CN111304108A - Leuconostoc lactis and application thereof - Google Patents

Leuconostoc lactis and application thereof Download PDF

Info

Publication number
CN111304108A
CN111304108A CN201910645660.8A CN201910645660A CN111304108A CN 111304108 A CN111304108 A CN 111304108A CN 201910645660 A CN201910645660 A CN 201910645660A CN 111304108 A CN111304108 A CN 111304108A
Authority
CN
China
Prior art keywords
fermented
vegetable
vegetables
leuconostoc lactis
preparation
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201910645660.8A
Other languages
Chinese (zh)
Other versions
CN111304108B (en
Inventor
何艳平
卢伟
赵楠
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Sichuan Laotanzi Food Co ltd
Original Assignee
Sichuan Laotanzi Food Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Sichuan Laotanzi Food Co ltd filed Critical Sichuan Laotanzi Food Co ltd
Priority to CN201910645660.8A priority Critical patent/CN111304108B/en
Publication of CN111304108A publication Critical patent/CN111304108A/en
Application granted granted Critical
Publication of CN111304108B publication Critical patent/CN111304108B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C12N1/205—Bacterial isolates
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L19/00—Products from fruits or vegetables; Preparation or treatment thereof
    • A23L19/20—Products from fruits or vegetables; Preparation or treatment thereof by pickling, e.g. sauerkraut or pickles
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L2/00—Non-alcoholic beverages; Dry compositions or concentrates therefor; Their preparation
    • A23L2/38—Other non-alcoholic beverages
    • A23L2/382—Other non-alcoholic beverages fermented
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS, OR NON-ALCOHOLIC BEVERAGES, NOT COVERED BY SUBCLASSES A21D OR A23B-A23J; THEIR PREPARATION OR TREATMENT, e.g. COOKING, MODIFICATION OF NUTRITIVE QUALITIES, PHYSICAL TREATMENT; PRESERVATION OF FOODS OR FOODSTUFFS, IN GENERAL
    • A23L29/00—Foods or foodstuffs containing additives; Preparation or treatment thereof
    • A23L29/065—Microorganisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20—Bacteria; Culture media therefor
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04—Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23V—INDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2002/00—Food compositions, function of food ingredients or processes for food or foodstuffs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/90—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in food processing or handling, e.g. food conservation

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Microbiology (AREA)
  • Nutrition Science (AREA)
  • Food Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biomedical Technology (AREA)
  • Virology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Non-Alcoholic Beverages (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention discloses a leuconostoc lactis and application thereof. The Leuconostoc lactis is preserved in China center for type culture Collection with the preservation number of CCTCC M2019444. The enterococcus acidilactici CCTCC M2019444 has acid resistance and salt resistance, can grow well in the environment with pH4.0 and 6% NaCl, and can produce n-nonanol with high yield; the strain has good growth characteristics in bittern and vegetable juice; the strain has good acid production characteristics in bittern and vegetable juice, and the pH value is 5.58 after fermentation for 18 h; the results of detecting the n-nonanol content and the types of volatile flavor compounds in the fermented vegetables and fermented vegetable juice beverages prepared from the same show that the yield of the n-nonanol of the enterococcus acidus acidi lactici is improved by 60.49-61.53%, the aroma quality of the product is improved, the sensory quality of the product is improved, and the method has a wide application prospect in the field of fermented vegetable products.

Description

Leuconostoc lactis and application thereof
Technical Field
The invention relates to the technical field of microorganisms, in particular to a leuconostoc lactis and application thereof.
Background
The fermented food is a food processed and manufactured by using beneficial microorganisms, and has unique flavor, such as yoghourt, cheese, fermented glutinous rice, pickle, soy sauce, table vinegar, fermented soya beans, yellow wine, beer, wine and the like. Lactic acid bacteria are gram-positive bacteria which can metabolize carbohydrates into lactic acid and do not have a spore structure, most of the lactic acid bacteria are beneficial bacteria, different strains of the genus lactobacillus are widely used for food processing due to the special metabolic characteristics of the lactic acid bacteria, and the contribution to the fermented food processing industry in China is not insignificant.
And n-Nonanol (1-Nonanol, C)9H20O), one of the important flavor compounds in lactic acid fermented foods, generally imparts intense floral, fruity, grassy, fresh tallow notes to the food. Although only a trace amount of n-nonanol is contained in the fermented food, the fermented food can remarkably improve and enrich the flavor quality of the fermented food, and when the concentration of the n-nonanol reaches 0.9 mug/kg, the special aroma of the fermented food can be presented in the aspect of flavor sense, so that the aroma of the fermented food is more soft and abundant. In general, the n-nonanol yield during food fermentation is low, and in production, the flavor of fermented foods can be improved by adding or increasing endogenous production from an external source for the purpose of enhancing the flavor.
The improvement of the n-nonanol content realized by an exogenous addition mode often causes pollution due to impurities in exogenous additives, so that the safety of products is poor, the quality is unstable, the synthesis and extraction cost of the n-nonanol is high, and the natural flavor sensory quality is difficult to present, so that the large-scale production application of the exogenously added n-nonanol in the aspect of improving the flavor of fermented foods is limited. The n-nonanol extracted from natural products has the disadvantages of expensive raw materials and high production cost, so that the large-scale production application is limited.
Besides exogenous addition, endogenous production is also a way of producing n-nonanol. The endogenous production is that the n-nonanol is directly synthesized by a series of biochemical reactions in the fermentation process of microorganisms, the product is naturally released to the fermented food environment, the step of separation and purification is omitted, the method has the advantages of multiple types of microorganisms, fast growth, low cost of used raw materials, capability of biodegradation of the produced substances, mellow, soft and high acceptance degree of flavor, and better accords with the consumption trend of advocating natural products without addition, thereby becoming a hotspot in the field of recent related technology development.
In the food fermentation process, the variety of the lactobacillus capable of producing the n-nonanol is various, but the variety of the lactobacillus capable of achieving the ideal yield effect and the product aroma enhancement effect through fermentation is not developed yet.
Disclosure of Invention
The invention aims to provide the leuconostoc lactis which is preserved in China Center for Type Culture Collection (CCTCC) M2019444. The leuconostoc lactis has high n-nonanol production capacity and great industrial application value and application prospect.
It is a second object of the present invention to provide a biologically pure culture of the aforementioned Leuconostoc lactis.
The third object of the present invention is to provide a working fermentation broth containing the above-mentioned Leuconostoc lactis.
The fourth purpose of the invention is to provide a preparation method of the working leavening agent.
The fifth purpose of the invention is to provide a fermented food, which comprises the staphylococcus lactis. The fermented food is fermented vegetable or fermented vegetable juice beverage.
The sixth object of the present invention is to provide a method for preparing the above fermented vegetable.
The seventh object of the present invention is to provide a method for preparing the fermented vegetable juice beverage.
The eighth purpose of the invention is to provide an application of the leuconostoc lactis in preparation of food fermentation bacteria or fermented food.
The ninth purpose of the invention is to provide an application of the leuconostoc lactis in preparing n-nonanol.
The tenth object of the invention is to provide the application of the leuconostoc lactis in imparting any one or more of floral, fruity, green grass and fresh oil aroma.
In order to achieve the above purpose of the invention, the following technical scheme is adopted:
firstly, the leuconostoc lactis is provided, and is preserved in China center for type culture Collection with the preservation number of CCTCC M2019444. The leuconostoc lactis CCTCC M2019444 has acid resistance and salt resistance, and can grow well in an environment with pH4.0 and 6% NaCl; the strain has good growth characteristics in bittern and vegetable juice; the strain has good acid production characteristics in bittern and vegetable juice, and the pH value is 5.58 after fermentation for 18 h.
Next, a biologically pure culture of the aforementioned Leuconostoc lactis is provided. A biologically pure culture is defined as the progeny of a cell or a population of the same cell that has been grown in culture.
And providing the working leaven containing the leuconostoc lactis again. The working starter herein refers to a starter used for the actual production of a product directly by the scale-up culture of a mother starter or a seed starter. Preferably, the number of viable bacteria in the working starter is 109CFU/mL。
And provides a preparation method of the working leaven, which comprises the following steps:
s1 providing sterile skim milk;
weighing a certain mass of skim milk powder, glucose and glycerol, adding water to dissolve, sterilizing and cooling to obtain sterile skim milk;
s2 activating the S lactis;
taking a ring of the Leuconostoc lactis strain stored in a freeze-drying tube dissolved by sterile water by using an inoculating ring, scribing on an MRS agar culture medium plate, and culturing in an incubator until a single colony grows out to obtain a plate activated strain; the MRS agar culture medium is a lactic acid bacteria culture medium, is not necessarily limited to the MRS agar culture medium, and can be used for culturing all strains.
S3 preparing strain culture solution, adding sterile skim milk during centrifugal precipitation, and lyophilizing;
inoculating the plate activated strain obtained in the step into a triangular flask filled with a broth liquid culture medium in a ring manner, and placing the triangular flask in an incubator for constant-temperature culture to obtain a culture solution; centrifuging the culture solution at a controlled rotation speed, washing the precipitate obtained by centrifuging with a buffer solution, adding a sterile skim milk solution into the washed precipitate, performing vortex oscillation to resuspend thalli, introducing the strain culture solution into a glass ampoule bottle under a sterile condition, covering the bottle stopper, quickly freezing in a freezer, filling the glass ampoule bottle with a tray, and freeze-drying in a freeze dryer. Thus obtaining the working leaven containing the Leuconostoc lactis CCTCC M2019444. The buffer solution is preferably a sterile phosphate buffer solution.
And provides a fermented food comprising the above-mentioned leuconostoc lactis. The fermented food is a food processed and manufactured by using beneficial microorganisms, and has unique flavor, such as yoghourt, cheese, fermented glutinous rice, pickle, soy sauce, table vinegar, fermented soya beans, yellow wine, beer, wine and the like.
The fermented food is preferably a fermented vegetable or a fermented vegetable juice beverage.
The preparation steps of the fermented vegetable are as follows:
s1 vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning for later use, and disinfecting the vegetables with a disinfectant; then washing with clear water, and draining for later use; the disinfectant is preferably a disinfectant capable of forming hypochlorous acid or containing hypochlorous acid;
s2 preparation of brine
Taking a proper amount of seasoning, putting the seasoning into purified water, adding a proper amount of salt and sugar according to the volume of the water, heating and boiling, cooling, and cooling the boiled salt water to room temperature to obtain brine; the flavoring is preferably anise and pepper; the sugar is preferably glucose;
s3 preparation of vegetable bittern mixture
Adding the vegetables processed in the step S1 into the bittern obtained in the step S2 to obtain a vegetable bittern mixture;
s4 fermentation culture
And (4) inoculating the working leavening agent containing the leuconostoc lactis and the conventional leavening agent into the vegetable bittern mixture obtained in the step S3 according to a certain proportion, and controlling the temperature to ferment so as to obtain the fermented vegetable containing the leuconostoc lactis. The working leaven is the working leaven containing the leuconostoc lactis. The conventional leavening agent is preferably any one of conventional lactobacillus plantarum and leuconostoc mesenteroides or the combination of the two.
The preparation method of the fermented vegetable juice beverage comprises the following steps:
s1 vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning for later use, and disinfecting the vegetables with a disinfectant; then washing with clear water, and draining for later use; the disinfectant is preferably a disinfectant capable of forming hypochlorous acid or containing hypochlorous acid;
preparation of S2 vegetable serum
Taking a proper amount of vegetables and sugar, putting into purified water, and pulping in a pulping machine to obtain vegetable pulp; the sugar is preferably glucose; purified water is used to avoid the influence of mixed bacteria;
preparation of S3 fermentation base material
Inoculating the working starter culture containing the leuconostoc lactis and the conventional starter culture into the vegetable pulp obtained after the treatment in the step S2 according to a certain proportion, controlling the temperature to ferment, filtering to obtain clear liquid, and refrigerating to obtain a fermentation base material containing the leuconostoc lactis; the conventional leavening agent is preferably any one or the combination of two of conventional lactobacillus plantarum and leuconostoc mesenteroides;
blending of S4 fermented vegetable juice
Adding purified water into sugar with a certain mass, stirring at high speed for dissolving, sterilizing, and cooling to room temperature; adding a certain amount of fermentation base material into the solution, uniformly stirring, and adjusting the acidity value by using a proper amount of acid; the acid is preferably citric acid; the sugar is preferably sucrose;
s5 homogenizing and sterilizing
And (5) homogenizing the solution treated in the step (S4), sterilizing and cooling to obtain the fermented vegetable juice beverage containing the leuconostoc lactis.
And provides the application of the leuconostoc lactis in preparing food fermentation inocula or fermented foods. The food fermentation microbial inoculum refers to a viable bacteria fermentation preparation prepared from beneficial microorganisms.
And provides the application of the leuconostoc lactis in preparing the n-nonanol. The molecular formula of the n-nonanol is C9H20And O. Colorless to yellow oily liquid. Boiling point 213-215 ℃, solubility in ethanol and grease, acid value<1.0. Has strong sweet and green fragrance of rose wax and fruit-flavored lipid wax. There is a certain orange-like, sweet orange smell. CAS number 143-08-8. The English name is 1-Nonanol.
And provides the application of the leuconostoc lactis in endowing any one of flower fragrance, fruit fragrance, green grass fragrance and fresh oil fragrance. Preferably one or more of the above-mentioned flavours are imparted to the fermented food product. The floral aroma is preferably rose aroma. The aroma preparation application of the leuconostoc lactis is used for blending and preparing aroma based on the aroma of n-nonanol.
The invention has the beneficial effects that:
the enterococcus acidilactici CCTCC M2019444 has acid resistance and salt resistance, can grow well in the environment with pH4.0 and 6% NaCl, and can produce n-nonanol with high yield; the strain has good growth characteristics in bittern and vegetable juice; the strain has good acid production characteristics in bittern and vegetable juice, and the pH value is 5.58 after fermentation for 18 h; through detecting the n-nonanol content in the fermented vegetables and the fermented vegetable juice beverage prepared by the method and measuring the volatile flavor compound species, the result shows that the yield of the n-nonanol of the leuconostoc lactis is improved by 60.49-61.53%, the aroma quality of the product is improved, the sensory quality of the product is improved, and the method has a wide application prospect in the field of fermented vegetable products.
Preservation information
The invention provides a Leuconostoc lactis (Leuconostoc lactis) strain (internal number: L7ZSAAS01), the biological name of which is: leuconostoc lactis, deposited in the China center for type culture Collection on 6 months and 10 days in 2019, with the deposition address: china, wuhan university, zip code: 430072, the preservation number of the strain is: CCTCC M2019444.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention, and therefore should not be considered as limiting the scope, and it is obvious for those skilled in the art that other related drawings can be obtained from the drawings without inventive efforts.
FIG. 1 is a schematic diagram of phylogenetic tree of Leuconostoc lactis CCTCC M2019444 according to example 2 of the present invention;
FIG. 2 is a cell morphology (x 1600) of Leuconostoc lactis CCTCC M2019444;
FIG. 3 is a graph of the growth of Leuconostoc lactis CCTCC M2019444;
FIG. 4 is a graph of the growth temperature of Leuconostoc lactis CCTCC M2019444;
FIG. 5 is a GC-MS total ion flow diagram of fermented vegetables of Leuconostoc lactis CCTCC M2019444.
Detailed Description
In order that those skilled in the art will better understand the technical solutions of the present invention, the present invention will be further described in detail with reference to the following embodiments.
The present invention is described in detail below with reference to the examples of the present invention.
The invention firstly screens out a lactobacillus L7ZSAAS01 from naturally fermented fruit and vegetable products, and identifies the lactobacillus L7ZSAAS01 as Leuconostoc lactis (Leuconostoc lactis) by utilizing the microbiological characteristics such as morphological characteristics, culture traits, physiological and biochemical characteristics and the like and the genetic characteristic 16s rDNA thereof, wherein the lactobacillus has been preserved in the China center for type culture Collection (CCTCC for short) in 2019, 6 months and 10 days, and the preservation number is CCTCC M2019444.
A biologically pure culture of the aforementioned Leuconostoc lactis. A biologically pure culture is defined as the progeny of a cell or a population of the same cell that has been grown in culture.
The working leaven contains the enterococcus faecalis. The working starter herein refers to a starter used for the actual production of a product directly by the scale-up culture of a mother starter or a seed starter. Preferably, the number of viable bacteria in the working leavening agent is 109CFU/mL。
And provides a preparation method of the working leaven, which comprises the following steps:
s1 providing sterile skim milk;
the method comprises the following specific steps: weighing 10-12% (m/v) of skimmed milk powder, 2-4% (m/v) of glucose and 1-2% of glycerol, adding purified water to fully dissolve the skimmed milk powder, sterilizing at 95 ℃ for 20min, and cooling to 37-40 ℃ to obtain the sterile skimmed milk.
S2 activating the S lactis;
the method comprises the following specific steps: taking the strain of the Leuconostoc lactis CCTCC M2019444 which is preserved by a freeze-drying tube dissolved by sterile water by using an inoculating loop, marking on a MRS agar culture medium plate in a loop manner, and culturing in an incubator at 37 ℃ for 24-48 hours until a single colony grows out. The MRS agar culture medium is a lactic acid bacteria culture medium, is not limited to the MRS agar culture medium, and can be used for culturing strains.
S3 preparing strain culture solution, adding sterile skim milk during centrifugal precipitation, and lyophilizing;
the method comprises the following specific steps: inoculating the plate activated strain obtained in the step S2 into a 250mL triangular flask filled with 50mL of MRS culture medium in a one-ring manner, and placing the flask in an incubator at 37 ℃ for constant-temperature culture for 12-18 hours to obtain a culture solution; centrifuging the obtained culture solution at the control rotating speed of 4000-6000 r/min for 20-30 min, washing the precipitate obtained by centrifuging for 2-3 times by using a sterile phosphate buffer solution (50mM, pH6.8), adding 50mL of sterile skim milk solution into the precipitate obtained after washing, performing vortex oscillation at 4000-6000 rpm to resuspend the thalli, introducing the obtained strain culture solution into a glass ampoule bottle under the sterile condition, wherein the liquid level height is 0.8-1 cm, covering, quickly freezing the bottle stopper in a freezer at-30 ℃, filling the glass ampoule bottle by using a tray, and freeze-drying the bottle stopper in a freeze dryer.
And provides a fermented food comprising the above-mentioned leuconostoc lactis. The fermented food can be grain fermented product, bean fermented product, milk fermented product, and vegetable fermented product. Preferably vegetable fermentation products, the vegetable types include various Chinese cabbage, beet, radish, cucumber, celery, green tomato, pepper, green bean, kidney bean, allium chinense, young ginger, cowpea, etc. The vegetable fermented product is more preferably a fermented vegetable or a fermented vegetable juice beverage.
The preparation steps of the fermented vegetable are as follows:
s1 vegetable pretreatment
The method comprises the following specific steps: sorting vegetables to remove impurities and inedible parts, then processing the vegetables into blocks, strips or other shapes, cleaning for later use, disinfecting the vegetables for 3-5 min by using a disinfectant capable of forming hypochlorous acid, and controlling the number of microorganisms of the vegetables to be less than or equal to 300 CFU/g; washing with clear water for 3-5 min, and draining for later use;
s2 preparation of brine
The method comprises the following specific steps: weighing 1-2% (m/v) of anise, 2-4% (m/v) of pepper, 2-6% (m/v) of salt and 3-6% of glucose, adding purified water to fully dissolve the anise, heating and boiling for 10-60 minutes, cooling, and cooling the boiled salt water to room temperature to obtain pickle brine, namely obtaining the brine;
s3 preparation of vegetable bittern mixture
The method comprises the following specific steps: mixing the pretreated vegetables processed in the step S1 with the brine obtained in the step S2 according to the ratio of 1: 5-1: 10(m/v) to obtain a vegetable brine mixture;
s4 fermentation culture
The method comprises the following specific steps: the inoculation amount of the working leaven and the conventional leaven is 1-5% (m/v), the temperature is controlled to be 25-30 ℃, and the vegetables are fermented for 3-7 days until the total acid is 0.6-2.4%, so that the fermented vegetables containing the leuconostoc lactis are obtained. The working leaven is the working leaven containing the leuconostoc lactis. The conventional leavening agent is preferably any one of conventional lactobacillus plantarum and leuconostoc mesenteroides or the combination of the two.
The preparation method of the fermented vegetable juice beverage comprises the following steps:
s1 vegetable pretreatment
The method comprises the following specific steps: sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning for later use, disinfecting the vegetables for 3-5 min by using a disinfectant capable of forming hypochlorous acid, and controlling the number of microorganisms of the vegetables to be less than or equal to 300 CFU/g; washing with clear water for 3-5 min, and draining for later use;
preparation of S2 vegetable serum
The method comprises the following specific steps: weighing 10-20% (m/v) of vegetables and 6-10% (m/v) of glucose, adding purified water, and pulping in a pulping machine to obtain vegetable pulp;
preparation of S3 fermentation base material
The method comprises the following specific steps: inoculating a working starter containing the Leuconostoc lactis and a conventional starter into vegetable slurry according to the inoculation amount of 1-5% (m/v), then controlling the temperature to be 25-30 ℃, fermenting for 3-7 days until the total acid is 0.6-2.4%, and filtering the vegetable fermentation liquid by using filter cloth with the mesh number of 150-300 to obtain a fermentation base material containing the Leuconostoc lactis; the conventional leavening agent is preferably any one or the combination of two of conventional lactobacillus plantarum and leuconostoc mesenteroides;
blending of S4 fermented vegetable juice
The method comprises the following specific steps: treating 10-15% (m/v) of sucrose with purified water at 70-80 ℃, stirring at a high speed for dissolving for 20-30 min, sterilizing at 95 ℃ for 5-10 min, and cooling to 20-30 ℃; adding 20-30% of fermentation base material into the solution, stirring for 10-15 min, and adjusting the pH value to 3.6-4.0 by using a proper amount of citrate;
s5 homogenizing and sterilizing
The method comprises the following specific steps: homogenizing at 20-30 deg.C and 20-30 Mpa; and then sterilizing at 95 ℃ for 5-10 min, and refrigerating at 4 ℃ to obtain the fermented vegetable juice beverage containing the leuconostoc lactis.
And provides the application of the leuconostoc lactis in preparing food fermentation inocula or fermented foods. The food fermentation microbial inoculum refers to a viable bacteria fermentation preparation prepared from beneficial microorganisms.
And provides the application of the leuconostoc lactis in preparing the n-nonanol. The molecular formula of the n-nonanol is C9H20And O. Colorless to yellow oily liquid. Boiling point 213-215 ℃, solubility in ethanol and grease, acid value<1.0. Has strong sweet and green fragrance of rose wax and fruit-flavored lipid wax. There is a certain orange-like, sweet orange smell. CAS number 143-08-8. The English name is 1-Nonanol.
And provides the application of the leuconostoc lactis in endowing any one of flower fragrance, fruit fragrance, green grass fragrance and fresh oil fragrance. Preferably one or more of the above-mentioned flavours are imparted to the fermented food product.
The morphological characteristics and properties of the present invention are further described in detail in the following examples of the present invention, which show the morphological characteristics of the present invention, Leuconostoc lactis CCTCC M2019444
Colony characteristics: the strain is streaked and separated on an MRS plate, and is subjected to anaerobic culture at 37 ℃ for 48h, so that the strain grows well. The colony diameter is about 1mm-1.5mm, and is round, concave, smooth, moist, opaque, milky white or yellowish.
The characteristics of the thallus are as follows: the cells are spherical (FIG. 2), are arranged in a chain with different lengths, and are also arranged in a single dispersed way, the cell size is generally 0.5 μm × 1.5 μm, and gram staining is positive.
The culture characteristics of the leuconostoc lactis CCTCC M2019444 are as follows:
as shown in FIG. 4, the minimum growth temperature of the Leuconostoc lactis CCTCC M2019444 is 15 ℃, the maximum growth temperature is 40 ℃, and the growth temperature is the best at 30-40 ℃; the maximum and minimum initial growth pH was 9.0 and 4.0, the optimum growth initial pH was 6.0; as shown in fig. 3, the lag phase of strain CCTCC M2019444 was relatively short, 6h entered logarithmic growth phase, and 16h reached stationary phase.
Example 1 Collection, separation and selection method of Leuconostoc lactis CCTCC M2019444
(1) Obtaining appropriate dilution gradient and culturing
Sampling from natural fermented sauerkraut products collected from Sichuan and Jiangsu. The collected samples were placed in a freezer for refrigeration, kept at a lower temperature, brought back to the laboratory and stored frozen at-80 ℃ for future use. Weighing 1mL of sample, adding into 9mL of sterile water, sequentially diluting 1mL of bacterial liquid in 9mL of sterile water to make the sample concentration gradient diluted to 10-4 Taking 4 dilutions of 10-104Respectively coating 50 mu L of the bacterial suspension on MRS agar plates, and culturing for 36-48 h at a constant temperature of 37 ℃ under a facultative anaerobic condition.
(2) Separating and purifying
And (3) selecting single colonies with different sizes, bulges, slight white color, wetness, regular edges and yellow colony backs by using a plate marking method, and repeating the culture and selection operation to obtain the strains with excellent properties.
(3) Gram stain and Catalase assay
Selecting single colony, performing gram staining and catalase experiment, purifying gram positive and hydrogen peroxide negative bacteria plate for four generations, selecting typical single colony by plate marking method, repeating the culture and selection operation to obtain strain with excellent properties, inoculating in MRS culture for three generations, centrifuging at 5000rpm for 5min, adding 30% glycerol as protective agent, and freezing and storing in 30% glycerol tube at-20 deg.C.
(4) Determination of n-nonanol of different strains
The isolate obtained from the plate was inoculated into MRS liquid medium for 24 hours, then inoculated into MRS-containing liquid medium in an inoculum size of 2% (v/v), cultured at 37 ℃ for 10 hours, and continuously activated for 2 times. Centrifuging the fermentation solution at 4 deg.C for 20min at 5000r/min, washing the precipitate with sterile phosphate buffer solution (50mM, pH6.8) for 3 times, adding 50mL sterile skimmed milk into the washed precipitate, and vortex-oscillating at 5000rpm to resuspend thallus;
weighing 12% (m/v) skimmed milk powder, 6% (m/v) glucose and 2% glycerol, adding purified water to dissolve completely, sterilizing at 95 deg.C for 20min, and cooling to 37 deg.C to obtain sterilized skimmed milk;
inoculating the resuspended thallus and conventional starter into sterilized skim milk at an inoculum size of 5% (m/v), mixing, fermenting at 25 deg.C until the titer acidity is 70-80 ° T, cooling to room temperature, and storing at 4 deg.C.
7g of the above refrigerated fermented vegetables were weighed and placed in a headspace solid phase microextraction vial (15 mL). Placing the headspace bottle in a constant temperature water bath kettle at 55 deg.C, inserting an extraction head (50/30 μm DVB/CAR/PDMS), adsorbing with headspace for 40min, transferring the extraction head to GC-MS sample inlet, analyzing for 5min, and completing sample injection.
Wherein, the fermentation time of the fermented vegetable of the leuconostoc lactis is preferably 3 days.
Wherein, the measuring conditions of the headspace solid phase microextraction are as follows: placing 7g of the fermented vegetables in a 15mL headspace bottle, extracting for 40min in a constant temperature water bath at 55 ℃, and placing an extraction head on a GC-MS for 5 min.
And (3) performing GC-MS (gas chromatography-mass spectrometry) at the initial temperature of 40 ℃ for 3min, heating to 230 ℃ at the speed of 5 ℃/min, and heating at the speed of 10min to finish the detection of the aroma compounds of the fermented vegetables, so as to determine the content of the n-nonanol in the fermented vegetables. The strain B-MS-PC-12 can produce n-nonanol, and the strain is selected and named as L7ZSAAS 01.
Example 2 identification of Leuconostoc lactis L7ZSAAS01
(1) Physiological and biochemical identification
The strain L7ZSAAS01 is a gram-positive, peroxidase-negative, immotile bacterium capable of growing at 15 ℃ and 40 ℃.
(2) PCR amplification of 16S rDNA sequence analysis of Strain L7ZSAAS01
1) Absorbing 1mL of liquid culture medium which is uniformly mixed by shaking, centrifuging and then discarding the supernatant, blowing and cleaning for 2 times by using 1mL of sterile water, centrifuging and then discarding the supernatant, and using the supernatant as a template for colony PCR. PCR system 50. mu.L, where Mix was 25. mu.L, 27F was 1. mu.L, 1492R was 1. mu.L, and ddH2O was 23. mu.L.
The primer used was (16s27F: GAGAGTTTGATCCTGGCTCAG; 16s 1492R: CGGCTACCTTGTTACGACTT). The nucleotide sequence of the amplified fragment is shown as SEQ ID No 3, and the length is 429 bp.
And (3) carrying out phylogenetic tree analysis on the sequence obtained by sequencing, wherein the experimental result is shown as the attached figure 1, and the bacteria obtained in the experiment are shown to be the leuconostoc lactis.
2) PCR conditions were as follows:
Lid：105℃mBY-16s V：20μL
the DNA double strand is denatured at 94 ℃ for 10min, cooled at 50 ℃ for 30s after 94 ℃, cooled at 30s, rapidly heated to 72 ℃ for 80s, circulated 29 times, and finally kept at 72 ℃ for 7 min.
3) Agar gel electrophoresis (80mL)
Adding 0.8g of agarose and 80mL of 1 XTAE into a triangular flask, heating by using a microwave until the mixture is clear, and adding 8 mu L of EB dye after the mixture is cooled slightly; adding electrophoresis plate, cooling for half an hour, and condensing into solid gel; using a liquid transfer gun to drive 3-5 mu L of samples into the small holes of the rubber plate, and adding a Marker at the tail end of each row; inserting an electrode, regulating the voltage to 120V, and running for half an hour; taking out the rubber plate, exposing for 10s under UV, and storing the image of the electrophoresis strip; the sample that gave a clear electrophoretic band was sequenced.
4)16S rRNA sequence analysis and identification
According to a sequencing report given by Beijing Liuhe Huada Dagen science and technology Co., Ltd, the separated 16S rRNA sequence of the lactic acid bacteria is compared and identified with a corresponding sequence of a known strain in a (GenBank/EMBL/DDBJ) database by combining with a BLAST analysis tool, and is analyzed and identified as Leuconostoc lactis (Leuconostoc lactis), and the Access Number is MK 855188. The Leuconostoc lactis L7ZSAAS01 is rod-shaped, white, smooth and wet in surface, neat in edge and convex in colony.
The L7ZSAAS01 is identified as Leuconostoc lactis (Leuconostoc lactis) according to the microbiological characteristics such as morphological characteristics, physiological and biochemical characteristics and the like and the genetic characteristic of 16s rDNA, the strain is preserved in the China center for type culture Collection (CCTCC for short) in 6 and 10 months in 2019, and the preservation number is CCTCC M2019444.
Example 3 growth and fermentation characteristics of the CCTCC M2019444 Strain
(1) Drawing of CCTCC M2019444 strain growth curve
The activated leuconostoc lactis CCTCC M2019444 is inoculated into an MRS liquid culture medium according to the inoculation amount of 2% (v/v), the activated leuconostoc lactis CCTCC M2019444 is cultured at the constant temperature of 37 ℃ for 18h, the OD value of the culture solution is measured at 600nm every 1-2h, the OD value is plotted against the time to obtain the growth curve of the strain CCTCC M2019444 in MRS, and the result (figure 3) shows that: the leuconostoc lactis CCTCC M2019444 grows rapidly in an MRS culture medium, enters a logarithmic phase within about 4 hours, and enters a stationary phase within about 12 hours.
(2) CCTCC M2019444 strain optimum growth temperature determination
Activated Leuconostoc lactis CCTCC M2019444 is inoculated into 10 mM MRS liquid culture medium according to the inoculation amount of 2% (V/V), and is cultured at constant temperature of 15 ℃, 25 ℃, 32 ℃, 37 ℃, 40 ℃ and 45 ℃ for 12h, the non-inoculated MRS liquid culture medium is used as a control, OD values of culture solutions cultured at different temperatures are measured at 600nm, and the optimal growth temperature is determined according to the OD value. The results show that: (figure 4) the growth temperature range of the Leuconostoc lactis CCTCC M2019444 is wide, the growth is from 15 ℃ to 45 ℃, the growth is good at 30-40 ℃, and the optimal growth temperature is 37 ℃.
(3) Changes of pH and titrated acidity of Leuconostoc lactis CCTCC M2019444 in skim milk within 16h
Inoculating the Leuconostoc lactis CCTCC M2019444 stored at-80 deg.C in MRS liquid culture medium, culturing at 37 deg.C for 24 hr, subculturing for 2-3 times to 108～109cfu/mL. Taking out the bacteria liquid activated in MRS and inoculating the bacteria liquid into skim milk according to the volume ratio of 2-4 percent to ensure that the bacteria amount in the yoghurt reaches 105cfu/g. And (3) putting the inoculated sample into an incubator at 42 ℃ for fermentation, sampling every 4h, detecting the pH and the titer change in the fermentation process, and obtaining the experimental results shown in the figures 3 and 4. ByAs can be seen in FIGS. 3 and 4, the pH of the fermentation of Leuconostoc lactis CCTCC M2019444 was reduced by 0.98 for 16 h.
Example 4 determination of the ability of Leuconostoc lactis CCTCC M2019444 to produce n-nonanol
(1) Preparation of sterile skim milk
Weighing 12% (m/v) skimmed milk powder, 6% (m/v) glucose and 2% glycerol, adding purified water to dissolve completely, sterilizing at 95 deg.C for 20min, and cooling to 37 deg.C to obtain sterile skimmed milk;
(2) strain activation
Taking a strain of the Leuconostoc lactis CCTCC M2019444 which is preserved in a freeze-drying tube and dissolved by sterile water by using an inoculating loop, marking one loop on a MRS agar culture medium plate, and growing a single colony in an incubator at 37 ℃ for 24 hours to obtain a plate activated strain;
(3) preparation of working starter
Taking the plate activated strain obtained in the step (2) by using an inoculating loop, inoculating the plate activated strain into a triangular flask with the specification of 250mL and filled with 50mL of MRS broth liquid culture medium, and placing the triangular flask into an incubator at 37 ℃ for constant-temperature culture for 18 hours to obtain culture solution; centrifuging the culture solution at a rotation speed of 5000r/min for 20min, washing the centrifuged precipitate with sterile phosphate buffer solution (50mM, pH6.8) for 3 times, adding 50mL of sterile skim milk into the washed precipitate, performing vortex oscillation at 5000rpm to resuspend thallus, introducing the strain culture solution into a glass ampoule bottle under sterile conditions, wherein the liquid level is 0.8-1 cm, covering the bottle stopper, quickly freezing in a freezer at-30 ℃, loading the glass ampoule bottle with a tray, freeze-drying in a freeze dryer to obtain a working starter, and the number of viable bacteria is preferably 109cfu/mL or more;
(4) vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, strips or other shapes, cleaning for later use, sterilizing the vegetables with disinfectant capable of forming hypochlorous acid for 5min, and controlling the number of microorganisms in the vegetables to be less than or equal to 300 CFU/g; washing with clear water for 5min, and draining;
(5) preparation of brine
Weighing 2% (m/v) of old ginger, 3% (m/v) of wild pepper, 4% (m/v) of salt and 4% of glucose, adding purified water to fully dissolve, heating and boiling for 45 minutes, cooling, and cooling the boiled salt water to room temperature to obtain pickle brine, namely obtaining the brine.
(6) Preparation of vegetable bittern water mixture
And (3) mixing the pretreated vegetables obtained in the step (4) with the brine obtained in the step (5) according to the ratio of 1:10(m/v) to obtain a vegetable brine mixture.
(7) Fermentation culture
The inoculation amounts of the working leaven, the conventional leaven of lactobacillus plantarum and the conventional leaven of leuconostoc mesenteroides are respectively 2% (m/v), the temperature is controlled at 30 ℃, and the fermentation is carried out for 3 days until the total acid is 1.5 percent, thus obtaining the fermented vegetable containing the leuconostoc lactis.
(8) GC-MS (gas chromatography-Mass Spectrometry) measurement of n-nonanol content in vegetable fermentation process
The chromatographic conditions are as follows: 5g of the fermented vegetable obtained above is weighed, 1.3g of NaCl is added, and methyl heptanoate is quantitatively adopted as an internal standard (1mg/mL, the sample loading amount is 1 mu L) and placed in a headspace solid phase microextraction vial. And (3) completing the detection of the aromatic compounds of the fermented vegetables, thereby determining the content of the n-nonanol in the fermented vegetables, wherein the total ion flow diagram is shown in figure 5. DB-WAX-UI capillary column; column specification: 30m is multiplied by 0.25 μm, the inlet temperature is 240 ℃, the column flow rate is 35cm/s, and the carrier gas is helium; temperature programming: maintaining the initial temperature at 40 deg.C for 10 min; heating to 90 deg.C at 10 deg.C/min, and maintaining for 15 min; heating to 130 deg.C at 20 deg.C/min, and maintaining for 5 min; heating to 250 deg.C at 20 deg.C/min, and maintaining for 5 min.
The mass spectrum conditions are as follows: ionization mode EI, emission energy of 74eV, ion source temperature of 230 ℃, interface temperature of 280 ℃, quadrupole temperature: the mass-to-charge ratio is 15-500 at 150 ℃. The materials were characterized by searching in NIST 2001 standard library and comparing with standard sample, and the peak area of each component was calculated by peak area normalization and expressed as μ g/kg vegetable product.
(9) Variation of n-nonanol content during fermentation
The yield of n-nonanol in each fermentation time period of the enterococcus faecalis CCTCC M2019444 is high, 1.30 mu g/kg is obtained at 18h, the yield of the n-nonanol in the conventional starter is 0.11 mu g/kg, the yield of the L7ZSAAS01 strain is 0.32 mu g/kg, and the yield of the n-nonanol in the L7ZSAAS01 strain is far higher than that of the conventional starter.
Application example 1 preparation of working starter culture containing Leuconostoc lactis CCTCC M2019444
(1) Preparation of sterile skim milk
Weighing 10% (m/v) skimmed milk powder, 6% (m/v) glucose and 2% glycerol, adding purified water to dissolve completely, sterilizing at 95 deg.C for 20min, and cooling to 37 deg.C to obtain sterile skimmed milk;
(2) strain activation
Taking a strain of the Leuconostoc lactis CCTCC M2019444 preserved in a freeze-drying tube dissolved in sterile water by using an inoculating loop, marking one loop on an MRS agar culture medium plate, and culturing in an incubator at 37 ℃ for 48 hours until a single colony grows out to obtain a plate activated strain;
(3) preparation of working starter
Culturing in a constant temperature incubator at 37 ℃ for 12 hours to obtain a culture solution; centrifuging the obtained culture solution at a rotation speed of 5000r/min for 20min, washing the centrifuged precipitate with sterile phosphate buffer solution (50mM, pH6.8) for 3 times, adding 50mL of sterile skim milk solution into the washed precipitate, performing vortex shaking at 5000rpm to resuspend the thallus, introducing the strain culture solution into a glass ampoule bottle under sterile conditions, wherein the liquid level is 0.8-1 cm, covering the bottle stopper, quickly freezing in a freezer at-30 ℃, loading the glass ampoule bottle with a tray, freeze-drying in a freeze dryer to obtain the working starter culture containing the Leuconostoc lactis CCTCC M2019444, and the number of viable bacteria in the working starter culture is 109cfu/mL or more.
The working fermenters used in the following application examples 2 to 5 were the working fermenters prepared in application example 1.
Application example 2 preparation of fermented vegetables containing Leuconostoc lactis CCTCC M2019444
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, strips or other shapes, cleaning for later use, sterilizing the vegetables with disinfectant capable of forming hypochlorous acid for 3min, and controlling the number of microorganisms in the vegetables to be less than or equal to 300 CFU/g; washing with clear water for 3min, and draining;
(2) preparation of brine
Weighing 1% (m/v) of anise, 2% (m/v) of pepper, 3% (m/v) of salt and 3% of glucose, adding purified water to fully dissolve the anise, heating and boiling for 60 minutes, cooling, and cooling the boiled salt water to room temperature to obtain pickled vegetable brine, namely the bittern.
(3) Preparation of vegetable bittern water mixture
And (3) mixing the pretreated vegetables obtained in the step (1) with the brine obtained in the step (2) according to the ratio of 1:10(m/v) to obtain a vegetable brine mixture.
(4) Fermentation culture
The inoculation amount of the working starter containing the leuconostoc lactis CCTCC M2019444 is 2% (M/v), the temperature is controlled to be 30 ℃, and fermentation is carried out for 3 days until the total acid is 1.5%, so that the fermented vegetable containing the leuconostoc lactis is obtained.
Application example 3 preparation of fermented vegetables containing Leuconostoc lactis CCTCC M2019444
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, strips or other shapes, cleaning for later use, sterilizing the vegetables with disinfectant capable of forming hypochlorous acid for 5min, and controlling the number of microorganisms in the vegetables to be less than or equal to 300 CFU/g; washing with clear water for 5min, and draining;
(2) preparation of brine
Weighing 2% (m/v) of anise, 3% (m/v) of pepper, 4% (m/v) of salt and 4% of glucose, adding pure water to fully dissolve the anise, heating and boiling for 45 minutes, and cooling the boiled salt water to room temperature to obtain pickle brine, namely obtaining the brine.
(3) Preparation of vegetable bittern water mixture
And (3) mixing the pretreated vegetables obtained in the step (1) with the brine obtained in the step (2) according to the ratio of 1:10(m/v) to obtain a vegetable brine mixture.
(4) Fermentation culture
The inoculation amount of the working starter containing the leuconostoc lactis CCTCC M2019444 is 4% (M/v), the temperature is controlled to be 30 ℃, the fermentation is carried out for 3 days until the total acid is 2.4%, and the fermented vegetable containing the leuconostoc lactis is obtained.
Application example 4 preparation of fermented vegetable juice beverage containing Leuconostoc lactis CCTCC M2019444
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning, and keeping for later use, wherein the vegetables are sterilized by a disinfectant capable of forming hypochlorous acid for 5min, and the number of microorganisms in the vegetables is controlled to be less than or equal to 300 CFU/g; washing with clear water for 5min, and draining;
(2) preparation of vegetable pulp
Weighing 10% (m/v) of vegetables and 6% (m/v) of glucose, adding purified water, and pulping in a pulping machine to obtain vegetable pulp.
(3) Preparation of fermentation base
Inoculating a working starter containing the Leuconostoc lactis CCTCC M2019444 into the vegetable pulp according to the inoculation amount of 2% (M/v), controlling the temperature at 30 ℃, and fermenting for 3 days until the total acid is 0.6%, thus obtaining the fermentation base material containing the Leuconostoc lactis.
(4) Blending of fermented vegetable juice
Treating 15% (m/v) sucrose with 80 deg.C purified water, stirring at high speed for dissolving for 30min, sterilizing at 95 deg.C for 10min, and cooling to 30 deg.C; adding 30% of fermentation base material into the above solution, stirring for 15min, and adjusting pH to 4.0 with appropriate amount of citrate.
(5) Homogenizing and sterilizing
Homogenizing at 30 deg.C and 20 Mpa; then sterilizing at 95 deg.C for 10min, and refrigerating at 4 deg.C to obtain fermented vegetable juice beverage containing the strain.
Application example 5 preparation of fermented vegetable juice beverage containing Leuconostoc lactis CCTCC M2019444
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning, and keeping for later use, wherein the vegetables are sterilized by a disinfectant capable of forming hypochlorous acid for 5min, and the number of microorganisms in the vegetables is controlled to be less than or equal to 300 CFU/g; washing with clear water for 5min, and draining;
(2) preparation of vegetable pulp
Weighing 20% (m/v) of vegetables and 10% (m/v) of glucose, adding purified water, and pulping in a pulping machine to obtain vegetable pulp.
(3) Preparation of fermentation base
In the preparation of the fermentation base material: inoculating the working starter containing the leuconostoc lactis into the vegetable pulp according to the inoculation amount of 4% (m/v), then controlling the temperature to be 30 ℃, fermenting for 3 days until the total acid is 1.8%, and filtering the vegetable fermentation liquor by using filter cloth with the mesh number of 200, wherein the clear liquid is the fermentation base material containing the leuconostoc lactis.
(4) Blending of fermented vegetable juice
During the blending of the fermented vegetable juice: treating 12% (m/v) sucrose with 80 deg.C purified water, stirring at high speed for dissolving for 30min, sterilizing at 95 deg.C for 10min, and cooling to 20 deg.C; adding 25% of fermentation base material into the above solution, stirring for 15min, and adjusting pH to 3.6 with appropriate amount of citrate.
(5) Homogenizing and sterilizing
Homogenizing and sterilizing: homogenizing at 30 deg.C and 30 Mpa; then sterilizing at 95 deg.C for 10min, and refrigerating at 4 deg.C to obtain fermented vegetable juice beverage containing the strain.
Comparative example 1 preparation of comparative fermented vegetable
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, strips or other shapes, cleaning for later use, sterilizing the vegetables with disinfectant capable of forming hypochlorous acid for 5min, and controlling the number of microorganisms in the vegetables to be less than or equal to 300 CFU/g; washing with clear water for 3min, and draining;
(2) preparation of brine
Weighing 2% (m/v) of anise, 4% (m/v) of pepper, 5% (m/v) of salt and 5% of glucose, adding pure water to fully dissolve the anise, heating and boiling for 60 minutes, cooling, and cooling the boiled salt water to room temperature to obtain pickle brine, namely the brine.
(3) Preparation of vegetable bittern water mixture
And (3) mixing the pretreated vegetables obtained in the step (1) with the brine obtained in the step (2) according to the ratio of 1:5(m/v) to obtain a vegetable brine mixture.
(4) Fermentation culture
The inoculation amount of the lactobacillus plantarum conventional starter or the leuconostoc mesenteroides conventional starter is 2% (m/v), the temperature is controlled to be 30 ℃, and fermentation is carried out for 3 days until the total acid is 1.6%, thus obtaining the fermented vegetable.
Comparative example 2 preparation of comparative fermented vegetables
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, strips or other shapes, cleaning for later use, sterilizing the vegetables with disinfectant capable of forming hypochlorous acid for 5min, and controlling the number of microorganisms in the vegetables to be less than or equal to 300 CFU/g; washing with clear water for 3min, and draining;
(2) preparation of brine
Weighing 1% (m/v) of anise, 3% (m/v) of pepper, 6% (m/v) of salt and 4% of glucose, adding pure water to fully dissolve the anise, heating and boiling for 45 minutes, cooling, and cooling the boiled salt water to room temperature to obtain pickle brine, namely the brine.
(3) Preparation of vegetable bittern water mixture
And (3) mixing the pretreated vegetables obtained in the step (1) with the brine obtained in the step (2) according to the ratio of 1:5(m/v) to obtain a vegetable brine mixture.
(4) Fermentation culture
The inoculation amount of the lactobacillus plantarum conventional starter or the leuconostoc mesenteroides conventional starter is 4% (m/v), the temperature is controlled to be 30 ℃, and fermentation is carried out for 3 days until the total acid is 2.4%, thus obtaining the fermented vegetable.
Comparative example 3 preparation of a comparative fermented vegetable juice beverage
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning, and keeping for later use, wherein the vegetables are sterilized by a disinfectant capable of forming hypochlorous acid for 5min, and the number of microorganisms in the vegetables is controlled to be less than or equal to 300 CFU/g; washing with clear water for 5min, and draining;
(2) preparation of vegetable pulp
Weighing 15% (m/v) of vegetables and 6% (m/v) of glucose, adding purified water, and pulping in a pulping machine to obtain vegetable pulp.
(3) Preparation of fermentation base
In the preparation of the fermentation base material: inoculating the conventional lactobacillus plantarum starter or the conventional leuconostoc mesenteroides starter into the vegetable pulp according to the inoculation amount of 2% (m/v), controlling the temperature to be 30 ℃, fermenting for 3 days until the total acid is 1.6%, and filtering the vegetable fermentation liquid by using filter cloth with the mesh number of 150 to obtain clear liquid, namely the fermentation base material.
(4) Blending of fermented vegetable juice
During the blending of the fermented vegetable juice: treating 10% (m/v) sucrose with 80 deg.C purified water, stirring at high speed for dissolving for 30min, sterilizing at 95 deg.C for 10min, and cooling to 20 deg.C; adding 30% of fermentation base material into the above solution, stirring for 15min, and adjusting pH to 4.0 with appropriate amount of citrate.
(5) Homogenizing and sterilizing
Homogenizing and sterilizing: homogenizing at 30 deg.C and 20 Mpa; sterilizing at 95 deg.C for 10min, and refrigerating at 4 deg.C to obtain fermented vegetable juice beverage.
Comparative example 4 preparation of a comparative fermented vegetable juice beverage
(1) Vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning, and keeping for later use, wherein the vegetables are sterilized by a disinfectant capable of forming hypochlorous acid for 5min, and the number of microorganisms in the vegetables is controlled to be less than or equal to 300 CFU/g; washing with clear water for 5min, and draining;
(2) preparation of vegetable pulp
Weighing 18% (m/v) vegetables and 10% (m/v) glucose, adding purified water, and pulping in a pulping machine to obtain vegetable pulp.
(3) Preparation of fermentation base
In the preparation of the fermentation base material: inoculating conventional lactobacillus plantarum starter or conventional Leuconostoc mesenteroides starter into vegetable pulp according to the inoculation amount of 4% (m/v), controlling the temperature at 30 ℃, fermenting for 3 days until the total acid is 2.0%, and filtering the vegetable fermentation liquor by using filter cloth with the mesh number of 300, wherein the clear liquid is the fermentation base material.
(4) Blending of fermented vegetable juice
During the blending of the fermented vegetable juice: treating 15% (m/v) sucrose with 70 deg.C purified water, stirring at high speed for dissolving for 20min, sterilizing at 95 deg.C for 10min, and cooling to 20 deg.C; adding 20% of fermentation base material into the above solution, stirring for 10min, and adjusting pH to 3.6 with appropriate amount of citrate.
(5) Homogenizing and sterilizing
Homogenizing and sterilizing: homogenizing at 25 deg.C and 30 Mpa; sterilizing at 95 deg.C for 10min, and refrigerating at 4 deg.C to obtain fermented vegetable juice beverage.
Effect example 1 application of Leuconostoc lactis in fermented vegetables
This example compares the n-nonanol production capacity of Leuconostoc lactis CCTCC M2019444 and a conventional starter.
Fermented peppers were prepared by setting the preparation processes in application examples 2 and 3 and comparative examples 1 and 2, respectively, and the n-nonanol content of the fermented vegetables in application examples 2 and 3 and comparative examples 1 and 2 was measured, respectively. Wherein comparative example 1 and comparative example 2 are each provided with experimental groups of two species of Lactobacillus plantarum and Leuconostoc mesenteroides, respectively.
The results obtained are shown in Table 1.
TABLE 1 fermentation results
Figure RE-GDA0002485566050000241
As can be seen from Table 1, the enterococcus faecalis CCTCC M2019444 has higher n-nonanol production capacity in the fermented vegetables, can greatly improve the endogenous aroma production of the fermented vegetables in the fermentation process, and has wide application prospect in the preparation of the fermented vegetables.
Effect example 2 application of Leuconostoc lactis in fermented vegetable juice beverage
Comparison of volatile flavor compound types in fermented vegetable juice beverages containing Leuconostoc lactis CCTCC M2019444 and control fermented vegetable juice beverages.
Fermented radish juice beverages were prepared by setting the preparation processes in application examples 4 and 5 and comparative examples 3 and 4, respectively, and the n-nonanol content of the fermented vegetable juice beverages in application examples 4 and 5 and comparative examples 3 and 4, respectively, was measured. Wherein comparative example 3 and comparative example 4 are each provided with experimental groups of two species of Lactobacillus plantarum and Leuconostoc mesenteroides, respectively. The results obtained are shown in Table 2.
TABLE 2 fermentation results
Figure RE-GDA0002485566050000251
As can be seen from Table 2, the enterococcus faecalis CCTCC M2019444 has higher n-nonanol production capacity in the fermented vegetable juice beverage, can greatly improve the endogenous aroma production of the fermented vegetable in the fermentation process, and has wide application prospect in the preparation of the fermented vegetable juice beverage.
The above is only a preferred embodiment of the present invention, and it should be noted that the above preferred embodiment should not be considered as limiting the present invention, and the protection scope of the present invention should be subject to the scope defined by the claims. It will be apparent to those skilled in the art that various modifications and variations can be made in the present invention without departing from the spirit or scope of the invention.
Sequence listing SEQ ID No 3
Leuconostoc lactis L7ZSAAS01 16s RNA
GGGACTTGGGGGGCGTGCTATACATGCAAGTCGAACGCGCAGCGAAA GGTGCTTGCACCTTTCAAGCGAGTGGCGAACGGGTGAGTAACACGTGGAT AACCTGCCTCAAGGCTGGGGATAACATTTGGAAACAGATGCTAATACCGA ATAAAACTTAGTATCGCATGATACAAAGTTGAAAGGCGCTACGGCGTCAC CTAGAGATGGGTCCGCGGTGCATTAGTTAGTTGGTGGGGTAAAGGCCTACC AAGACAATGATGCATAGCCGAGTTGAGAGACTGATCGGCCACATTGGGAC TGAGACACGGCCCAAACTCCTACGGGAGGCTGCAGTAGGGAATCTTCCAC AATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGTGTGATGAAGGCTTTA GGGTCGTAAAGCACTGTTGTATGGGAAGAAATGCTAGAATAGGGAATGAT TCTAGTTCGACGGTACCATACCAGAAAGGGACGGCTAAATACGTGCCAGC AGCCGCGGTAATACGTATGTCCCGAGCGTTATCCGGATTTATTGGGCGTAA AGCGAGCGCAGACGGTTGATTAAGTCTGATGTGAAAGCCCGGAGCTCAAC TCCGGAATGGCATTGGAAACTGGTTAACTTGAGTGTTGTAGAGGTAAGTGG AACTCCATGTGTAGCGGTGGAATGCGTAGATATATGGAAGAACACCAGTG GCGAAGGCGGCTTACTGGACAACAACTGACGTTGAGGCTCGAAAGTGTGG GTAGCAAACAGGATTAGATACCCTGGTAGTCCACACCGTAAACGATGAAT ACTAGGTGTTAGGAGGTTTCCGCCTCTTAGTGCCGAAGCTAACGCATTAAG TATTCAGCCTGGGGAGTACGACCGCAAGGTTGAAACTCAAAGGAATTTGA CGGGGACCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCG GAAAATCTTACCAGGTCTTGGACATTCTTTGAAGCTTTTAAGAGATATAAG TGTTC
Sequence listing
<110> Sichuan old jar food Co., Ltd
<120> Leuconostoc lactis and application thereof
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1007
<212>DNA
<213> Leuconostoc lactis (Leuconostoc lactis)
<400>1
gggacttggg gggcgtgcta tacatgcaag tcgaacgcgc agcgaaaggt gcttgcacct 60
ttcaagcgag tggcgaacgg gtgagtaaca cgtggataac ctgcctcaag gctggggata 120
acatttggaa acagatgcta ataccgaata aaacttagta tcgcatgata caaagttgaa 180
aggcgctacg gcgtcaccta gagatgggtc cgcggtgcat tagttagttg gtggggtaaa 240
ggcctaccaa gacaatgatg catagccgag ttgagagact gatcggccac attgggactg 300
agacacggcc caaactccta cgggaggctg cagtagggaa tcttccacaa tgggcgaaag 360
cctgatggag caacgccgcg tgtgtgatga aggctttagg gtcgtaaagc actgttgtat 420
gggaagaaat gctagaatag ggaatgattc tagttcgacg gtaccatacc agaaagggac 480
ggctaaatac gtgccagcag ccgcggtaat acgtatgtcc cgagcgttat ccggatttat 540
tgggcgtaaa gcgagcgcag acggttgatt aagtctgatg tgaaagcccg gagctcaact 600
ccggaatggc attggaaact ggttaacttg agtgttgtag aggtaagtgg aactccatgt 660
gtagcggtgg aatgcgtaga tatatggaag aacaccagtg gcgaaggcgg cttactggac 720
aacaactgac gttgaggctc gaaagtgtgg gtagcaaaca ggattagata ccctggtagt 780
ccacaccgta aacgatgaat actaggtgtt aggaggtttc cgcctcttag tgccgaagct 840
aacgcattaa gtattcagcc tggggagtac gaccgcaagg ttgaaactca aaggaatttg 900
acggggaccc gcacaagcgg tggagcatgt ggtttaattc gaagcaacgc ggaaaatctt 960
accaggtctt ggacattctt tgaagctttt aagagatata agtgttc 1007

Claims (11)

1. The leuconostoc lactis is characterized in that the leuconostoc lactis is preserved in China center for type culture Collection with the preservation number of CCTCC M2019444.
2. A biologically pure culture comprising the bacterium Leuconostoc lactis of claim 1.
3. A working starter culture comprising the bacterium Leuconostoc lactis of claim 1.
4. A method of preparing a working starter according to claim 3 comprising the steps of:
s1 providing sterile skim milk;
s2 activating the S lactis;
s3 preparing culture solution, adding sterile skimmed milk during centrifugal precipitation, and freeze drying.
5. A fermented food product comprising the leuconostoc lactis bacterium according to claim 1.
6. The fermented food product according to claim 5, wherein: the fermented food is fermented vegetable or fermented vegetable juice beverage.
7. A method for preparing fermented vegetables according to claim 6, characterized in that: the method comprises the following steps:
s1 vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning for later use, and disinfecting the vegetables with a disinfectant; then washing with clear water, and draining for later use;
s2 preparation of brine
Taking a proper amount of seasoning, putting the seasoning into purified water, adding a proper amount of salt and sugar according to the volume of the water, heating and boiling, cooling, and cooling the boiled salt water to room temperature to obtain brine;
s3 preparation of vegetable bittern mixture
Adding the vegetables processed in the step S1 into the bittern obtained in the step S2 to obtain a vegetable bittern mixture;
s4 fermentation culture
And (4) inoculating the working leavening agent containing the leuconostoc lactis and the conventional leavening agent into the vegetable bittern mixture obtained in the step S3 according to a certain proportion, and controlling the temperature to ferment so as to obtain the fermented vegetable containing the leuconostoc lactis.
8. A method of preparing the fermented vegetable juice beverage of claim 6, wherein: the method comprises the following steps:
s1 vegetable pretreatment
Sorting vegetables to remove impurities and inedible parts, cutting the vegetables into blocks, cleaning for later use, and disinfecting the vegetables with a disinfectant; then washing with clear water, and draining for later use;
preparation of S2 vegetable serum
Taking a proper amount of vegetables and sugar, putting into purified water, and pulping in a pulping machine to obtain vegetable pulp;
preparation of S3 fermentation base material
Inoculating a working starter containing the leuconostoc lactis and a conventional starter into the vegetable pulp obtained after the treatment in the step S2 according to a certain proportion, controlling the temperature to ferment, filtering to obtain clear liquid, and refrigerating to obtain a fermentation base material containing the leuconostoc lactis;
blending of S4 fermented vegetable juice
Adding purified water into sugar with a certain mass, stirring at high speed for dissolving, sterilizing, and cooling to room temperature; adding a certain amount of fermentation base material into the solution, uniformly stirring, and adjusting the acidity value by using a proper amount of acid;
s5 homogenizing and sterilizing
And (5) homogenizing the solution treated in the step (S4), sterilizing and cooling to obtain the fermented vegetable juice beverage containing the leuconostoc lactis.
9. The use of the Leuconostoc lactis strain according to claim 1 for preparing a food fermentation inoculant or fermented food.
10. Use of the bacteria of claim 1 for the preparation of n-nonanol.
11. Use of the bacteria of claim 1 for imparting any one or more of floral, fruity, grassy, fresh tallow aroma.
CN201910645660.8A 2019-07-17 2019-07-17 Leuconostoc lactis and application thereof Active CN111304108B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201910645660.8A CN111304108B (en) 2019-07-17 2019-07-17 Leuconostoc lactis and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201910645660.8A CN111304108B (en) 2019-07-17 2019-07-17 Leuconostoc lactis and application thereof

Publications (2)

Publication Number Publication Date
CN111304108A true CN111304108A (en) 2020-06-19
CN111304108B CN111304108B (en) 2023-07-25

Family

ID=71144796

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201910645660.8A Active CN111304108B (en) 2019-07-17 2019-07-17 Leuconostoc lactis and application thereof

Country Status (1)

Country Link
CN (1) CN111304108B (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113151106A (en) * 2021-05-17 2021-07-23 四川老坛子食品有限公司 Leuconostoc lactis and application thereof

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109234204A (en) * 2018-11-07 2019-01-18 福建省农业科学院农业工程技术研究所 A kind of pickle starter and its methods for making and using same

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109234204A (en) * 2018-11-07 2019-01-18 福建省农业科学院农业工程技术研究所 A kind of pickle starter and its methods for making and using same

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HE等: "AIR FLOW ASSISTED IONIZATION FOR REMOTE SAMPLING OF AMBIENT MASS SPECTROMETRY AND ITS APPLICATION", 《RAPID COMMUNICATIONS IN MASS SPECTROMETRY》, vol. 25, no. 7 *
钟涛等: "牙签电喷雾电离质谱分析脐橙果汁成分", 《质谱学报》, vol. 37, no. 1 *
陆敏等: "高效液相色谱法同时测定常见水果中的四种有机酸", 《食品工业科技》, vol. 30, no. 7 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113151106A (en) * 2021-05-17 2021-07-23 四川老坛子食品有限公司 Leuconostoc lactis and application thereof
CN113151106B (en) * 2021-05-17 2024-02-23 四川老坛子食品有限公司 Leuconostoc lactate and application thereof

Also Published As

Publication number Publication date
CN111304108B (en) 2023-07-25

Similar Documents

Publication Publication Date Title
CN110257285B (en) Lactobacillus plantarum with functions of efficiently degrading nitrite and strongly producing acid and application thereof
CN111676156B (en) Bacillus belgii MRS for improving reduction activity and fermentation product and application thereof
CN116138429B (en) Short Kazakhstan yeast XJ-65 and application thereof in pepper fermentation
CN109971689B (en) Pediococcus pentosaceus ZF618 and application thereof
Xiao et al. Screening lactic acid bacteria with high yielding-acid capacity from pickled tea for their potential uses of inoculating to ferment tea products
CN104774775B (en) A kind of yeast strain, its cultural method and application
CN116024133B (en) Lactobacillus plantarum resistant to high-concentration malic acid and application thereof
CN103060243A (en) Sub-lactobacillus casei and sub-cheese subspecies strain
CN109234204A (en) A kind of pickle starter and its methods for making and using same
CN112940954A (en) High-ester-yield abnormal hamamelis virginiana and application thereof
CN113151107B (en) Leuconostoc mesenteroides and application thereof
CN113151021A (en) Yeast and application thereof
CN110004090B (en) Leuconostoc mesenteroides and application thereof in pickled vegetable fermentation
CN113308418B (en) Lactobacillus chaff for fermentation and fermentation preparation process thereof
CN111635870B (en) Leavening agent, direct-feeding fermentation method of stinky tofu marinating liquid and stinky tofu marinating liquid
CN111304108B (en) Leuconostoc lactis and application thereof
CN113439830A (en) Preparation method of compound leavening agent and application of compound leavening agent in pepper fermentation and flavor enhancement
CN109749962B (en) Shanxi mature vinegar dominant local flavor lactobacillus plantarum with strong tolerance and high acid production and application thereof
CN116555097A (en) Lactobacillus plantarum capable of resisting capsaicin stress, microbial inoculum and application thereof
CN115960732A (en) Pichia anomala strain and microbial agent and application thereof
CN111254102B (en) Leuconostoc citreum and application thereof in precipitated starch slurry
CN111718868B (en) Edinglake terribacillus LBX capable of improving free radical scavenging capacity and fermentation product and application thereof
CN108753655A (en) A kind of Lactobacillus casei of high yield 2,3- diacetyl and its application
CN112458003B (en) Diacetyl-producing lactobacillus plantarum and application thereof in pickled vegetables
CN113151106B (en) Leuconostoc lactate and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant