CN111304299A

CN111304299A - Primer combination, kit and method for detecting copy number variation of autosome

Info

Publication number: CN111304299A
Application number: CN201911270317.6A
Authority: CN
Inventors: 郑乔松; 师晓; 谭达; 李乐; 李光宇; 焦宇辰; 王思振
Original assignee: Genetron Health Beijing Co ltd
Current assignee: Genetron Health Beijing Co ltd
Priority date: 2019-12-11
Filing date: 2019-12-11
Publication date: 2020-06-19
Anticipated expiration: 2039-12-11
Also published as: CN111304299B

Abstract

The invention discloses a primer combination, a kit and a method for detecting autosomal copy number variation. The invention firstly provides a primer combination for detecting the copy number variation of the autosome, which comprises the following components: a Barcode primer, an upstream primer, a downstream outer primer and a downstream inner primer. The invention further discloses a method for detecting the copy number variation of the autosomal chromosomes. The invention takes the retrotransposon region as the specific target amplification region, can cover the region to enrich the whole genome by designing limited one to several pairs of primers, can truly reflect the copy number level of each region of different chromosomes, constructs an amplicon library by combining a one-step method, and avoids sample pollution, so that the method for detecting the autosomal copy number variation has the characteristics of simple operation, high sensitivity, high accuracy and low cost, and can truly realize the application of the chromosome copy number detection method in actual detection.

Description

Primer combination, kit and method for detecting copy number variation of autosome

Technical Field

The invention relates to the field of biotechnology. In particular to a primer combination, a kit and a method for detecting the copy number variation of autosomes.

Background

Research shows that the occurrence of tumors is related to the activation of proto-oncogenes and the inactivation of cancer suppressor genes, and the chromosomal Copy Number Variation (CNV) plays an important role in the occurrence and development of tumors. The amplification or deletion of chromosomes can cause the copy number of some proto-oncogenes to be increased or the copy number of cancer suppressor genes to be reduced, so that the expression of related genes is influenced, and the variation of the chromosome copy number exists in a plurality of tumors and is an important index of canceration of cells.

The existing CNV detection technologies include various technologies, such as fluorescence in situ hybridization, microarray technology, SNP typing chip, oligonucleotide microarray analysis technology, multiplex ligation probe amplification technology, and whole genome sequencing technology based on a new generation high throughput sequencing platform, and although the detection technologies are various, the application and popularization of chromosome copy number variation detection are limited due to limited detection region, complicated operation process, poor stability, low sensitivity, or too high detection cost. Wherein: the whole genome sequencing based on the second-generation sequencing is the most effective and accurate technology for detecting the copy number variation of the chromosome, and can truly reflect the copy number level of different regions of the chromosome, but the biggest problem of the technology is that the detection cost is too high, so that the technology cannot be widely applied in practice; the SNP typing chip analyzes the difference of copy numbers by comparing the strength of the hybridization signal of the DNA to be detected with the average value of the hybridization signal of a control microarray, and has the defects of unbalanced SNP distribution in a high-density chip, relatively poor density of SNP probes in a repetitive region and a complex region, insufficient definition, poor detection effect and higher cost of the detection mode; the multiple connection probe amplification technology is characterized in that two adjacent probes are designed according to a target site, the 5' ends of all the probes are connected with a universal primer, and the detection of the copy number is realized by comparing the difference between a sample to be detected and a control sample; the fluorescence in situ hybridization technology is a classical cytology detection technology, and the detection technology is also a probe designed for a known specific region, can be used for positioning and accurately quantifying a target region, but has low detection flux and high cost, and requires rich experience of detection personnel; however, other detection techniques such as RT-qPCR compare the target gene and the reference gene for relative quantification and detect the abundance of the relative copy number, but suffer from low throughput and limited detection regions, and are difficult to be practically applied in the aspect of chromosomal copy number variation.

Disclosure of Invention

The invention aims to solve the technical problem of how to detect the copy number variation of the autosome quickly and at low cost.

In order to solve the above technical problems, the present invention provides a primer set for detecting an autosomal copy number variation.

The primer combination for detecting the copy number variation of the autosomal chromosome comprises the following components: a Barcode primer, an upstream primer, a downstream outer primer and a downstream inner primer;

the Barcode primer comprises a sequencing joint 1, a Barcode sequence and a universal sequence 1 which are sequentially arranged, wherein the Barcode sequence and the universal sequence are used for distinguishing different samples;

the upstream primer comprises a universal sequence 1 and an upstream specific primer sequence which are sequentially arranged;

the downstream outer primer comprises a sequencing joint 2 and a universal sequence 2 which are sequentially arranged;

the downstream inner primer comprises a universal sequence 2 and a downstream specific primer sequence which are sequentially arranged;

the upstream specific primer sequence and the downstream specific primer sequence are designed according to a target retrotransposon region and are used for amplifying the retrotransposon region.

In the above primer combination, optionally, the upstream primer includes a universal sequence 1, a molecular tag and an upstream specific primer sequence arranged in sequence;

further, the molecular tag is 6-30nt in length and consists of M random bases and at least one group of specific bases, wherein M is a natural number which is greater than or equal to 6 and less than or equal to 15; the molecular tags are sequences of different initial template molecules for marking PCR amplification of the target retrotransposon region, and one molecular tag corresponds to one initial template molecule.

In the molecular tag sequence, the specific base is arranged in a random base; setting, for example, 1 group or 2 groups; the specific bases of each group consist of 1 to 5 bases, for example, 3 or 4. In one library construction process, the base type (A, T, G, C) of random bases in the molecular tag sequence is randomly selected except that the position and composition of specific bases are fixed.

In the primer combination, the length of the barcode sequence is 6-12nt, the GC content is 30-70%, and no obvious secondary structure exists.

In the above primer combination, the sequencing adaptor 1 and the sequencing adaptor 2 are sequencing adaptors selected according to different sequencing platforms, and further, optionally, the sequencing platform is Illumina platform, and the sequencing adaptor 1 and the sequencing adaptor 2 are P5 and P7, respectively; optionally, the sequencing platform is an Ion Torrent platform, and the sequencing linker 1 and the sequencing linker 2 are a and P, respectively.

In the primer combination, the length of the universal sequence 1 and the length of the universal sequence 2 are both 15-25 nt. The downstream of the Barcode primer and the upstream of the upstream primer comprise a universal sequence 1, and the Barcode primer and the upstream primer can be bridged through the universal sequence 1, so that the Barcode primer can amplify an amplification product of the upstream primer; the downstream of the downstream outer primer and the upstream of the downstream inner primer comprise a universal sequence 2, and the downstream outer primer and the downstream inner primer can be bridged by the universal sequence 2, so that the downstream outer primer can amplify the amplification product of the downstream inner primer.

In a specific embodiment of the present invention, the sequence of the universal sequence 1 is: TCTGTACGGTGACAAGGCG (SEQ ID No. 3); the sequence of general sequence 2 is: CTATGGGCAGTCGGTGAT (SEQ ID No. 4).

In the invention, the retrotransposon can be determined according to actual conditions, and can be, for example, Line-1; when the retrotransposon region is Line-1, the corresponding upstream-specific primer sequence and downstream-specific primer sequence can be 5'-ACACAGGGAGGGGAAC-3' (SEQ ID No.1) and 5'-TGCCATGGTGGTTTGC-3' (SEQ ID No.2), respectively (including but not limited to these two primer sequences).

In the primer combination, the sample can be genomic DNA extracted from urinary sediment cells or genomic DNA extracted from isolated tumor tissues.

The invention also provides a kit for detecting the copy number variation of the autosome, which comprises the primer combination.

The kit also comprises a data processing system.

In the kit, the data processing system can analyze data and judge the variation condition of the chromosome copy number.

The invention also provides application of the primer combination or the kit in detecting the copy number variation of the autosome.

The invention also provides a method for detecting the copy number variation of the autosome, which comprises the following steps:

constructing a reference set and a training set; wherein the reference set comprises a plurality of healthy people, and the training set comprises a plurality of positive samples and a plurality of negative samples;

constructing a standard set, a training set and an amplicon library of a sample to be detected by using the primer combination or the kit;

and sequencing the amplicon library, performing data analysis according to a sequencing result, and judging whether the chromosome copy number variation occurs in the sample to be detected.

In the above method, the data analysis method includes:

preprocessing the sequencing result of the reference set to obtain the position of an amplicon and sequencing depth data thereof, and constructing a reference data set;

preprocessing the sequencing results of the training set and the sample to be tested, obtaining amplicons of the training set and the sample to be tested respectively intersected with the training set and the sample to be tested and sequencing depth data thereof by taking a reference data set as a contrast, obtaining Zscore on each chromosome arm level of the training set and the sample to be tested according to the sequencing depth data, dividing a positive threshold interval according to the distribution difference of Zscore values of positive samples and negative samples on each chromosome arm in the training set, and then judging whether the sample to be tested has chromosome copy number variation or not by using the positive threshold interval.

In the above method, the pretreatment method comprises: at least one of aligned, filtered, or data volume normalized to a reference genome.

In the above method, the method for constructing the reference data set includes: taking a log2 value of the sequencing depth of each amplicon in the standard set amplification library, and then taking an average value and a standard deviation;

in the above method, the average value is calculated by: for example, the sequencing depth of the ith amplicon in the reference set amplification library is the average value (μ i) after log2, and the calculation formula is as follows:

wherein xi is the sequencing depth of the ith amplicon in the amplicon library of the normal sample and is taken as the log2 value; n is the total number of the reference set samples;

in the above method, the method for calculating the standard deviation is as follows: the standard deviation (σ) after log2 values was taken for the sequencing depth of each amplicon in the amplicon library for the reference set, and calculated as follows:

taking log2 value as the sequencing depth of the ith amplicon in the amplicon library with xi as the reference set;

taking the mean value after log2 value for the sequencing depth of all amplicons in the amplicon library of the reference set; n is a reference set sampleThe total number of books;

in the above method, the formula for the Zscore calculation at each chromosome arm level of the training set and the sample to be tested is:

wherein, assuming that the amplicon on a single chromosome arm is (mu 1.. mu 1), Zj is the Zscore value, mu, of the jth chromosome arm in the amplicon library of each sample to be tested or each training set sample_iTaking the mean value after log2 value, sigma, for the sequencing depth of the ith amplicon in the amplicon library of the reference set_iThe standard deviation after log2 was taken as the sequencing depth of the ith amplicon in the library of amplicons of the reference set, and 1 is the number of amplicons on the jth chromosome arm.

In the above method, the negative samples in the reference set and the training set are derived from healthy persons, which are clinically diagnosed as non-cancer persons as opposed to positive samples.

In the above method, the negative samples in the training set can be used as a reference set.

In the method, the total number of samples in the training set is greater than or equal to 30, and the total number of samples in the reference set is greater than or equal to 10.

The method for detecting the copy number variation of the autosomal chromosomes has the following advantages:

1. high stability and sensitivity: the retrotransposon region is used as a specific amplification target region, and the region can be covered by designing limited one to several pairs of primers to enrich the whole genome, so that the copy number level of each region of different chromosomes can be truly reflected, and the accuracy is close to the level of WGS;

2. high accuracy: good coverage of the transposon region on a genome range is reversed, an amplicon library is constructed by a one-step method, sample pollution is avoided, and accurate quantification of chromosome copy number with tumor purity as low as 1% can be realized;

3. the detection cost is low: constructing an amplicon library, NGS sequencing with ultra-low data volume (400 Mbp/sample) by one-step method, wherein the total detection cost is at least one order of magnitude lower than that of whole genome sequencing;

4. the operation is simple: the library construction can be completed only by simple common PCR, magnetic bead purification and Qubit quantification, the requirement on operators is extremely low, and the subsequent collocation is an automatic on-machine sequencing process;

5. the detection period is short: the method can quickly establish a library and carry out NGS sequencing by one step, and can obtain a chromosome copy number detection result within 3 days at the fastest speed.

Drawings

FIG. 1 is a diagram showing a PCR product distribution diagram obtained by Agilent2200tape station Systems after library construction, wherein the abscissa is fragment length, the ordinate is signal intensity (FU), the lower peak is 25bp position marker, and the upper peak is 1500bp position marker.

FIG. 2 shows the size of the region of the genome covered by the amplicon at different sequencing depths.

FIG. 3 is the number of amplicons at different sequencing depths; the abscissa is the amount of sequencing data and the ordinate is the number of amplicons.

FIG. 4 shows the average number of amplicons on each chromosome when the amount of sequencing data was 400M or more.

FIG. 5 is a density profile of the length of the insert (amplification product with sequencing adaptors, barcode sequences and molecular tag sequences removed).

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures used in the following examples are all conventional procedures unless otherwise specified. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.

Example 1 establishment of detection of frequently stained copy number variation

Design synthesis of primer combination

Designing a primer combination according to the target retrotransposon region, wherein the primer combination comprises the following primer combinations:

barcode primer (F1): the sequencing joint 1+ is used for distinguishing barcode sequences of different samples + universal sequences 1;

upstream primer (F2): a general sequence 1+ a molecular tag sequence + an upstream specific primer sequence;

optionally, the upstream primer (F2) is: a universal sequence 1+ upstream specific primer sequence;

downstream outer primer (R1): sequencing linker 2+ universal sequence 2;

downstream inner primer (R2): a universal sequence 2+ downstream specific primer sequence;

In the molecular tag sequence, the specific base is arranged in a random base; sets are, for example, 1 group, 2 groups, and 3 groups; the specific bases of each group consist of 1 to 5 bases, for example, 3 or 4. In one library construction process, the base type (A, T, G, C) of random bases in the molecular tag sequence is randomly selected except that the position and composition of specific bases are fixed.

A barcode sequence corresponds to a sample to be detected, and the barcode sequence is a sequence for distinguishing different samples to be detected; the number of barcode sequences can be designed according to the number of samples to be detected; the length of the barcode sequence is 6-12nt, the GC content is 30-70%, and no obvious secondary structure exists;

the upstream specific primer sequence and the downstream specific primer sequence are designed according to the target retrotransposon region, the upstream specific primer sequence is specifically combined with the upstream of the target retrotransposon region, and the downstream specific primer sequence is specifically combined with the downstream of the target retrotransposon region. For example, when the retrotransposon sequence is Line-1, the upstream specific primer sequence can be 5'-ACACAGGGAGGGGAAC-3' (SEQ ID No.1) and the downstream specific primer sequence can be 5'-TGCCATGGTGGTTTGC-3' (SEQ ID No. 2).

The universal sequence 1 and the universal sequence 2 are universal sequences with different nucleotide sequences, the length of the universal sequences is 15-25nt, the sequences can be changed according to needs, for example, the universal sequence 1 can be TCTGTACGGTGACAAGGCG (SEQ ID No. 3); the universal sequence 2 may be CTATGGGCAGTCGGTGAT (SEQ ID No. 4).

The sequencing joint 1 and the sequencing joint 2 are sequencing joints with different nucleotide sequences, are joint sequences required by sequencing, and are determined according to a sequencing platform:

if the sequencing platform is the Illumina platform, sequencing linker 1 and sequencing linker 2 are P5 and P7, respectively.

If the sequencing platform is Ion Torrent platform, sequencing linker 1 and sequencing linker 2 are A (CCATCTCATCCTGCGTGTCCCGACTCAG) and P (CCTCCTATGGGCAGTCGGTGAT), respectively.

Secondly, a construction method of the amplicon library:

1. constructing a reference set and a training set, and extracting genome DNA of a sample to be detected, a reference set sample and a training set sample; the F1, F2, R1 and R2 primers are dissolved in water with the same volume for standby.

2. The PCR amplification of gDNA was performed using Barcode primers and primers mix (F2, R2, R1 in a 1: 5 volume ratio) for each sample, and the reagents shown in Table 1 below were added sequentially to 0.2ml of eight-row tubes or 96-well plates:

TABLE 1 PCR reagents

In the PCR amplification system, the molar ratio of the Barcode primer F1, the upstream primer F2, the downstream outer primer R1 and the downstream inner primer R2 is as follows: the molar ratio of F1: R1: F2: R2 is 5: 2: 1.

3. A PCR reaction solution was obtained by running the program shown in Table 2 below on a PCR machine (the PCR machine used in 2720Thermal Cycler from Applied bio-system).

TABLE 2 PCR reaction procedure

4. And (3) sucking 1-fold volume of the PCR reaction solution by using a pipette gun to purify and recover a PCR product, namely completing the construction of an amplicon library of a control sample, a normal sample and a sample to be detected.

The specific purification steps are as follows:

1) taking the Agencour AMPure XP Kit out 30 minutes in advance, fully vortexing, and standing at room temperature.

2) After the PCR reaction is finished, the magnetic beads are fully vortexed again, 24 mu l of magnetic beads are added into the system, the system is repeatedly blown and beaten for more than 5 times or fully vortexed, and the system is kept standing for 5 minutes at room temperature.

3) The EP tube was transferred to a magnetic stand and left to stand for 5 minutes until the solution cleared, and the supernatant was carefully removed with a pipette gun, taking care not to touch the beads.

4) Add 100. mu.l of freshly prepared 80% ethanol solution per tube, place the EP tube on a magnetic frame and rotate slowly for 2 cycles, stand for 5m, and discard the supernatant.

5) Repeating the step 4) once.

6) The EP tube is opened and kept stand at room temperature to ensure that the liquid is completely volatilized, and the magnetic beads are not dried excessively based on the fact that the surfaces of the magnetic beads are matt.

7) The EP tube was removed from the magnetic stand, 30. mu.l of PCR-grade purified water was added, vortexed and mixed, and then allowed to stand at room temperature for 10 minutes.

8) And (3) placing the EP tube on a magnetic frame for 2 minutes or after the solution is clarified, carefully sucking the supernatant on the side away from the magnet by using a pipette gun, and obtaining a purified PCR product without touching the magnetic bead.

At this point, the amplicon library construction is complete.

5. Sequencing, alignment, filtering and data normalization processing

The library of amplicons obtained as described above is subjected to sequencing, for example, using Proton or Illumina.

And (3) comparison: and (3) performing sequence alignment on the sequencing result data and the reference genome (for example, using alignment software bwa0.7.10), obtaining the position information and the sequencing depth of each amplicon on the reference genome in the amplicon libraries of the training set, the reference set and the sample to be tested, and filtering out the amplicons which are not covered in any sample.

And filtering according to the comparison result, wherein the filtering conditions are as follows:

1) removing the amplicon with the length less than 60 bp;

2) removal of amplicon sequencing depth less than 5X in any one sample but greater than 50X in any other sample;

3) counting the sequencing depth distribution variance of all the amplicons in all samples to be detected, and removing the amplicons with the variance of 2 percent at most;

4) and (3) eliminating noise among experimental batches and samples by using quantile normalization, and then reducing noise aiming at the problem that short fragments can cause amplification deviation, namely removing part of amplicons which can introduce deviation according to the sequencing depth density distribution of the amplicons.

Optionally, data normalization processing is performed on the sequencing depths of the amplicons of the reference set, the training set, and the sample to be tested, so as to offset the sequencing depth deviation of the amplicons caused by the initial data amount. For example, taking a reference set sample as an example, the normalization method specifically includes: calculating the average value of the sequencing depths of the amplicons of all the samples of the reference set, dividing the sequencing depth of each sample amplicon by the average value to obtain a multiple relation of the sequencing depths of the amplicons of the samples relative to all the samples of the reference set, and dividing the sequencing depth of the amplicons of the samples by the multiple relation to obtain the normalized sequencing depth.

6. And calculating the sequencing depth of each amplicon after the amplicon library of the reference set is subjected to data normalization treatment, and taking the average value and the standard deviation after the log2 values as the reference of the training set and the sample to be detected.

The mean value (μ i) after log2 values was taken for the sequencing depth of the ith amplicon in the amplicon library of the reference set, and calculated as follows:

taking log2 value as the sequencing depth of the ith amplicon in the amplicon library with xi as the reference set; n is the total number of the reference set samples;

the standard deviation (σ) after log2 values was taken for the sequencing depth of each amplicon in the amplicon library for the reference set, and calculated as follows:

taking the mean value after log2 value for the sequencing depth of all amplicons in the amplicon library of the reference set; n is the total number of samples of the reference set;

7. defining CNV positive signal threshold and judging whether CNV occurs in sample to be detected

And respectively taking the intersection of the amplicon obtained after data quantity normalization processing in the amplicon libraries of the training set and the sample to be detected and the amplicon of the reference set, and taking the intersection as the amplicon for calculating the sample to be detected and the training set CNV.

Wherein, for the Zscore of the ith amplicon in the amplicon library of the training set or the sample to be detected, the calculation formula is as follows:

wherein Ri is the Zscore value, Depth, of the ith amplicon in the amplicon library of each sample to be tested or each sample of the training set_iTaking log2 value, mu, of sequencing depth of ith amplicon in amplicon library of each sample to be tested or each sample of training set_iThe log2 value mean, σ, of the sequencing depth of the ith amplicon in the amplicon library of the reference set sample_iThe standard deviation after log2 values was taken for the sequencing depth of the ith amplicon in the amplicon library of the training set samples.

According to the above calculation method of the Zscore of the amplicon, for the calculation method of the Zscore at the level of a single chromosome arm of each training set sample or each sample to be tested, it is assumed that the amplicon existing on a certain chromosome arm is μ 1.. μ l, and the calculation formula of the Zscore at the level of the chromosome arm is obtained as follows:

wherein Zj is the Zscore value, mu, of the jth chromosome arm of each sample to be tested or each training set sample_iTaking the mean value after log2 value, sigma, for the sequencing depth of the ith amplicon in the amplicon library of the reference set sample_iThe standard deviation after log2 value was taken for the sequencing depth of the ith amplicon in the amplicon library of the reference set sample, and 1 is the number of amplicons on the jth chromosome arm.

Positive threshold intervals were defined according to the differences in the distribution of the Zscore values at the level of individual chromosome arms in the amplicon library of positive and negative samples in the training set. The positive threshold interval is used to determine whether CNV has occurred, and the type of CNV, for example, whether CNV is amplified or deleted, may be further determined based on the positive threshold interval. The selection of the positive threshold interval is based on the Zscore values of the positive and negative samples in the training set, e.g., the positive threshold interval determined when 99.5% or more of the positive or negative samples are detected can be selected.

Judging whether CNV occurs according to the positive threshold interval and the Zscore value of each chromosome arm level in the amplicon library of the sample to be detected, and when the Zscore value of a single chromosome arm level is in the positive threshold interval of the corresponding chromosome arm, indicating that no CNV occurs; indicating the occurrence of CNV when the Zscore value is not within the positive threshold interval of the corresponding chromosome arm at the level of the single chromosome arm, and indicating the type of CNV is amplification when the Zscore value is greater than the upper limit of the positive threshold interval; when the Zscore value is less than the lower limit of the positive threshold interval, then the type of CNV is absent.

Example 2 detection of frequently-stained copy number variation of genomic DNA in urinary sediment of bladder cancer

1. Construction of amplicon libraries

1) Design of primers

The primer set comprises the following primers:

barcode primer (F1): sequencing joint 1+ barcode sequence + universal sequence 1;

upstream primer (F2): a general sequence 1+ a molecular tag + an upstream specific primer sequence;

downstream outer primer (R1): sequencing linker 2+ universal sequence 2;

the sequence of sequencing linker 1 is: CCATCTCATCCCTGCGTGTCTCCGACTCAG, respectively;

the sequence of general sequence 1 is: TCTGTACGGTGACAAGGCG, respectively;

the sequence of sequencing linker 2 is: CCTCTCTATGGGCAGTCGGTGAT, respectively;

the sequence of general sequence 2 is: CTATGGGCAGTCGGTGAT, respectively;

the upstream specific primer sequence and the downstream specific primer sequence are 5'-ACACAGGGAGGGGAAC-3' and 5'-TGCCATGGTGGTTTGC-3', respectively.

The lengths of the barcode sequences are 8-12, and the total length is 115 barcode sequences;

the number of random bases of the molecular tag is 9, the specific bases are 2 groups, ACT and TGA are respectively, and the molecular tag is NNNNACTNNNNNTGA.

2) Construction of amplicon library of reference set, training set and sample to be tested

Constructing a reference set: 10 healthy people.

Constructing a training set: 30 healthy persons were used as negative samples and 30 patients with bladder cancer with clear pathology were used as positive samples.

A sample to be detected: urinary sediment from 45 clinical specimens (including 30 positive bladder cancer samples and 15 negative bladder cancer samples)

Genomic DNA in bladder cancer urinary sediment of a sample to be detected, a reference set sample and a training set sample is extracted according to the method in the embodiment 1, and amplification and purification are carried out according to the method in the embodiment 1, so that an amplicon library for constructing the reference set sample, the training set sample and the sample to be detected is finally obtained. After the amplicon library is constructed, taking one of the training set samples as an example, the distribution of the amplification products obtained by Agilent2200tape station Systems (see FIG. 1) is detected, and the length of each amplicon in the amplicon library is within the range of 200-220 bp.

2. Sequencing the amplicon libraries of the reference set, the training set and the sample to be detected, and comparing the sequence with the reference genome (bwa 0.7.10) to obtain the position information and sequencing depth of each amplicon of the reference set, the training set and the sample to be detected on the reference genome, filtering out the amplicons which are not covered in any sample, and obtaining about 12000 common amplicon subsets of the samples. FIG. 2 shows the size of the region covered by the amplicon on the genome at different sequencing depths, and it can be seen that the region covered by the amplicon on the genome becomes larger as the sequencing depth increases.

The situation for the filtered amplicons is shown in FIG. 3: the number of amplicons was 8000 to 12000 (the number of amplicons was about 12000 in the plateau region in the case of about 400M data amount, which was positively correlated with the data amount), and the coverage on the genome was about 1M to 1.5M. The average depth of coverage at 400M data volume was about 190X and there were a large number of low coverage amplicons. The amplicons are distributed discretely on each chromosome, and generally the longer the chromosome the more amplicons it contains, as shown in FIG. 4, but there is no coverage on 13p, 14p, 15p and 21 q. The sizes of the amplicon inserts are in typical bimodal distribution (124 bp; 142bp), and the amplicon of the small insert is obviously more than that of the long insert, which shows that the amplification efficiency has obvious preference on the small insert. FIG. 5 is a density profile of the length of the amplicon insert (PCR product with sequencing adaptor, barcode sequence and molecular tag sequence removed).

Filtering the amplicons under the conditions shown in example 1 to obtain about 5000 amplicons; the number of amplicons fluctuates slightly with the specific sample and the experimental batch, and is a normal sample and experimental noise.

The sequencing depths of the amplicons of the reference set, the training set and the sample to be tested obtained above were normalized according to the method described in example 1.

3. Zscore calculation

Library of amplicons for the reference set:

and calculating the sequencing depth of each amplicon obtained after the data normalization treatment of the amplicon library of 10 samples in the reference set, and taking the average value and standard deviation after log2 values as the reference of the training set and the sample to be detected.

The mean value (μ i) after log2 values was taken for the sequencing depth of the ith amplicon in the reference set amplicon library and calculated as follows:

taking log2 value as the sequencing depth of the ith amplicon in the amplicon library with xi as the reference set; n is 10;

taking the standard deviation (σ) after log2 values for the sequencing depth of each amplicon in the reference set amplicon library, the calculation formula is as follows:

for the training set and amplicon library of the samples to be tested:

and taking intersection of the amplicon obtained after carrying out data quantity normalization processing on the sequencing depth of each amplicon in the amplicon library of the training set and the sample to be detected and the amplicon of the normal sample as the amplicon for calculating the CNV of the training set and the sample to be detected.

For the amplicon library of the training set:

the log2 value Zscore for the sequencing depth of the ith amplicon in the amplicon library for each training set sample was calculated as follows:

where Ri is the Zscore value, Depth, of the ith amplicon in the amplicon library for each training set sample_iLog2 value, μ, for sequencing depth of the ith amplicon in the amplicon library for each training set sample_iIs the mean value after log2 of the sequencing depth of the ith amplicon in the amplicon library of the reference set, σ_iThe standard deviation after log2 values was taken for the sequencing depth of the ith amplicon in the library of reference set amplicons.

According to the above calculation method of the Zscore of the amplicon, for the Zscore at the level of a single chromosome arm in the amplicon library of each training set sample, the amplicon on a certain chromosome arm is assumed to be μ 1.. μ l, and the calculation formula of the Zscore at the level of the chromosome arm is as follows:

where Zj is the Zscore value, μ, for the jth chromosome arm in the amplicon library of each training set sample_iTaking the mean value after log2 value, sigma, for the sequencing depth of the ith amplicon in the reference set amplicon library_jThe standard deviation after log2 was taken for the sequencing depth of the ith amplicon in the library of reference set amplicons, and 1 is the number of amplicons on the jth chromosome arm.

Delineation of CNV positive signal threshold:

positive threshold intervals were defined as the difference in the distribution of Zscore values at the level of individual chromosome arms in the amplicon library of the training set positive and negative samples. The positive threshold interval is used to determine whether CNV has occurred, and the type of CNV, for example, whether CNV is amplified or deleted, may be further determined based on the positive threshold interval. The selection of the positive threshold interval is selected according to the Zscore value of the control sample, for example, the positive threshold interval determined when 99.5% or more of the positive samples of the training set are detected can be selected.

According to the calculation results of the above method, the positive threshold values as shown in Table 3 were determined.

For example, no variation occurs when the value of Zscore is in the range of-1 to 1 on 1p, amplification occurs when the value of Zscore is greater than 1, and deletion occurs when the value of Zscore is less than-1.

TABLE 3 Positive threshold for determination of different chromosomes

For the amplicon library of test samples, the Zscore values on each chromosome arm were calculated as for the training set samples described above, and the results are shown in table 4 (table 4 provides the Zscore values on each chromosome arm for one positive test sample and one negative test sample in the test sample). Whether CNV occurs in each chromosome arm is judged according to the positive threshold interval in Table 3. The frequency of positive CNVs of each chromosome arm in all samples to be tested was finally obtained, wherein the results of 30 positive bladder cancer samples are shown in table 5 (table 5 provides the frequency of positive CNVs of each chromosome arm in 30 bladder cancer patients in the samples to be tested), and the results show that all bladder cancer positive patients have autosomal copy number variation of different degrees.

TABLE 4 Zscore values on individual chromosome arms for one test positive and one test negative sample

Chromosome arm	RH049TU1	RH328TU1
			Pathology of disease	Positive for bladder cancer	Negative for bladder cancer
1p	-5.02 deletion	0.01NA
			1q	0.43NA	-0.05NA
2p	0.17NA	-0.03NA
			2q	-0.06NA	0.18NA
3p	0.39NA	0.06NA
			3q	0.70NA	0.22NA
4p	0.47NA	-0.05NA
			4q	0.26NA	0.07NA
5p	-0.05NA	-0.06NA
			5q	-0.19NA	-0.10NA
6p	0.42NA	0.20NA
			6q	0.37NA	-0.04NA
7p	0.65NA	0.19NA
			7q	0.31NA	0.05NA
8p	0.28NA	0.15NA
			8q	0.46NA	0.14NA
9p	-3.73 deletion	0.00NA
			9q	-4.99 deletion	-0.08NA
10p	0.39NA	-0.08NA
			10q	0.22NA	-0.18NA
11p	0.13NA	-0.05NA
			11q	-0.33NA	0.14NA
12p	0.30NA	0.03NA
			12q	0.21NA	0.07NA
13q	0.61NA	-0.03NA
			14q	0.27NA	-0.10NA
15q	0.10NA	0.04NA
			16p	0.04NA	-0.05NA
16q	-0.01NA	-0.07NA
			17p	-3.40 deletion	-0.31NA
17q	0.30NA	-0.05NA
			18p	-0.26NA	-0.23NA
18q	-0.32NA	0.05NA
			19p	-0.37NA	-0.56NA
19q	0.33NA	-0.07NA
			20p	2.90 amplification	0.04NA
20q	3.25 amplification	-0.23NA
			21q	0.29NA	-0.05NA
22q	-0.10NA	-0.21NA
			Discrete value	33.06	4.30

TABLE 530 frequency of positive CNV in each chromosome arm in bladder cancer patients

Chromosome arm	Amplification of	Absence of
			1p	2	3
1q	10	0
			2p	4	2
2q	3	5
			3p	7	4
3q	4	0
			4p	2	4
4q	0	5
			5p	9	3
5q	1	7
			6p	2	2
6q	2	4
			7p	3	0
7q	6	1
			8p	5	3
8q	5	0
			9p	0	15
9q	1	12
			10p	2	1
10q	1	5
			11p	0	12
11q	0	15
			12p	5	0
12q	5	1
			13q	4	3
14q	3	2
			15q	1	3
16p	3	1
			16q	0	4
17p	1	3
			17q	6	0
18p	7	0
			18q	4	2
19p	1	0
			19q	3	2
20p	9	0
			20q	6	0
21q	6	1
			22q	1	5
Total of	134	130

Example 3 autosomal Copy Number Variation (CNV) of LINE-1 Gene from brain cancer patients

Constructing a brain cancer training set: 30 healthy persons were used as negative samples and 50 patients with brain cancer with clear pathology were used as positive samples.

The samples to be tested were fresh surgical tumor tissue samples of 7 patients with brain cancer.

First, amplicon library construction

1. Synthesis of primers

TABLE 6 primer sequences

Note: the barcode sequence corresponds to the 7 samples to be tested.

2. Genomic DNA of the above training set of brain cancer and fresh surgical tumor tissue samples of 7 patients with brain cancer was extracted according to the method of example 1, and amplified and purified according to the method of example 1 to finally obtain an amplicon library of the training set and the samples to be tested.

3. Comparing and filtering

Sequencing the amplicon library of the training set and the sample to be detected, comparing the sequencing result data with the reference genome (bwa 0.7.10), determining the position information and the sequencing depth on the reference genome, and finally obtaining 11581 amplicons.

Comparing the results, filtering according to the method described in example 1 to obtain 5037 amplicons;

and carrying out data quantity-based normalization treatment on the sequencing depth of each amplicon in the amplicon library of the sample to be detected so as to offset the sequencing depth deviation of the amplicons caused by the initial data quantity.

4. Zscore calculation of samples to be tested

Taking the intersection of the amplicons of the training set and the sample to be tested obtained after the step 3 and the amplicons of the reference set constructed in the embodiment 2 as the amplicons for calculating the CNV of the sample to be tested, wherein the total number of the amplicons is 5029.

Following the procedure of example 1, a distribution of Zscore values at the level of a single chromosome arm was obtained for the positive and negative samples of the training set, with positive samples having a positive threshold interval of 99.5% and regions similar to those of example 2, so the positive thresholds were selected as shown in table 3.

Zscore at the level of each chromosome arm of the test sample was calculated according to the method described in example 1, and CNV determination was performed using the positive threshold intervals of determination of different chromosomes as described in table 3 of example 2, and the specific results are shown in table 7.

TABLE 7 Zscore values and CNV profiles at the level of each chromosome arm of the samples tested

The Fluorescence In Situ Hybridization (FISH) and the whole genome off-target detection (WGS) are used for detecting the CNV of the short arm of the chromosome 1 and the long arm of the chromosome 19 of the sample to be detected, and the result is shown in Table 8, which shows that the method of the invention is completely consistent with the result of the WGS detection, but the FISH and the two methods are different by only one example, thereby fully embodying the accuracy of the method of the invention.

TABLE 8 comparison of the method of the invention with the WGS, FISH method

The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.

SEQUENCE LISTING

<110> Beijing Panshengzi Gene science and technology Co., Ltd

<120> a primer combination, kit and method for detecting autosomal copy number variation

<130>GNCFY191822

<160>4

<170>PatentIn version 3.5

<210>1

<211>16

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

acacagggag gggaac 16

<210>2

<211>16

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

tgccatggtg gtttgc 16

<210>3

<211>19

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

tctgtacggt gacaaggcg 19

<210>4

<211>18

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ctatgggcag tcggtgat 18

Claims

1. A primer combination for detecting an autosomal copy number variation, comprising: the primer combination comprises: a Barcode primer, an upstream primer, a downstream outer primer and a downstream inner primer;

2. The primer combination of claim 1, wherein: the upstream primer comprises a general sequence 1, a molecular tag sequence and an upstream specific primer sequence which are sequentially arranged;

preferably, the length of the molecular tag sequence is 6-30nt, and the molecular tag sequence consists of M random bases and at least one group of specific bases, wherein M is a natural number which is greater than or equal to 6 and less than or equal to 15; the molecular tags are sequences of different initial template molecules for marking PCR amplification of the target retrotransposon region, and one molecular tag corresponds to one initial template molecule.

3. The primer combination of claim 1, wherein: the length of the barcode sequence is 6-12nt, the GC content is 30-70%, and no obvious secondary structure exists.

4. The primer combination of claim 1, wherein: the sequencing joint 1 and the sequencing joint 2 are corresponding sequencing joints selected according to different sequencing platforms; optionally, the sequencing platform is Illumina platform, and the sequencing linker 1 and the sequencing linker 2 are P5 and P7, respectively; optionally, the sequencing platform is an Ion Torrent platform, and the sequencing joint 1 and the sequencing joint 2 are respectively a and P;

preferably, the length of the universal sequence 1 and the length of the universal sequence 2 are both 15-25 nt.

5. The primer combination according to any one of claims 1 to 4, wherein: the retrotransposon is Line-1, and preferably, the upstream specific primer sequence and the downstream specific primer sequence are respectively shown as SEQ ID No.1 and SEQ ID No. 2.

6. A kit for detecting an autosomal copy number variation, comprising: comprising a primer combination according to any one of claims 1 to 5.

7. The kit of claim 6, wherein: a data analysis system is also included.

8. Use of a primer combination according to any one of claims 1 to 5 or a kit according to claim 6 or 7 for the detection of an autosomal copy number variation.

9. A method for detecting an autosomal copy number variation, comprising the steps of:

constructing a reference set and a training set; wherein the reference set comprises a plurality of healthy people, and the training set comprises a plurality of negative samples and a plurality of positive samples;

constructing an amplicon library of a reference set, a training set, and a test sample using the primer combination of any one of claims 1-5 or the kit of claim 6 or 7;

10. The kit of claim 7 or the method of claim 9, wherein the method of data analysis comprises: