CN111303278A

CN111303278A - Human antibodies that bind to RSV G protein

Info

Publication number: CN111303278A
Application number: CN201911248665.3A
Authority: CN
Inventors: J·瓦迪亚; R·A·威廉森; J·P·M·朗热戴克; G·帕斯夸尔; A·万特沃特
Original assignee: Janssen Vaccines and Prevention BV
Current assignee: Janssen Vaccines and Prevention BV
Priority date: 2013-04-15
Filing date: 2014-04-14
Publication date: 2020-06-19
Anticipated expiration: 2034-04-14
Also published as: CN111303278B

Abstract

The present invention provides isolated antibodies and antigen-binding fragments that bind to the G protein of RSV and are capable of neutralizing RSV.

Description

Human antibodies that bind to RSV G protein

This application is a divisional application of chinese patent application 201480021357.6 entitled "human antibody binding to RSV G protein" filed 4/14/2014.

Technical Field

The present invention relates to medicine. The invention relates, inter alia, to antibodies and antigen-binding fragments that specifically bind to the attachment glycoprotein (G protein) of Respiratory Syncytial Virus (RSV) and neutralize RSV. The invention also relates to diagnostic, prophylactic and therapeutic methods using anti-RSV antibodies.

Background

Human Respiratory Syncytial Virus (RSV) is a negative-sense single-stranded RNA virus of the Paramyxoviridae family (Paramyxoviridae) which also includes common respiratory viruses such as those that cause measles and mumps. There are two primary RSV subtypes: subtype A and subtype B. RSV replicates in the upper respiratory tract and then spreads to the lower airways, leading to bronchiolitis or pneumonia. The virus causes inflammation, airway edema, increased mucus production, and respiratory epithelial rupture.

It is estimated that 6400 million respiratory diseases and 160,000 deaths worldwide can be attributed to RSV-induced disease. Severe RSV infection occurs most commonly in children and infants, especially premature infants. Potential health problems (such as chronic lung disease or congenital heart disease) can significantly increase the risk of serious illness. RSV infection may also cause serious illness in the elderly, individuals with chronic lung disease, and adults with immune insufficiency (e.g., bone marrow transplant recipients).

Several approaches to the prevention and treatment of RSV infection have been investigated. Intravenous immunoglobulin isolated from donors (RSV-IGIV;

) And monoclonal antibody palivizumab

Has been approved for RSV prophylaxis in high risk preterm infants. However, vaccines or commercially available treatments for RSV are not yet available. Ribavirin alone is approved for the treatment of RSV infection.In order to be effective for the treatment of RSV infection, high doses, repeated dosing and/or large amounts of antibody products (such as palivizumab) are desirable due to low effectiveness.

RSV has two major surface glycoproteins, F and G. The F protein mediates fusion, allowing the virus to enter the cytoplasm of the cell and promoting the formation of syncytia in vitro. The F protein sequence is well conserved (about 90%) among RSV strains (Johnson and Collins, J.Gen. Virol (1988)69: 2623-2628). The only commercially available monoclonal antibody palivizumab is directed against the F protein of RSV.

The G protein of RSV is a surface protein that is heavily glycosylated and serves as an attachment protein. In contrast to the F protein, the G protein is quite variable in the strain except for the Central Conserved Domain (CCD) which contains amino acid residues 153-184 of the G protein of the RSV A2 strain or the corresponding amino acid residues in other strains. The central conserved domain and the adjacent region (residues 145-193) are bounded by rigid and heavy O-glycosylated mucin-like regions. The N-terminal half of the central conserved domain contains a small region conserved among more than 700 strains. The C-terminal half contains 4 conserved cysteines linked in a 1-4, 2-3 arrangement and folds into a cystine lasso.

While passive immunization with antibodies directed against the G protein is generally considered impractical due to lack of sequence conservation in the virus strain, monoclonal antibodies that neutralize G protein bound to RSV are known. Anderson L.J (Anderson, L.J.) et al (J.Virol. (1988)62:4232-4238) describe the neutralizing capacity of F and G murine monoclonal antibody mixtures, one of which is associated with G protein binding (i.e., 131-2G). The antigenic site of this antibody was later defined by salender (Sullender) ("virology" (Virol.) (1995)209: 70-79). This antibody was found to bind to RSV groups a and B, which represent the major strains of RSV. In addition, WO 2009/055711 discloses antibodies that are immunoreactive with a conserved motif within position 160-176 of the G protein of RSV A2 and that have neutralizing activity against RSV A and B subtypes, such as 3D3 and 3G 12. These antibodies have been shown to recognize linear epitopes in the central conserved domain, but have not been tested in a preferred animal model (i.e., cotton rats) for evaluation of RSV antibodies and vaccines.

In view of the severity of respiratory diseases caused by RSV, particularly in young children and the elderly, there is a continuing need for effective means to prevent and treat RSV infection.

Summary of The Invention

The present invention provides isolated antibodies and antigen-binding fragments thereof that specifically bind to the G protein of RSV and are capable of neutralizing RSV. These antibodies and antigen-binding fragments are preferably capable of specifically binding to and neutralizing RSV of subtypes a and B. Preferably, these antibodies are human antibodies. These antibodies bind to epitopes in the central conserved aglycosylated region (also known as the central conserved domain, CCD) of the RSV G protein.

These antibodies and antigen binding fragments have high affinity for the G protein and have potent neutralizing capacity. These antibodies and antigen-binding fragments of the invention are useful as diagnostic, prophylactic and/or therapeutic agents, alone and in combination with other diagnostic, prophylactic and/or therapeutic agents.

The invention further provides compositions comprising one or more antibodies of the invention and/or antigen-binding fragments thereof. The invention also provides diagnostic, prophylactic and therapeutic methods using these anti-RSV antibodies. Methods of prevention and treatment include administering the anti-RSV antibodies and/or antigen-binding fragments thereof to a human subject for preventing or treating an RSV infection and RSV-mediated disease or condition and/or ameliorating one or more symptoms of an RSV infection. A variety of different anti-RSV antibodies and/or antigen-binding fragments thereof and/or combinations with other anti-RSV antibodies can be used in combination therapy. Also provided are compositions comprising these anti-RSV antibodies and/or antigen-binding fragments thereof in combination with other prophylactic or therapeutic agents. The invention also provides nucleic acid molecules encoding these antibodies or antigen-binding fragments thereof.

These antibodies of the invention are unique in that they are more potent against RSV types a and B than any known anti-RSV G antibody, particularly the known anti-RSV G monoclonal antibody 3D3, in an in vitro neutralization assay.

These antibodies of the invention bind to a unique epitope on the RSV G protein.

In certain embodiments, the antibodies comprise a heavy chain CDR3 comprising a CXXXXC motif in its amino acid sequence.

In certain embodiments, these antibodies and antigen-binding fragments thereof are unique in that they act additively and/or synergistically with anti-RSV F antibodies.

Drawings

FIG. 1 shows a schematic view of aBinding profiles for RSV Ga and RSV Gb proteins are shown. IgG was tested for its ability to bind to recombinant RSV Ga and Gb proteins in an ELISA assay. Open circles (dashed lines) indicate binding to Ga (RSV a/long) and closed circles (solid lines) indicate binding to Gb (RSV B/B1).

FIG. 2Neutralization profiles for RSV-A and RSV-B strains are shown. IgG was tested in a neutralization assay for its ability to neutralize RSV-A and RSV-B strains. Open circles (dashed line) indicate neutralized RSV-a (RSV a/a2) and closed circles (solid line) indicate neutralized RSV-B (RSV B/18537).

FIG. 3Binding of RSV G-specific monoclonal antibodies to RSV G peptides (ELISA) is shown. Short and long RSV G peptides spanning the central conserved domain (table 15) were used in a binding experiment in an ELISA with different concentrations of RSV G-specific mAb: CB017.5 (closed dark grey circle), CB030.1 (open dark grey circle) or no mAb (closed light grey circle).

FIG. 4:minimal epitope mapping by PepScan. Binding activity of RSV G protein-specific antibodies to all fully overlapping 5-mer, 8-mer, 10-mer, 14-mer, 18-mer, 25-mer, and 32-mer peptides of the central region (residues 145-201 of RSV-G A and B types). The binding activity to one peptide is shown as a vertical line proportional to the PepScan ELISA signal.

FIG. 5:alanine scan of the central region of the RSV G protein (PepScan). Alanine substitutions at all positions of the peptides corresponding to residues 161-192 of the RSV-G central domain of type A (left panel) and type B (right panel). The alanine at position 180 of form a is replaced with glycine. The reactivity of the initial peptide is shown in the form of a grey bar.

FIG. 6Showing monoclonal antibodies to RBinding of naturally occurring variants of the central region of the SV G protein. mabcb017.5 and CB030.1 binding to different peptides corresponding to the available type a (top panel) and type B (bottom panel) variants. Reactivity of wild-type peptide is shown in gray bar form.

FIG. 7The prophylactic efficacy of anti-RSV G mAb on lung and rhinovirus loads in cotton rat RSV-a/long model on day 4 post challenge is shown.

FIG. 8Therapeutic efficacy of anti-RSV G mAb on lung and rhinovirus loads in cotton rat RSV-a/length model on day 4 post challenge is shown.

FIG. 9Therapeutic efficacy of anti-RSV G mAb on histopathological scores in cotton rat RSV-a/length model at day 6 post challenge is shown.

Description of the invention

Definition of

The following gives definitions of terms as used in the present invention.

As used herein, the term "included" or "including" is to be taken as the word "without limitation" following.

As used herein, the term "antibody" refers to immunoglobulin molecules, including monoclonal antibodies, such as chimeric, humanized or human monoclonal antibodies. The term "antibody" includes all classes and subclasses of immunoglobulins known in the art. Depending on the amino acid sequence of the constant domain of its heavy chain, antibodies can be divided into five major complete antibody classes: IgA, IgD, IgE, IgG, and IgM, and several of these classes can be further divided into subclasses (isotypes), such as IgA1, IgA2, IgG1, IgG2, IgG3, and IgG 4. The term antibody also refers to antigen binding and/or variable domain-containing fragments of an immunoglobulin that compete with the intact immunoglobulin for specific binding to the immunoglobulin (i.e., the RSV G protein) binding partner. Regardless of structure, an antigen-binding fragment binds to the same antigen recognized by an intact immunoglobulin. Antigen-binding fragments include, inter alia, Fab, F (ab') 2, Fv, dAb, Fd, Complementarity Determining Region (CDR) fragments, single chain antibodies (scFv), bivalent single chain antibodies, (single) domain antibodies, diabodies, triabodies, tetradiabodies, (poly) peptides containing at least one immunoglobulin sufficient to cause a specific antigen to bind to a fragment of the (poly) peptide, and the like. An antigen binding fragment may comprise a peptide or polypeptide comprising an amino acid sequence of at least 2, 5, 10, 15, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90, 100, 125, 150, 175, 200, or 250 consecutive amino acid residues of the amino acid sequence of an antibody. Antigen-binding fragments may be produced synthetically or by enzymatic or chemical cleavage of intact immunoglobulins, or they may be genetically engineered by recombinant DNA techniques. Methods of production are well known in the art and are described, for example, in "antibodies: a description is given in the handbook of experiments (Antibodies: Laboratory Manual), ed.harlow, E.Harlow and D ryan (D, Lane) eds (1988), Cold Spring Harbor Laboratory (Cold Spring Harbor Laboratory), Cold Spring Harbor (Cold Spring Harbor), N.Y. (New York), which is incorporated herein by reference. An antibody or antigen-binding fragment thereof can have one or more binding sites. If more than one binding site is present, these binding sites may be identical to each other or they may be different.

As used herein, the term "monoclonal antibody" refers to an antibody molecule having a single specificity. A monoclonal antibody exhibits a single binding specificity and affinity for a particular epitope. Thus, the term "human monoclonal antibody" refers to an antibody exhibiting a single binding specificity having variable and constant regions derived from or based on human germline immunoglobulin sequences or derived from fully synthetic sequences. The method of preparing monoclonal antibodies is not related to the binding specificity.

As used herein, the term "functional variant" refers to an antibody comprising a nucleotide and/or amino acid sequence that is altered by one or more nucleotides and/or amino acids as compared to the nucleotide and/or amino acid sequence of a reference antibody and is capable of competing with the reference antibody for specific binding to a binding partner (i.e., RSV). In other words, modifications in the amino acid and/or nucleotide sequence of a reference antibody do not significantly affect or alter the binding characteristics of an antibody encoded by or containing the nucleotide sequence, i.e., the antibody is still capable of specifically recognizing and binding its target. Functional variants may have conservative sequence modifications, including nucleotide and amino acid substitutions, additions, and deletions. These modifications can be introduced by standard techniques known in the art (e.g., site-directed mutagenesis and random PCR-mediated mutagenesis) and can comprise natural as well as non-natural nucleotides and amino acids.

As used herein with respect to the antibodies of the invention, the term "neutralizing" refers to an antibody that is capable of preventing or inhibiting infection of a cell by a virus by neutralizing or inhibiting its biological effects and/or reducing infectious titer of RSV, regardless of the mechanism by which neutralization is achieved. Neutralization can be achieved, for example, by inhibiting attachment or adhesion of the virus to the cell surface or by inhibiting fusion of the virus with the cell membrane after attachment of the virus to the target cell, and the like.

As used herein with respect to the interaction of an antibody with its binding partner (e.g., an antigen), the term "specific binding" means that the interaction is dependent on the presence of a particular structure (e.g., an antigen-determining moiety or epitope) on the binding partner. In other words, the antibody preferentially binds or recognizes the binding partner even when the binding partner is present in a mixture of other molecules or organisms. Binding may be mediated by covalent or non-covalent interactions or a combination of both. In yet other words, the term "specifically binding" means that the antibody is specifically immunoreactive with one antigen-determining moiety or epitope and not immunoreactive with other antigen-determining moieties or epitopes. An antibody that (immuno) specifically binds to an antigen can bind to other peptides or polypeptides with lower affinity, as determined by, for example, Radioimmunoassay (RIA), enzyme-linked immunosorbent assay (ELISA), BIACORE, or other assays known in the art. An antibody or fragment thereof that specifically binds to one antigen can be cross-reactive with a related antigen carrying the same epitope. Preferably, an antibody or fragment thereof that specifically binds to one antigen does not cross-react with other antigens.

Detailed description of the invention

In a first aspect, the present invention provides antibodies and antigen-binding fragments capable of specifically binding to the G protein of Respiratory Syncytial Virus (RSV) and capable of neutralizing RSV. These antibodies are preferably capable of specifically binding to and neutralizing RSV of subtypes a and B. Preferably, these antibodies are human monoclonal antibodies.

The antibodies and antigen-binding fragments of the invention directed to RSV types a and B have been shown to be more potent than either of the known anti-RSV G antibodies, particularly the known anti-RSV G monoclonal antibody 3D3, in an in vitro neutralization assay, particularly an in vitro assay as described in example 7.

According to the invention, these antibodies and antigen-binding fragments bind to an epitope in the Central Conserved Domain (CCD) of the RSV G protein. The central conserved domain spans the amino acid sequence comprising amino acids 153-184 of the G protein of the RSV A2 strain (or corresponding amino acid residues in other strains).

According to the present invention, antibodies and antigen-binding fragments are provided which bind to an epitope comprising one or more amino acids within the region comprising amino acids 160-169 and one or more amino acids within the region comprising amino acids 184-192 of the RSV G protein (RSV A and B types; numbered according to the RSV A2 strain). Antibodies are thus provided that bind to an epitope that spans an almost entirely central conserved domain. These antibodies and antigen binding fragments bind to the central conserved domain in yet another completely different manner. These antibodies with the highest neutralizing capacity bind to a more complex epitope consisting of the entire central region and a part of the C-terminus of the basic region of the central domain (residues 160 and 192 of the RSV A and B types (numbered according to the RSVA2 strain). Although these antibodies bind to a larger and therefore more variable region, these antibodies bind and neutralize both subtypes because binding depends only on recognition of the backbone or side chains of conserved residues (see table 17). From fine localization using Pepscan analysis, it has been shown that antibodies are dependent on residues in the conserved N-terminal portion of the domain and residues in the C-terminal basic domain, and not on residues in cystine noose. These antibodies rely on the complex conformational integrity of the central domain because mutation of the cysteine abolishes binding (e.g., mab CB017.5 and especially CB030.1, see table 17). Localization shows that the 160-169 and 184-192 regions are part of the same antigenic region that complements the discrete epitopes of such antibodies.

In certain embodiments, the antibody is selected from the group consisting of:

a) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 1, a heavy chain CDR2 region of SEQ ID NO. 2, and a heavy chain CDR3 region of SEQ ID NO. 3,

b) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 7, a heavy chain CDR2 region of SEQ ID NO 8, and a heavy chain CDR3 region of SEQ ID NO 9,

c) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 13, a heavy chain CDR2 region of SEQ ID NO 14, and a heavy chain CDR3 region of SEQ ID NO 15,

d) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 19, a heavy chain CDR2 region of SEQ ID NO 20, and a heavy chain CDR3 region of SEQ ID NO 21,

e) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 25, a heavy chain CDR2 region of SEQ ID NO 26, and a heavy chain CDR3 region of SEQ ID NO 27,

f) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 31, a heavy chain CDR2 region of SEQ ID NO. 32, and a heavy chain CDR3 region of SEQ ID NO. 33,

g) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 37, a heavy chain CDR2 region of SEQ ID NO 38, and a heavy chain CDR3 region of SEQ ID NO 39,

h) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 43, a heavy chain CDR2 region of SEQ ID NO 44, and a heavy chain CDR3 region of SEQ ID NO 45,

i) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 49, a heavy chain CDR2 region of SEQ ID NO 50, and a heavy chain CDR3 region of SEQ ID NO 51,

j) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 55, a heavy chain CDR2 region of SEQ ID NO. 56, and a heavy chain CDR3 region of SEQ ID NO. 57,

k) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 61, a heavy chain CDR2 region of SEQ ID NO 62, and a heavy chain CDR3 region of SEQ ID NO 63; and

l) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 64, a heavy chain CDR2 region of SEQ ID NO. 65, and a heavy chain CDR3 region of SEQ ID NO. 66.

In certain embodiments, the antibody is selected from the group consisting of:

a) an antibody comprising a light chain CDR1 region of SEQ ID NO. 4, a light chain CDR2 region of SEQ ID NO. 5, and a light chain CDR3 region of SEQ ID NO. 6,

b) an antibody comprising a light chain CDR1 region of SEQ ID NO. 10, a light chain CDR2 region of SEQ ID NO. 11, and a light chain CDR3 region of SEQ ID NO. 12,

c) an antibody comprising a light chain CDR1 region of SEQ ID NO 16, a light chain CDR2 region of SEQ ID NO 17 and a light chain CDR3 region of SEQ ID NO 18,

d) an antibody comprising a light chain CDR1 region of SEQ ID NO. 22, a light chain CDR2 region of SEQ ID NO. 23, and a light chain CDR3 region of SEQ ID NO. 24,

e) an antibody comprising a light chain CDR1 region of SEQ ID NO 28, a light chain CDR2 region of SEQ ID NO 29 and a light chain CDR3 region of SEQ ID NO 30,

f) an antibody comprising a light chain CDR1 region of SEQ ID NO. 34, a light chain CDR2 region of SEQ ID NO. 35, and a light chain CDR3 region of SEQ ID NO. 36,

g) an antibody comprising a light chain CDR1 region of SEQ ID NO 40, a light chain CDR2 region of SEQ ID NO 41, and a light chain CDR3 region of SEQ ID NO 42;

h) an antibody comprising a light chain CDR1 region of SEQ ID NO. 46, a light chain CDR2 region of SEQ ID NO. 47, and a light chain CDR3 region of SEQ ID NO. 48;

i) an antibody comprising a light chain CDR1 region of SEQ ID NO 52, a light chain CDR2 region of SEQ ID NO 53 and a light chain CDR3 region of SEQ ID NO 54;

j) an antibody comprising a light chain CDR1 region of SEQ ID NO 58, a light chain CDR2 region of SEQ ID NO 59, and a light chain CDR3 region of SEQ ID NO 60;

k) an antibody comprising a light chain CDR1 region of SEQ ID NO 64, a light chain CDR2 region of SEQ ID NO 65, and a light chain CDR3 region of SEQ ID NO 66; and

l) an antibody comprising a light chain CDR1 region of SEQ ID NO. 70, a light chain CDR2 region of SEQ ID NO. 71 and a light chain CDR3 region of SEQ ID NO. 72.

In certain embodiments, the antibody is selected from the group consisting of:

a) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 1, a heavy chain CDR2 region of SEQ ID NO. 2, and a heavy chain CDR3 region of SEQ ID NO. 3, a light chain CDR1 region of SEQ ID NO. 4, a light chain CDR2 region of SEQ ID NO. 5, and a light chain CDR3 region of SEQ ID NO. 6;

b) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 7, a heavy chain CDR2 region of SEQ ID NO. 8, and a heavy chain CDR3 region of SEQ ID NO. 9, a light chain CDR1 region of SEQ ID NO. 10, a light chain CDR2 region of SEQ ID NO. 11, and a light chain CDR3 region of SEQ ID NO. 12,

c) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 13, a heavy chain CDR2 region of SEQ ID NO. 14, and a heavy chain CDR3 region of SEQ ID NO. 15, a light chain CDR1 region of SEQ ID NO. 16, a light chain CDR2 region of SEQ ID NO. 17, and a light chain CDR3 region of SEQ ID NO. 18;

d) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 19, a heavy chain CDR2 region of SEQ ID NO. 20, and a heavy chain CDR3 region of SEQ ID NO. 21, a light chain CDR1 region of SEQ ID NO. 22, a light chain CDR2 region of SEQ ID NO. 23, and a light chain CDR3 region of SEQ ID NO. 24;

e) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 25, a heavy chain CDR2 region of SEQ ID NO. 26, and a heavy chain CDR3 region of SEQ ID NO. 27, a light chain CDR1 region of SEQ ID NO. 28, a light chain CDR2 region of SEQ ID NO. 29, and a light chain CDR3 region of SEQ ID NO. 30;

f) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 31, a heavy chain CDR2 region of SEQ ID NO. 32, and a heavy chain CDR3 region of SEQ ID NO. 33, a light chain CDR1 region of SEQ ID NO. 34, a light chain CDR2 region of SEQ ID NO. 35, and a light chain CDR3 region of SEQ ID NO. 36;

g) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 37, a heavy chain CDR2 region of SEQ ID NO 38, and a heavy chain CDR3 region of SEQ ID NO 39, a light chain CDR1 region of SEQ ID NO 40, a light chain CDR2 region of SEQ ID NO 41, and a light chain CDR3 region of SEQ ID NO 42;

h) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 43, a heavy chain CDR2 region of SEQ ID NO 44, and a heavy chain CDR3 region of SEQ ID NO 45, a light chain CDR1 region of SEQ ID NO 46, a light chain CDR2 region of SEQ ID NO 47, and a light chain CDR3 region of SEQ ID NO 48;

i) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 49, a heavy chain CDR2 region of SEQ ID NO. 50, and a heavy chain CDR3 region of SEQ ID NO. 51, a light chain CDR1 region of SEQ ID NO. 52, a light chain CDR2 region of SEQ ID NO. 53, and a light chain CDR3 region of SEQ ID NO. 54;

j) an antibody comprising a heavy chain CDR1 region of SEQ ID NO. 55, a heavy chain CDR2 region of SEQ ID NO. 56, and a heavy chain CDR3 region of SEQ ID NO. 57, a light chain CDR1 region of SEQ ID NO. 58, a light chain CDR2 region of SEQ ID NO. 59, and a light chain CDR3 region of SEQ ID NO. 60;

k) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 61, a heavy chain CDR2 region of SEQ ID NO 62, and a heavy chain CDR3 region of SEQ ID NO 63, a light chain CDR1 region of SEQ ID NO 64, a light chain CDR2 region of SEQ ID NO 65, and a light chain CDR3 region of SEQ ID NO 66; and

l) an antibody comprising a heavy chain CDR1 region of SEQ ID NO 67, a heavy chain CDR2 region of SEQ ID NO 68, and a heavy chain CDR3 region of SEQ ID NO 69, a light chain CDR1 region of SEQ ID NO 70, a light chain CDR2 region of SEQ ID NO 71, and a light chain CDR3 region of SEQ ID NO 72.

In certain embodiments, the antibody comprises a heavy chain variable region comprising an amino acid sequence selected from the group consisting of seq id no:73, 75, 77, 79, 81, 83, 85, 87, 89, 91, 93 and 95.

In certain embodiments, the antibody comprises a light chain variable region comprising an amino acid sequence selected from the group consisting of seq id nos: SEQ ID NO 74, SEQ ID NO 76, SEQ ID NO 78, SEQ ID NO 80, SEQ ID NO 82, SEQ ID NO 84, SEQ ID NO 86, SEQ ID NO 88, SEQ ID NO 90, SEQ ID NO 92, SEQ ID NO 94 and SEQ ID NO 96.

In certain embodiments, the antibody is selected from the group consisting of:

a) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO. 73 and a light chain variable region comprising the amino acid sequence of SEQ ID NO. 74;

b) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 75 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 76;

c) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 77 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 78;

d) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:79 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 80;

e) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 81 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 82;

f) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 83 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 84;

g) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 85 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 86;

h) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO:87 and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 88;

i) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO. 89 and a light chain variable region comprising the amino acid sequence of SEQ ID NO. 90;

j) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 91 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 92;

k) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 93 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 94; and

l) an antibody comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO 95 and a light chain variable region comprising the amino acid sequence of SEQ ID NO 96.

In certain embodiments, antigen-binding fragments of the above antibodies are provided.

The antibodies and antigen-binding fragments of the invention bind to a different epitope than the epitope of a known anti-RSV G protein (e.g., known anti-RSV G antibody 3D3, which has also been shown to bind to an epitope in the central conserved domain of the RSV G protein). Binding to a different epitope means that the antibody binds to a different key amino acid residue than known antibodies (e.g., 3D 3). Furthermore, it has been shown that the antibodies of the invention are more potent than any of the known RSV G protein binding antibodies when measured in an in vitro neutralization assay, in particular an in vitro neutralization assay as described in example 7.

In certain embodiments, these antibodies act synergistically when used in combination with an antibody that binds to an RVS F protein. As used herein, the term "synergistic" means that the combined effect of these antibodies or antigen binding fragments when used in combination is greater than their additive effect when used individually. One way to calculate synergy is by means of combination indices. The concept of Combination Index (CI) has been described by Weekly (Chou) and Talalay (Talalay) (1984).

In certain embodiments, the antibodies are used as a medicament, and preferably for the diagnostic, therapeutic and/or prophylactic treatment of RSV infections caused by RSV subtypes a and/or B. As used herein, the term "treatment" or "treatment" refers to reducing the viral burden of a subject already infected with RSV and/or ameliorating the symptoms of disease in such a subject. Such symptoms include, for example, bronchiolitis, airway inflammation, pulmonary congestion, and dyspnea. "prevention" or "prophylaxis" encompasses inhibiting or reducing the spread of RSV or inhibiting or reducing the onset, development or progression of one or more symptoms associated with RSV infection.

The invention also relates to compositions comprising at least one antibody or antigen-binding fragment of the invention. In certain embodiments, these compositions are pharmaceutical compositions comprising at least one antibody or antigen-binding fragment according to the invention and at least one pharmaceutically acceptable excipient. By "pharmaceutically acceptable excipient" is meant any inert substance used in combination with an active molecule (such as an antibody) to prepare a suitable dosage form. A "pharmaceutically acceptable excipient" is one that is non-toxic to recipients at the dosages and concentrations used and is compatible with other ingredients of the formulation containing the drug, agent or antibody. Pharmaceutically acceptable excipients are widely applicable and known in the art.

In yet another embodiment, the invention relates to the use of an antibody of the invention for the preparation of a medicament for the diagnosis, prevention and/or treatment of RSV infection. The invention also relates to methods of preventing or treating RSV infection by administering a therapeutically effective amount of an antibody according to the invention to a subject in need thereof. The term "therapeutically effective amount" refers to an amount of an antibody as defined herein that is effective to prevent, ameliorate and/or treat a condition caused by RSV infection. As used herein, ameliorating can refer to reducing visible or perceptible symptoms of disease, viremia, or any other measurable manifestation of RSV infection.

For use in therapy, the antibodies or fragments thereof are formulated into pharmaceutical compositions using suitable excipients and administered according to standard protocols. The pharmaceutical composition may have a monoclonal antibody, particularly a monoclonal antibody or fragment cross-reactive with subtype a and B G proteins, as its sole active ingredient. Alternatively, two monoclonal antibodies may be the only active ingredients, one of which reacts more strongly with subtype a G protein and the other with subtype B G protein. In all of these cases, additional therapeutic agents may be present, including one or more antibodies immunoreactive with the F protein of RSV or other therapeutic agents effective against RSV or inflammation. Thus, anti-inflammatory agents (e.g., steroidal and non-steroidal anti-inflammatory compounds) may be included in the compositions.

In certain embodiments, a full antibody, i.e., containing a complement-containing Fc region, is used.

In certain embodiments, for example to reduce an inflammatory response in the lung, only antigen-binding fragments of the antibodies are used. It is also within the scope of the invention to administer a mixture of immunospecific fragments and intact antibodies.

Treatment can target a group of patients susceptible to RSV infection. Such patient groups include, but are not limited to, for example, elderly (e.g., > 50 years, > 60 years, and preferably > 65 years), younger (e.g., < 5 years, 1 year), hospitalized patients, immunocompromised patients, and patients who have been treated with an antiviral compound but have shown an inadequate antiviral response.

Administration of the antibody compositions of the invention is typically by injection, generally intramuscular or intravenous injection. Formulations are prepared in a manner generally known in the art for administering antibody compositions. Suitable formulations may be found in standard formulations such as Remington's Pharmaceutical Sciences, latest edition, Mark Publishing Co., Easton, Pa.P.Farne (PA), incorporated herein by reference. Formulations are typically formulations suitable for parenteral administration, including isotonic solutions containing buffers, antioxidants, and the like; and emulsions comprising delivery vehicles such as liposomes, micelles, and nanoparticles. The desired protocol and formulation will depend upon the judgment of the attending physician and the particular condition of the subject. Dosage levels will depend on the age, general health and severity of infection of the subject, as appropriate.

Another aspect of the invention encompasses functional variants of the antibodies as defined herein. A molecule is considered to be a functional variant of an antibody according to the invention if the variant is capable of competing with a "parent" or "reference" antibody for specific binding to RSV or a fragment thereof. In other words, a molecule is considered to be a functional variant of an antibody according to the invention when the functional variant is still capable of binding to the same or overlapping epitopes of RSV or a fragment thereof. Functional variants include, but are not limited to, derivatives having substantially similar primary structural sequences, including derivatives having modifications in the Fc receptor or other region involved in effector function, and/or derivatives containing chemical and/or biochemical modifications in vitro or in vivo, e.g., not found in the parent antibody. Such modifications include, inter alia, acetylation, acylation, covalent attachment of nucleotides or nucleotide derivatives, covalent attachment of lipids or lipid derivatives, cross-linking, disulfide bond formation, glycosylation, hydroxylation, methylation, oxidation, pegylation, proteolytic processing, phosphorylation, and the like.

Alternatively, a functional variant may be an antibody as defined in the present invention comprising an amino acid sequence comprising one or more amino acid substitutions, insertions, deletions or combinations thereof compared to the amino acid sequence of the parent antibody. In addition, functional variants may comprise truncations of the amino acid sequence at either or both of the amino or carboxy termini. The functional variants according to the invention may have the same or different, or higher or lower, binding affinity compared to the parent antibody but still be capable of binding to RSV or a fragment thereof. For example, for RSV or one of its fragments, a functional variant according to the invention may have increased or decreased binding affinity compared to the parent antibody. Preferably, the amino acid sequence of the variable regions (including but not limited to framework regions, hypervariable regions, particularly the CDR3 regions) is modified. In general, the light and heavy chain variable regions comprise three hypervariable regions, comprising three CDRs and more conserved regions, the so-called Framework Regions (FRs). The hypervariable region comprises amino acid residues from the CDRs and amino acid residues from the hypervariable loops. Functional variants intended to be within the scope of the present invention have at least about 50% to about 99%, preferably at least about 60% to about 99%, more preferably at least about 70% to about 99%, even more preferably at least about 80% to about 99%, most preferably at least about 90% to about 99%, particularly at least about 95% to about 99% and especially at least about 97% to about 99% amino acid sequence identity and/or homology to the parent antibody as defined herein. Computer algorithms known to those of ordinary skill in the art, such as Gap or Bestfit, among others, can be used to optimally align the amino acid sequences to be compared and define similar or identical amino acid residues. Functional variants can be obtained by altering the parent antibody or portion thereof by general molecular biology methods known in the art, including (but not limited to) error-prone PCR, oligonucleotide-directed mutagenesis, site-directed mutagenesis, and heavy and/or light chain shuffling.

In yet another aspect, the invention encompasses immunoconjugates, i.e., molecules comprising at least one antibody, antigen-binding fragment or functional variant and further comprising at least one tag (such as, inter alia, a detectable moiety/agent). Also encompassed in the present invention are mixtures of immunoconjugates according to the invention or mixtures of at least one immunoconjugate according to the invention with another molecule, such as a therapeutic agent or another antibody or immunoconjugate. In another embodiment, the immunoconjugate of the invention may comprise more than one tag. These labels may be the same or different from each other and may be non-covalently linked/bound to the antibody. The tag or tags may also be directly linked/bound to the human antibody by covalent bonding. Alternatively, the tag or tags may be linked/bound to the antibody by means of one or more linking compounds. Techniques for binding a tag to an antibody are well known to those skilled in the art. The labels of the immunoconjugates of the invention may be therapeutic agents, but they may also be detectable moieties/agents. Suitable labels in therapy and/or prophylaxis may be toxins or functional parts thereof, antibiotics, enzymes, other antibodies enhancing phagocytosis or immune stimulation. Immunoconjugates comprising a detectable agent can be used, for example, to diagnostically assess whether a subject has been infected with RSV, or to monitor the progression or progression of RSV infection as part of a clinical testing procedure, e.g., to determine the efficacy of an established treatment regimen. However, they may also be used for other detection and/or analysis and/or diagnostic purposes. Detectable moieties/agents include, but are not limited to, enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron-emitting metals, and nonradioactive paramagnetic metal ions. The label used to label the antibody for detection and/or analysis and/or diagnostic purposes depends on the specific detection/analysis/diagnostic technique and/or the method used, such as, inter alia, immunohistochemical staining of (tissue) samples, flow cytometry detection, scanning laser cytometry detection, fluorescence immunoassay, enzyme-linked immunosorbent assay (ELISA), Radioimmunoassay (RIA), bioassays (e.g. phagocytosis assays), western blot applications, etc. Suitable labels for use in detection/analysis/diagnostic techniques and/or methods known in the art are well within the ability of those skilled in the art.

In addition, the human antibodies or immunoconjugates of the invention can also be linked to solid carriers that are particularly useful in vitro immunoassays or in the purification of RSV or fragments thereof. The antibodies of the invention may be fused to a marker sequence (e.g., a peptide) to facilitate purification. Examples include, but are not limited to, a hexahistidine tag, a Hemagglutinin (HA) tag, a myc tag, or a flag tag. Alternatively, an antibody may bind to a second antibody to form an antibody heteroconjugate. In another aspect, an antibody of the invention may bind/be linked to one or more antigens. Preferably, the antigens are antigens recognized by the immune system of a subject administered the antibody-antigen conjugate. These antigens may be the same, but may also be different from each other. Binding methods for linking antigens to antibodies are well known in the art and include, but are not limited to, the use of cross-linking agents.

Next to chemically generating immunoconjugates by conjugation directly or indirectly via, for example, a linker, the immunoconjugates can be generated as fusion proteins comprising an antibody of the invention and a suitable tag. Fusion proteins can be produced by methods known in the art, such as, for example, recombinantly by constructing nucleic acid molecules comprising in frame the nucleotide sequences encoding the antibodies and the nucleotide sequence encoding the appropriate tag or tags and then expressing the nucleic acid molecules.

Another aspect of the invention provides a nucleic acid molecule encoding an antibody, antigen-binding fragment or functional variant according to the invention. Such nucleic acid molecules may be used as intermediates for cloning purposes, e.g. in affinity maturation as described above. In a preferred embodiment, these nucleic acid molecules are isolated or purified. The skilled artisan will appreciate that functional variants of these nucleic acid molecules are also intended to be part of the present invention. A functional variant is a nucleic acid sequence that can be directly translated using standard genetic code to provide an amino acid sequence identical to the amino acid sequence translated from the parent nucleic acid molecule.

Preferably, these nucleic acid molecules encode antibodies comprising CDR regions as described above. In another embodiment, these nucleic acid molecules encode an antibody comprising two, three, four, five, or even all six CDR regions of an antibody of the invention.

Another aspect of the invention is to provide vectors (i.e., nucleic acid constructs) comprising one or more nucleic acid molecules according to the invention, which may be derived from plasmids such as, inter alia, F, R1, RP1, Col, pBR322, TOL, Ti, etc., cosmids, bacteriophages such as, lambda, M13, Mu, P1, P22, Q β, Tjio, Tqi, T2, T4, T7, etc., plant viruses.

The invention also provides host cells containing one or more copies of the vectors mentioned above. Host cells include, but are not limited to, cells of mammalian, plant, insect, fungal or bacterial origin. Bacterial cells include, but are not limited to, cells from gram-positive or gram-negative bacteria such as several species of the genera Escherichia (e.coli) and Pseudomonas (Pseudomonas). Among the group of fungal cells, yeast cells are preferably used. Expression in yeast can be achieved by using yeast strains such as, inter alia, Pichia pastoris (Pichia pastoris), Saccharomyces cerevisiae (Saccharomyces cerevisiae) and Hansenula polymorpha (Hansenula polymorpha). In addition, insect cells (e.g., cells from Drosophila and Sf9) can be used as host cells. In addition, the host cell may be a plant cell, in particular a cell from a crop plant, such as a forestry plant, or a plant which supplies food and raw materials, such as a cereal or medicinal plant, or a cell from an ornamental plant, orCells from a bud crop. Transformed (transgenic) plants or plant cells are produced by known methods, such as agrobacterium-mediated gene transfer, transformation of leaf discs, protoplast transformation by polyethylene glycol-induced DNA transfer, electroporation, sonication, microinjection or ballistic gene transfer. Alternatively, a suitable expression system may be a baculovirus system. Expression systems using mammalian cells, such as Chinese Hamster Ovary (CHO) cells, COS cells, BHK cells, NSO cells or Bowes melanoma cells, are preferred in the present invention. Mammalian cells provide post-translational modifications to the expressed protein that most closely resemble native molecules of mammalian origin. Because the present invention deals with molecules that may have to be administered to humans, a fully human expression system would be particularly preferred. Thus, even more preferably, the host cell is a human cell. Examples of human cells are inter alia hela, 911, AT1080, a549, 293 and HEK293 cells. In preferred embodiments, the human producer cell comprises at least a functional portion of a nucleic acid sequence (in expressible form) encoding an adenoviral E1 region. In an even more preferred embodiment, the host Cell is derived from a human retina and immortalized with a nucleic acid comprising an adenoviral E1 sequence, such as 911 cells or deposited at the European Collection of Cell Cultures (ECACC) at 96022940, 2.29.1996, using the microbiological research Center (CAMR), Soltzbury (Salisbury), Wiltshire SP4OJG (Wiltshire SP4OJG), Great Britain (Great Britain) and under the trademarks of

(PER. C6 is a registered trademark of the Netherlands Cussel private company (Crucell Holland B.V.)) a commercially available cell line. C6 cells "for the purposes of this application refer to the cell deposited under number 96022940 or the elite, upstream or downstream generation of the deposited cell, as well as progeny from the elite, as well as derivatives of any of the foregoing. Production of recombinant proteins in host cells can be performed according to methods well known in the art. Using trademarks

Commercially available cells have been described as a production platform for proteins of interest in WO 00/63403, the disclosure of which is incorporated herein by reference in its entirety.

Antibodies can be prepared by different methods. A method of making an antibody according to the invention is an additional part of the invention. The method comprises the following steps: a) cultivating a host according to the invention under conditions conducive to the expression of the antibody, and b) optionally recovering the expressed antibody. The expressed antibodies can be recovered from the cell-free extract, but preferably they are recovered from the culture medium. The above manufacturing methods may also be used to manufacture functional variants and/or immunoconjugates of the antibodies of the invention. Methods for recovering proteins (e.g., antibodies) from cell-free extracts or media are well known to those skilled in the art.

Alternatively, next to expression in a host (e.g., a host cell), the antibodies and immunoconjugates of the invention can be made synthetically by conventional peptide synthesizers or in cell-free translation systems using RNA nucleic acids derived from DNA molecules according to the invention. Antibodies according to the invention may also be produced by transgenic non-human mammals expressing human immunoglobulin genes, such as for example transgenic mice or rabbits. Preferably, the transgenic non-human mammal has a genome comprising a human heavy chain transgene and a human light chain transgene encoding all or part of a human antibody as described above. The transgenic non-human mammal may be immunized with a purified or enriched preparation of RSV or a fragment thereof. Protocols for immunizing non-human mammals are well-defined in the art. See "use of antibody: the disclosure of the experimental handbook (Usingantibodies: A Laboratory Manual), E.Harlo, D Laien eds (1998), Cold spring harbor Laboratory, Cold spring harbor, New York and Current Protocols in Immunology, J.E. Koley root (J.E.Coligan), A.M. Cruis beck (A.M.Kruisbek), D.H. Margulis (D.H. Margulies), E.M. Shewach (E.M.Shevach), W.St.Rober (W.Strober) eds (2001), John Wiley & Sons, Inc., N.Y., the disclosures of which are incorporated herein by reference. Immunization protocols typically involve multiple immunizations with or without an adjuvant (e.g., Freund's complete adjuvant and Freund's incomplete adjuvant), but may also include naked DNA immunization. In other embodiments, the human antibody is produced by a B cell, plasma cell, and/or memory cell derived from a transgenic animal. In yet another embodiment, the human antibodies are produced by hybridomas prepared by fusing B cells obtained from the transgenic non-human mammals described above with immortalized cells. B cells, plasma cells and hybridomas as obtainable from the transgenic non-human mammals described above and human antibodies, B cells, plasma cells and/or memory cells and hybridomas as obtainable from the transgenic non-human mammals described above are also part of the invention.

The invention further provides a kit comprising at least one antibody according to the invention, one immunoconjugate, and/or at least one nucleic acid. Optionally, the above-described components of the kits of the invention are packaged in suitable containers and labeled for diagnosis, prevention and/or treatment of a specified condition. The above-mentioned components may be stored in unit or multi-dose containers in the form of an aqueous, preferably sterile solution or in the form of a lyophilized, preferably sterile, formulation for reconstitution. The kit may further comprise a further container comprising a pharmaceutically acceptable buffer. It may further comprise other substances desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, media for one or more suitable hosts, and possibly even at least one other therapeutic, prophylactic or diagnostic agent. Instructions associated with the kits can be customarily included in commercial packages of therapeutic, prophylactic or diagnostic products, containing information about, for example, the indication, usage, dosage, manufacture, administration, contraindications and/or warnings concerning the use of such therapeutic, prophylactic or diagnostic products.

The antibodies according to the invention can also be advantageously used as a diagnostic agent in an in vitro method for the detection of RSV. The invention thus further relates to a method of detecting RSV in a sample, wherein the method comprises the steps of: (a) assaying a sample for the level of RSV antigen, e.g., by contacting a sample with a diagnostically effective amount of an antibody (or fragment thereof) or immunoconjugate according to the invention, and (b) comparing the assayed level of RSV antigen to a control level, whereby an increase in the assayed level of RSV antigen compared to the control level is indicative of RSV infection. The sample may be a biological sample including, but not limited to, blood, serum, stool, sputum, nasopharyngeal aspirate, bronchial lavage, urine, tissue or other biological material from (possibly) an infected subject; or a non-biological sample such as water, a beverage, etc. The sample may be manipulated first to make it more suitable for use in a detection method. Manipulation means especially the treatment of a sample suspected to contain and/or to contain a virus in such a way that the virus will break down into antigenic components, such as proteins, (poly) peptides or other antigenic fragments. Preferably, the antibody or immunoconjugate of the invention is contacted with the sample under conditions such that an immune complex is formed between the antibody and the virus or antigenic component thereof that may be present in the sample. The formation of an immune complex, if any, indicative of the presence of the virus in the sample is then detected and measured by suitable means. Such methods include, inter alia, homogeneous and heterogeneous binding immunoassays, such as Radioimmunoassays (RIA), ELISA, immunofluorescence, immunohistochemistry, FACS, BIACORE, and western blot analysis. Preferred analytical techniques, particularly for large-scale clinical screening of patient serum and blood-derived products, are ELISA and western blotting techniques. ELISA tests are particularly preferred.

The invention is further shown in the following examples which are not intended to limit the invention.

Examples of the invention

Example 1

Antigen production and labelling

Unlike the fusion protein expressed on the surface of the viral coat (RSV F), the attachment protein (RSV G) is highly variable, thus defining two broad subtypes of RSV (i.e., subtypes a and B). Despite sequence variability, RSV G contains a central and highly conserved region. In an attempt to obtain broadly neutralizing monoclonal antibodies, RSV G corresponding to one representative subgroup a (RSV a/long) and subgroup B strain (RSV B/B1) was recombinantly expressed. In the following examples, recombinant RSV attachment protein (G protein) was expressed in 293 freestyle cells, purified, and labeled for use in single cell sorting experiments.

Expression of RSV Ga and Gb

Recombinant RSV attachment proteins (G proteins) corresponding to RSV a/length (accession number P20895) and RSV B/B1 (accession number NP _056862), referred to herein as RSV Ga and Gb, were expressed from a CMV-based promoter mammalian expression vector (Invitrogen Corp.), pcdna3.1, with a myc (eqkliseeld) and 6X histidine tag (table 1). A leader sequence corresponding to the human vkappa I signal peptide was introduced at the amino terminus to facilitate secretion. Both RSV Ga and Gb lack transmembrane domain expression and include amino acids 65-288 and 65-299 of RSV Ga and Gb, respectively.

RSV Ga and Gb were transfected according to manufacturer's instructions. Recombinantly expressed RSV Ga and Gb proteins were purified using nickel NTA chromatography. Seventy-two hours post-transfection, supernatants were collected and dialyzed against 20mM Tris-HCl pH8 and 300mM NaCl overnight. The following day, dialysis was repeated with fresh buffer and continued for another 6 hours. The dialyzed supernatant was then supplemented with 5% glycerol and 10mM imidazole (VWR, cat # EM-5720) and loaded onto a column packed with 2mL Ni-NTA agarose beads (Qiagen, cat # 30310). The binding protein was then washed with 12.5mL of a wash buffer consisting of: 20mM Tris-HCl, pH8, 300mM NaCl, 5% glycerol and 20mM imidazole. The protein was then eluted with 5mL of elution buffer containing: 20mM Tris-HCl, pH8, 300mM NaCl, 5% glycerol and 50mM imidazole. Finally, the eluate was dialyzed against four liters of Phosphate Buffered Saline (PBS) overnight at 4 ℃. The dialyzed protein was then concentrated to 0.5-1.0mL in a 30K MWCO concentrator (Millipore, Amicon Ultracel concentrator) and quantified by bicinchoninic acid analysis (BCA analysis; Seimer Feishol (Thermo Fisher), according to the manufacturer's instructions). In addition, the purified proteins were each subjected to quality control by SDS-PAGE/Coomassie (Coomassie).

RSV Ga was fluorescently labeled with Alexa Fluor 647(AF 647) using Alexa Fluor 647 micro-scale protein labeling kit (invitrogen catalog No. a30009) according to the manufacturer's instructions. Briefly, 100 μ g RSV Ga was labeled with an estimated degree of labeling of 3 moles dye per molecule protein. After a 15 minute incubation period with the dye, the labeled protein was purified using Biogel beads supplied with the kit. After purification, the actual degree of labelling was determined to be 1.2 moles AF 647 per mole protein using a NanoDrop UV spectrophotometer (manufacturer). Similarly, RSV Gb protein was labeled with Alexa Fluor 488(AF 488) using a micro-scale protein labeling kit (invitrogen cat No. a 30006). One hundred μ g of protein was labeled according to manufacturer's instructions and after final purification, the degree of labeling was determined to be about 2 molecules AF 488 per mole protein using a NanoDrop spectrophotometer.

Example 2

Identification of anti-RSV G-specific antibodies

Broadly neutralizing monoclonal antibodies against RSV G protein were recovered from memory B cells (CD19+ CD27+ IgG +) isolated from Peripheral Blood Mononuclear Cells (PBMCs) obtained from San diego blood Bank. Briefly, CD22+ B cells were stained with fluorescently labeled antibodies as B cell surface markers and incubated with RSV Ga, Gb (labeled with Alexa Fluor 647 and 488, respectively, as described in example 1) or RSV G Central Conserved Domain (CCD) biotin-binding peptide (SYM-1706). CD19/CD27/IgG/RSVGa/RSVGb or CD19/CD27/IgG/SYM-1706 (used in some sorting experiments) positive cells were sorted and single cells were placed into individual wells of a 96-well plate using either a FACSAria II (BD biosciences) or MoFlo XDP (Beckman Coulter). The plates were stored at-80 ℃ until processing. On average about 10-25x 10 per donor study⁶And (4) B cells.

Example 3

Recovery of heavy and light chain genes from single B cells specific for RSV Ga and Gb

As described in example 2, broadly neutralizing monoclonal antibodies against RSV were isolated from memory B cells (CD19+ CD27+ IgG +) reactive with RSV Ga and Gb proteins or RSV G Central Conserved Domain (CCD) biotin-binding peptide (SYM-1706). The heavy and light chain genes were then recovered from individual B cells by a two-step PCR method, cloned, and expressed in vitro as Fab antibodies.

First Strand cDNA Synthesis

Complementary DNA (cDNA) was generated from the individually sorted cells using the Invitrogen Superscript III first Strand Synthesis kit (Superscript III kit, catalog # 18080-.

IgG heavy and light chain amplification by nested PCR

IgG heavy and light chain variable regions (kappa and lambda chains) were amplified from freshly prepared cDNA using a two-step nested PCR method. Next, the heavy and light chain PCR fragments were pooled into a single cassette to facilitate downstream cloning using an overlap extension PCR.

Step I amplification

In step I, 2.5 μ Ι _ of freshly prepared cDNA generated as described above was used as template to amplify the heavy, kappa and lambda light chains. Primer pools specifically designed for the leader regions of the antibody heavy chain (CB-5 ' LVH primer), kappa light chain (CB-5 ' LVk primer) and lambda light chain (CB-5 ' LVlam primer) were used (tables 2-4). Single reverse primers specifically designed for the CH1, Ck and CL regions of the heavy, kappa and lambda light chains, respectively, were used in the step I PCR reaction.

Step II amplification

1) In step II, 2.5. mu.L of the step I PCR product resulting from the above reaction was used as a template to amplify the heavy, kappa and lambda light chains. A pool of forward primers specifically designed for the framework 1 region of the antibody heavy chain, kappa light chain and lambda light chain was used (tables 5-7). A pool of reverse primers specifically designed for the heavy chain cleavage junction (3' SalIJH primer), the kappa light chain cleavage junction (3' Jk primer) and the 5' region specific primer corresponding to the lambda light chain (CB-VL primer) was used. In addition, the step II forward primer was engineered to introduce a SfiI restriction site, while the step II heavy chain reverse primer was designed to introduce a SalI restriction site.

Step III, amplification: overlap extension PCR

In step III, heavy and light chain DNA fragments (step II products) were ligated into a single cassette via overlap extension PCR using: 1) fab linkers amplified as outlined below (κ or λ; table 8), which anneals to the 3 'end of the light chain step II and the 5' end of the heavy chain step II fragment and contains either a kappa or lambda constant region, 2) a forward overlapping primer with a SfiI restriction site, which anneals to the 5 'end of the light chain, and 3) a reverse primer with a SalI restriction site, which anneals to the 3' end of the heavy chain step II fragment (table 9). This reaction produced a 1200bp fragment (i.e., cassette) consisting of the light chain-linker-heavy chain. After amplification, the PCR linker reaction products or the overlap extension PCR reaction products were separated on a 1% agarose gel and gel extracted according to the manufacturer's instructions (Qiagen gel extraction kit; catalog No. 28706).

Digestion and cloning into bacterial expression vectors

After PCR purification (Qiagen) overlap extension PCR, fragments were digested and the digested overlap products were then separated on a 1% agarose gel. The band corresponding to the overlapping cassette (about 1.1kb) was purified by gel extraction (Qiagen). Finally, the digested overlapping extension products were ligated and cloned into the pCB-Fab bacterial expression vector. All transformations were performed using DH5a maximum efficiency cells (Invitrogen, Cat. No. 18258-012). Approximately 100. mu.l of the recovered cells were plated on a 100. mu.g/ml carbenicillin plate supplemented with 20mM glucose. Plates were incubated overnight at 37 ℃ to allow colonies to grow.

Example 4

Fab binding to RSV G and monoclonal antibody rescue

The Fab antibodies cloned in example 3 were expressed in bacteria and tested for their ability to bind to RSV Ga, RSV Gb or RSV G Central Conserved Domain (CCD) peptide (SYM-1706 amino acid sequence: biotin-KQRQNKPPNKPNNDFHFEVFNFVPCSICSNNPTCWAICKR; SEQ ID NO: 173).

Bacterial supernatants were added to RSV Ga, Gb, CCD peptide, negative control actin and anti-human f (ab)2 coated plates and incubated at 37 ℃ for 2 hours (except for the CCD peptide, it was incubated on one streptavidin coated plate and incubated at room temperature for 2 hours). CR9514 (an antibody, based on antibody 3D3, as disclosed in WO 2009/055711) was used as a positive control against RSV Ga, Gb, CCD peptides and anti-human f (ab)2 coated plates at a dilution of 0.1 μ g/mL in 0.4% NFDM/PBS/0.05% Tween 20. Mouse anti-actin (Sigma), cat # a3853) was used as a positive control for bovine actin-coated plates at 1.25 μ g/mL. anti-HA HRP (Roche, cat # 12013819001) was used as a secondary antibody to the bacterial supernatant. Anti-human Fab (Jackson laboratories, Cat 109. 036. 097) was used in the CR9514 (variable region containing 3D3) control well. Finally, goat anti-mouse HRP (Jackson laboratory, Cat. No. 115-035-072) was used for actin positive control. After incubation, the plates were washed four times in PBS/0.05% Tween20 and developed with 50 μ L of 1:1v/v TMB: peroxide solution (Pierce, Cat. No. 34021) for about 5 minutes. By adding 50. mu.L of 2N H₂SO₄The reaction was immediately stopped and absorbance at 450nm was measured using an ELISA plate reader. Positive binding is by OD greater than 0.5₄₅₀(0.5-0.9 is moderate binding,>1 is strong binding) and a response 3 times higher than background.

Based on ELISA results, about six clones reactive with the target antigen were selected on average. Since each Fab antibody was initially cloned using a pool of framework 1-specific and cleavage site-specific primers, the likelihood of cross-activation of particularly highly relevant primers is high. For this reason, several bacterial clones representing each overlapping product were selected for sequencing. Plasmid miniprep DNA was prepared according to the manufacturer's guidelines (Qiagen miniprep kit catalog No. 27106). Heavy and light chains corresponding to each selected clone were sequenced using the primers highlighted in table 10. The sequence was analyzed, the closest germ line was identified, and the CDRs and framework regions were determined. This information was then used to design primers to clone and convert the candidate antibodies to IgG.

Example 5

Cloning, sequencing and purification of IgG

Fab antibodies reactive with RSV Ga, Gb and CCD peptides identified in the bacterial ELISA outlined in example 4 were cloned and expressed as IgG in human embryonic kidney cells (293-F cells). The IgG was then purified by assay concentration, SDS-PAGE, and by size exclusion chromatography and quality control.

IgG cloning and sequencing information

Fab antibodies identified in bacterial ELISA (outlined in example 4) were then converted to IgG by: the variable heavy and light domains (κ and λ) were cloned by restriction digestion into pCP9- κ (SEQ ID NO:176) and pCP9- λ (SEQ ID NO:177) expression vectors. Considering the possibility of cross-activation (described previously in example 4), the initial amino acid of FR1 and the final amino acid of the splice region of each bacterial clone selected for conversion to IgG often differ from the amino acid of its corresponding germline sequence. For this reason, primers specific to each antibody were designed to restore FR1 and the splice point regions to the heavy and light chain genes of each selected bacterial clone. The heavy and light chains were amplified using the corresponding bacterial clones (expressed from the pCB-Fab vector in example 4) and cloned into the pCP9 expression vector in a serial manner.

Amplification of the heavy chain produced a fragment of average size 370bp, which was resolved on a 1% agarose gel and gel extracted according to the manufacturer's instructions (Qiagen). The heavy chain fragment was then used to ligate the HAVT20 leader sequence by overlap extension PCR (5'-ATGGCCTGCCCTGGCTTTCTCTGGGCACTTGTGATCTCCACCTGTCTTGAATTTTCCATGGCT-3'; MACPGFLWALVISTCLEFSMA).

The corresponding overlapping HAVT 20-heavy chain product was then PCR purified according to the manufacturer's instructions (Qiagen). The connection is performed continuously; that is, either the light chain is digested first and the linker or the corresponding heavy chain is digested and inserted. After either the light or heavy chain insertions have been sequence verified, a representative bacterial clone is selected, a miniprep is prepared and used to clone the second chain (i.e., either the light or heavy chain, depending on the first cloned chain). To clone the heavy chain fragment, the pCP9 vector and the PCR purified heavy chain overlap were digested with the restriction enzymes BamHI HF (NEB, cat # R3136L) and XhoI (NEB, cat # R0146L). The digested pCP9 vector and heavy chain overlap were then resolved on a 1% agarose gel and gel extracted (higher about 9.5kB for pCP9 vector). Ligation was performed in a 1:3 vector to insert ratio and transformed into DH5a most efficient cells (Invitrogen, Cat. No. 18258-012). After confirmation by sequencing, the second chain (e.g., light chain) is cloned. To clone the light chain fragments, pCP9 clones containing the corresponding heavy chain and the light chain PCR product were digested with NotI HF (NEB, catalog No. R3189L) and XbaI (NEB, catalog No. R0145L). The light chain was then ligated into the pCP9 vector via the XbaI and NotI sites and in-frame with its HAVT20 leader sequence. Clones containing the corresponding heavy chain genes were used for subcloning. The ligation was then transformed into DH5a most efficient cells. Several colonies were selected for sequencing and analysis (tables 11 and 12 show the sequences of antibody heavy and light chains annotated by framework and CDR regions, respectively).

IgG expression and purification

For expression of each IgG, a medium preparation of pCP9 vector containing the heavy and light chain genes of interest was prepared (Qiagen) and used to transfect 293-F cells using 293fectin (Invitrogen, Cat. No. 51-0031) according to the manufacturer's instructions. Transfection was performed for 72 hours to allow for sufficient IgG production. After 72 hours post-transfection, the cell culture medium was collected and centrifuged to remove the cells. Purification was achieved by column chromatography using a protein A column (protein A Sepharose beads; Amersham, Cat. No. 17-0963-03). The eluate was then dialyzed twice against 4 liters of 20mM Tris-HCl pH 7.2, 150mM NaCl. Finally, the dialyzed sample was concentrated down to about 1mL using a 10kDa Amicon Ultra column (Millipore).

A series of quality control steps were performed on each IgG to determine concentration and purity and to assess size. IgG concentrations were initially determined via NanoDrop readings using an IgG molar extinction coefficient of 210,000M-1 cm-1. In addition, IgG concentrations were confirmed by BCA analysis (seemer fly) according to the supplier's instructions and by measurement on Octet Red384 (fordebio) using protein a sensor tips. As an additional quality control step, SDS-PAGE was performed under non-reducing and reducing conditions (i.e., ± DTT) followed by biosafety coomassie staining (Biorad) to visualize intact IgG or reduced heavy and light polypeptide chains. Finally, IgG quality control was performed by size exclusion chromatography using a Superdex 20010/300 GL gel filtration column (Pharmacia).

Example 6

IgG binding assay

IgG and anti-RSVG antibody CR9514 (comprising the variable region of 3D3) produced and quality controlled as described in example 5 above were tested for their ability to bind to recombinant RSV Ga and Gb proteins in an ELISA assay. Briefly, 96-half well ELISA plates (Costar) were coated with 50 μ L of antigen in 1X PBS overnight [ RSV Ga: 0.5 mu g/mL; RSV Gb: 0.5 mu g/mL; bovine actin: 1 μ g/mL (Sigma); affinity purification of goat anti-human f (ab) 2: 2 μ g/mL (Jackson Immunoresearch)]. Plates were incubated overnight at 4 ℃ and blocked the next day with 135 μ L of 4% nonfat dry milk in PBS (NFDM, burle) and incubated for 2 hours at 37 ℃. The mAb was then adjusted to 0.4% NFDM/PBS/0.05% Tween20, starting at 100ng/mL and titrating down at 5-fold dilution, and continued for 2 hours at 37 ℃ after addition to the plate. CR9514(3D3) mAb was used as a positive control against RSV Ga and Gb and was titrated in a similar manner. Mouse anti-actin (Sigma), cat # a3853) was used as a positive control for bovine actin-coated plates at 1.25 μ g/mL. After incubation, the plates were washed four times with PBS/0.05% Tween 20. The secondary antibodies were each added at 1:1000 in 0.4% NFDM/PBS/0.05% Tween20 and incubated at 37 ℃ for 40 minutes. anti-Fc HRP (Jackson laboratory, Cat. No. 109. 035. 008) was used as the secondary antibody for the mAb. Finally, goat anti-mouse HRP (Jackson laboratory, Cat. No. 115-035-072) was used for actin positive control. After incubation, the plates were washed four times in PBS/0.05% Tween20 and developed with 50 μ L of 1:1v/v TMB: peroxide solution (Pierce, Cat. No. 34021) for about 5 minutes. By adding 50. mu.L of 2N H₂SO₄The reaction was immediately stopped and absorbance at 450nm was measured using an ELISA plate reader. The estimated binding EC50 values (determined by titration of each IgG) for mabs according to the invention ranged between 1.0 and 2.0 ng/ml. Figure 1 shows the binding characteristics of antibodies CB017.5L and CB030.1 against RSV Ga and Gb, respectively.

Example 7

IgG neutralization assay

The anti-RSV antibodies were assayed for their ability to bind to and neutralize RSV in solution as assessed by a plaque reduction assay. In this experiment, the virus and antibody were preincubated in the absence of target cells. The mixture is then added to the cells and viral infection is measured by one of the standard plaque reduction assays described herein. The anti-RSV antibodies were assayed for their ability to neutralize several RSV strains, including RSV A/A2(ATCC accession number VR-1540), RSV B/18537(ATCC accession number VR-1580), and RSV A/Long (ATCC accession number VR-26). Antibodies CR9514(3D3) and CR9505 (an antibody based on 131-2G, i.e.comprising the variable regions of the heavy and light chains of 131-2G, as disclosed in WO 2009/055711) are used as references.

Vero cells (ATCC, Cat. No.: CCL-81; Manassas, Va.) were used for host cell infection. Vero cells were grown in DMEM (sea clone, catalog No. SH 30285.01) with 10% Fetal Bovine Serum (FBS) (sea clone (HyClone), catalog No. SH30070.03), supplemented with 1% L-glutamine (sea clone, catalog No. SH30034.01) and 1% penicillin-streptomycin solution (sea clone, catalog No. SV 30010). Vero cells were maintained in a 37 ℃ incubator with 5% CO2 and passaged twice weekly.

Vero cells were cultured in 24-well cell culture plates on experimental day 1. (ii) cells are allowed to form a cell monolayer by day 2>80% confluence) of the density (about 9X 10⁴Individual cells/well) coating. On day 2, each antibody was serially diluted in normal eagle's minimal essential medium (EMEM, ATCC, catalog number: 30-2003) containing 10% young rabbit complement (AbD Serotec, catalog number C12 CAX). The final antibody concentrations tested were: 10. mu.g/mL, 1.3. mu.g/mL, 156ng/mL, 19.5ng/mL, 2.4ng/mL, and 0.3ng/mL (except CB010.7, which uses antibody concentrations: 2.5. mu.g/mL, 312.5ng/mL, 39.1ng/mL, 4.9ng/mL, 0.61ng/mL, and 0.08 ng/mL). The virus was also diluted in ordinary EMEM to a concentration of 2000-3000pfu/mL (100-150 pfu/50. mu.L), and 85. mu.L of diluted RSV was added to 85. mu.L of each diluted antibody solution and mixed by pipetting. For the virus control samples, 85. mu.L of diluted virus was added to 85. mu.L of normal EMEM. Antibody-virus or virus control mixtures were incubated at 37 ℃ for 2 hours. After incubation, the medium was decanted from a 24-well cell culture plate containing Vero host cells, and then 150 μ Ι _ of pre-incubated virus-antibody or virus-control mixture was transferred to each well. Each test and control sample was prepared in triplicate. The cells were then incubated at 37 ℃ for one hour with mixing every 15 minutes.

After the incubation period, 1mL of overlay medium was added to each well (overlay medium containing EMEM, 2% FBS, 1% L-glutamine, 0.75% methyl cellulose). 24-well cell culture plates were then incubated at 37 deg.C (in 5% CO)₂Bottom) was incubated for about 96-120 hours. Cell plates were fixed with 10% formalin for 1 hour at room temperatureBy ddH₂O washes 10 times and blocked with 5% skim milk powder (NFDM) in PBS for one hour at 37 ℃. After incubation, the blocking solution was decanted and 200 μ LHRP-bound mouse anti-RSV antibody (ab20686, abbam (Abcam), 1:750 dilution in 1% NFDM) was added to each well. Plates were incubated at 37 ℃ for 2 hours and with ddH₂O wash 10 times. After washing, 200. mu.L of water was added

Peroxidase substrate (KPL Cat No. 50-78-02) was added to each well. The plate was developed for 10 minutes at room temperature. Using ddH for plates₂O washed twice and dried on one paper towel and the number of blue plaques was counted. IC50 (effective dilution for 50% neutralization of plaque formation) was calculated using SPSS for Windows. The plaque reduction rate was calculated according to the following formula: plaque reduction rate (percentile) ═ 1- [ (average number of plaques at each antibody dilution)/(average number of plaques in virus control wells)]*100. Table 13 lists the IC50(ng/mL) of each antibody against RSV strain A/A2(ATCC accession number VR-1540) and RSV B/18537(ATCC accession number VR-1580). IC50 values shown in table 13 for virus neutralization analysis were determined using SPSS. Figure 2 shows virus neutralization profiles of antibodies CB017.5L and CB030.1 tested against RSV a2 and B-18537, respectively. Antibodies and antigen-binding fragments had an IC50 (effective dilution for 50% neutralization of plaque formation) of less than 40ng/ml against RSV strain A/A2(ATCC accession No. VR-1540) and/or an IC50 of less than 30ng/ml against RSV strain B/18537(ATCC accession No. VR-1589).

In addition, the IC50 of antibodies CB017.5, CB030.1 and control antibodies CR9505(131-2G) and CR9514(3D3) against RSV strain A/length (ATCC accession number VR-26) were 3.5, 37, 18 and 17ng/mL, respectively.

Example 8

Construction of fully human immunoglobulin molecules (human monoclonal antibodies), including codon optimization and risk-free assays

Each of the antibody clones isolated in example 5 above was examined for the presence of free cysteines and possible post-translational modification sites (including glycosylation, deamidation, and oxidation sites) in the heavy and light chain variable regions (VH and VL). To remove these sites, amino acid mutations consisting of structurally conservative and/or germline-based substitutions were used (table 14). A non-conserved cysteine mutation in the variable region to serine. For glycosylation sites, several mutations can be used, including the substitution of asparagine for conservative glutamine or germline mutations. Modifications to the deamidation site include the substitution of asparagine with aspartic acid and the substitution of glycine with serine or alanine. No modification was made to the possible oxidation sites. The nucleotide and amino acid sequences of each VH and VL obtained from the antibody clones were then codon optimized for expression in human cells in gene technology/invitrogen. The variable regions of these functional variants were then directly cloned by restriction digestion for expression in the IgG expression vectors pCP 9-kappa (see SEQ ID:143) and pCP 9-gamma (see SEQ ID: 144). BamHI, XhoI and/or SrfI were used to clone the variable heavy chain, and NotI and AscI were used to clone the variable light chain. The nucleotide sequences for all constructs were verified according to standard techniques known to the skilled artisan.

Example 9

Peptide binding studies by ELISA and Octet

Detailed epitope mapping was performed on some of the RSV G protein-specific mabs described above (i.e., CB017.5 and CB 030.1). Peptides were synthesized by Fmoc chemistry and purified by reverse phase High Performance Liquid Chromatography (HPLC). In peptide-peptide interaction studies, some peptides were N-terminally biotinylated via an aminocaproic acid (Ahx) spacer. Peptide identity was analyzed by electrospray mass spectrometry. Passing the sample through the ultra-high performance liquidBody chromatography (UPLC, Alliance, Waters, Milford (Milford), MA (MA), USA) uses a C18 reverse phase column and is detected by a photodiode matrix detector and a mass sensitive detector. Using solvent A (H)₂O + 0.05% trifluoroacetic acid [ TFA ]]) And 25% to 100% Acetonitrile (ACN) in solvent B (ACN + 0.05% TFA), gradient 25%/min. All reagents were at least HPLC grade.

Test mAb binding to biotinylated peptides containing RSV-G A and a central conserved region of type B (table 15). Avidin-coated 96-well microtiter plates were washed and incubated with 100. mu.L of biotinylated peptide (2.37X 10) at room temperature^-7M) were incubated together in ELISA buffer (PBS + 1% FBS + 0.05% Tween20) for 1 hour. Next, after washing, 180 μ Ι _ of blocking buffer (PBS + 10% FBS)/well was transferred to the well and incubated for 1 hour at room temperature. Next, the plates were washed and incubated with anti-human HRP (jackson immunoresearch) for 1 hour at room temperature. After washing, 100 μ L of o-phenylenediamine horseradish peroxidase substrate (Thermo Scientific) was added to each well. The reaction was stopped after 10 minutes with 100 μ L of 1MH2SO 4. The absorbance was read at 490 nm.

All of the mabs described above bound to RSV Ga and Gb proteins (example 6) and to central region type a and type B peptides (data not shown). Titrating antibodies CB017.5 and CB030.1 showed that these mabs had an IC50 of about 20ng/mL for all four peptides (fig. 3). Only mAb CB017.5 had a lower maximum signal for the truncated peptides (Sym-1706 and Sym-1789), indicating that a portion of the epitope of mAb CB017.5 is in the region C-terminal of the cystine noose.

The binding of mabs to RSV G peptide was also determined on Octet Red384 (ford organisms) using the streptavidin sensor end. Again, these mabs showed cross-reactivity with type a and type B peptides (table 16). CB030.1 showed slightly higher binding to type B compared to type a peptides. In contrast, CB017.5 showed a higher response to type a peptides and no response to shorter peptides with C-terminal truncations, consistent with ELISA results.

TABLE 16 binding of RSV G-specific mAbs to RSV-G peptide (Octet) [ RU ]

RU: answering unit

Example 10

Minimum epitope mapping (PepScan)

To locate the minimal epitope recognized by the mAb, peptides with lengths (5, 8, 10, 14, 18, 25 or 32 mers) that correspond to the central region of RSV-G A and type B (residue 145-201) were tested using the PepScan assay. Binding of the antibody to the peptide was assessed in a PepScan-based ELISA. Each mAb was titrated to ensure optimal binding was achieved and to avoid non-specific binding. Each credit card format polypropylene plate contains covalently linked peptides incubated overnight at 4 ℃ with mAb between 1 and 10ng/mL in PBS containing 5% horse serum (v/v), 5% OVA (w/v), and 1% (v/v) Tween 80 or an alternative PBS blocking buffer containing 4% horse serum (v/v) and 1% (v/v) Tween 80. After washing, the plates were incubated with an HRP-linked rabbit anti-mAb (DakoCytomation) for 1 hour at 25 ℃. After further washing, peroxidase activity was assessed using ABTS substrate and quantitative color development was performed using a charge coupled device camera and an image processing system.

This analysis showed the smallest peptide that bound the antibody, corresponded to the high energy core of the epitope, and the peptide with the highest binding, containing additional adjacent residues that also promoted binding, and containing the complete epitope. The reactivity of the antibodies with the peptides is summarized in table 17 (residues depicted in upper case).

Example 11

Alanine scanning (PepScan)

A set of peptides was tested in which each position was substituted with an alanine residue (figure 5). The side chains critical for binding the four mabs are summarized in table 17 (indicated in bold black).

Example 12

Binding to native variant peptides (PepScan)

Next, antibodies were tested against a panel of 31 peptides covering the RSV-G central domain that appeared in GenBank on 1/2012. As shown in fig. 6, almost all naturally occurring variant peptides of types a and B were identified. CB030.1 showed lower binding to type a than to type B peptide. CB017.5 binds equally well to type a and type B peptides. CB017.5 binding is sensitive to mutations at positions 190 and 192 in type a variants and to Pro90Leu mutations in type B variants. The mutation of Ser170Cys is critical. The Gln175Arg mutation is critical for CB030.1 binding, and the double mutation Ile181 Phe; ile184Ala is also critical for CB030.1 binding. Naturally occurring variants critical for binding of the four antibodies are summarized in table 17 (indicated by underlining).

Note that: capitalization-the smallest epitope (the shortest reactive peptide), italicized capitalization-the additional residue that promotes binding, bold white-the key residue identified using a complete substitution assay, bold black-the (additional) key residue identified using an alanine scan,underliningThe (additional) key residues that can be identified with the central region variant peptides are used.

Example 13

Preventive efficacy of anti-G mAbs

To determine whether the anti-G mAb showed in vivo prophylactic efficacy, mabcb017.5l and CB030.1 were tested in the RSV-a/long cotton rat model. Males inbred 24 hours before challenge, seronegative for paramyxovirus, 6-8 weeks old, and 60-80g body weight on day-1Cotton rats injected with 5mg/kg of CB017.5L, CB030.1, Gossypium hirsutum in the upper part of hind legs (quadriceps femoris muscle),

Or a vehicle (n-5/group). On day 0, cotton rats were treated with 10 doses of the drug^5.4pfu RSV-A/length was elicited by intranasal instillation of 100 μ L (50 μ L per nostril). After 96 hours, animals were sacrificed to collect lungs and turbinates: tongue lobes were used to isolate total RNA for total viral RNA load determination by qPCR, and the remaining lungs and turbinates were used for infectious viral load determination by pfu test. Blood samples were collected on day 0 before challenge (24 hours after mAb administration) and at study termination (96 hours after challenge) to confirm adequate dosing. G mAb reduced lung and turbinate infection virus titers and lung RNA virus load compared to vehicle (figure 7). Pulmonary infection Virus Titers (log)₁₀PFU/g) was reduced by 1.694 and 1.820log by antibodies CB017.5 and CB030.1, respectively₁₀Whereas prophylactic treatment with CR9514(3D3) produced only 0.801log₁₀And decreases.

Example 14

Therapeutic efficacy of anti-G mAbs

To determine whether the anti-G mAb showed therapeutic efficacy in vivo, mabcb017.5l and CB030.1 were tested in the RSV-a/long cotton rat model. 10 male cotton rats were bred on day 0 by inbreeding, seronegative for paramyxovirus, 6-8 weeks old, and 60-80g body weight on day-1^6.1pfu RSV-A/length was elicited by intranasal instillation of 100 μ L (50 μ L per nostril). 1 day after challenge, 50mg/kg CB017.5L, CB030.1,

(n-14/group) or a vehicle (n-23/group). On

day

4, 5 animals/group were randomly picked and sacrificed to collect lungs and turbinates: tongue lobes were used to isolate total RNA for total viral RNA load determination by qPCR, and the remaining lungs and turbinates were used for infectious viral load determination by pfu test. On day 6, all remaining animals (n ═ 9 or 18/group) were sacrificed to harvest lungs for lung histology. Day 2 post challenge (after mAb administration)24 hours) and at the termination of the study (day 4 or day 6 after challenge) to confirm adequate dosing. G mAb reduced lung and turbinate infectious virus titers compared to vehicle, but did not reduce lung RNA viral load (fig. 8). Pulmonary infection Virus Titers (log)₁₀PFU/g) reduced by 2.356 and 2.477 logs, respectively, by antibodies CB003.1 and CB010.7₁₀Whereas therapeutic treatment with CR9514(3D3) produced only 1.369log₁₀And decreases. In addition, the new G mAb reduced the histopathological scores of bronchiolitis, perivasculitis, interstitial pneumonia and alveolitis (fig. 9), while CR9514(3D3) only reduced interstitial pneumonia.

Sequence of

>CB017.3L VH-SEQ ID NO：73

>CB017.3L VL-SEQ ID NO：74

>CB017.5L VH-SEQ ID NO：75

>CB017.5L VL-SEQ ID NO：76

>CB028.1 VH-SEQ ID NO：77

>CB028.1 VK-SEQ ID NO：78

>CB030.1 VH-SEQ ID NO：79

>CB030.1 VK-SEQ ID NO：80

>CB047.1 VH-SEQ ID NO：81

>CB047.1 VK-SEQ ID NO：82

>CB047.2 VH-SEQ ID NO：83

>CB047.2 VK-SEQ ID NO：84

>CB065.1 VHzSEQ ID NO：85

>CB065.1 VK-SEQ ID NO：86

>CB071.1L VH-SEQ ID NO：87

>CB071.1L VL-SEQ ID NO：88

>CB072.1L VH-SEQ ID NO：89

>CB072.1L VL-SEQ lD NO：90

>CB073.1L VH-SEQ ID NO：91

>CB073.1L VL-SEQ ID NO：92

>CB076.2L VH-SEQ ID NO：93

>CB076.2L VL-SEQ ID NO：94

>CB079.1 VH-SEQ ID NO：95

>CB079.1 VK-SEQ ID NO：96

SEQ ID:176(pCP 9-kappa sequence)

177pCP 9-lambda sequence of SEQ ID

Sequence listing

<110> Yangsen vaccine & prevention Co

<120> human antibody binding to RSV G protein

<130>0213EPP00PRI

<140>EP13179242.6

<141>2013-08-05

<160>180

<170> PatentIn version 3.5

<210>1

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L HCDR1

<400>1

Val Tyr Ala Ile His

1 5

<210>2

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L HCDR2

<400>2

Val Ile Trp His Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210>3

<211>13

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L HCDR3

<400>3

Asp Pro Ile Val Gly Ser Lys Thr Asp Gly Met Asp Val

1 5 10

<210>4

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L LCDR1

<400>4

Ser Gly Asp Ala Leu Ala Asp Gln Tyr Ala Tyr

1 5 10

<210>5

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L LCDR2

<400>5

Lys Asp Asn Glu Arg Pro Ser

1 5

<210>6

<211>9

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L LCDR3

<400>6

Gln Ser Val Asp Ser Ser Gly Thr Tyr

1 5

<210>7

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.5L HCDR1

<400>7

Val Tyr Ala Met His

1 5

<210>8

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.5L HCDR2

<400>8

Ile Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210>9

<211>13

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.5L HCDR3

<400>9

Asp Pro Ile Val Gly His Thr Arg Asp Gly Leu Asp Val

1 5 10

<210>10

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.5L LCDR1

<400>10

Ser Gly Asp Ala Met Ala Glu Gln Tyr Thr Tyr

1 5 10

<210>11

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CD017.5L LCDR2

<400>11

Lys Asp Thr Glu Arg Pro Ser

1 5

<210>12

<211>9

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.5L LCDR3

<400>12

Gln Ser Thr Asp Ser Ser Gly Thr Ser

1 5

<210>13

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 HCDR1

<400>13

Ser Tyr Gly Ile Ser

1 5

<210>14

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 HCDR2

<400>14

Trp Ile Ser Thr His Ile Gly Thr Thr Asn Tyr Ala Gln Lys Leu Gln

1 5 10 15

Gly

<210>15

<211>22

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 HCDR3

<400>15

Asp Leu Ala Lys Trp Tyr Cys Ser Gly Asp Thr Cys Phe Cys Ser Gly

1 5 10 15

Gly Arg Cys Tyr Ser Asp

20

<210>16

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 LCDR1

<400>16

Arg Ala Ser Gln Ser Ile Asn Asp Cys Leu Asn

1 5 10

<210>17

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 LCDR2

<400>17

Ala Ala Ser Asn Leu Gln Ser

1 5

<210>18

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 LCDR3

<400>18

Gln Gln Ser Phe Ser Thr Pro

1 5

<210>19

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 HCDR1

<400>19

Thr Phe Ala Ile Asn

15

<210>20

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 HCDR2

<400>20

Gly Val Ile Pro Gly Phe Asp Ser Ala Asn Tyr Ala Gln Lys Phe Gln

1 5 10 15

Gly

<210>21

<211>13

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 HCDR3

<400>21

Asn Ser Gly Tyr Cys Ser Gly Asp Ser Cys Ala Pro Asn

1 5 10

<210>22

<211>16

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 LCDR1

<400>22

Arg Ser Ser Gln Ser Leu Val His Ser Asn Gly Tyr Ser Tyr Leu Asp

1 5 10 15

<210>23

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 LCDR2

<400>23

Leu Gly Ser Asn Arg Pro Ser

1 5

<210>24

<211>6

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 LCDR3

<400>24

Met Gln Asn Leu Gln Thr

1 5

<210>25

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 HCDR1

<400>25

Asn Tyr Ala Met Ser

1 5

<210>26

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 HCDR2

<400>26

Asp Ile Ser Gly Ser Gly Asn Ser Thr Asn Phe Ala Asp Ser Val Lys

1 5 10 15

Gly

<210>27

<211>21

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 HCDR3

<400>27

Phe Arg Val Pro Thr Tyr Cys Val Asn Gly Ile Cys Tyr Gln Gly Leu

1 5 10 15

Pro Gly Phe Asp Ile

20

<210>28

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 LCDR1

<400>28

Gln Ala Ser Gln Asp Ile Ser Asp Tyr Leu Asn

1 5 10

<210>29

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 LCDR2

<400>29

Asp Ala Ser Asn Leu Glu Thr

1 5

<210>30

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 LCDR3

<400>30

Gln His Tyr His Asn Leu Pro

1 5

<210>31

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2 HCDR1

<400>31

Asn Tyr Ala Met Ser

1 5

<210>32

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2 HCDR2

<400>32

Asp Ile Ser Ser Ser Gly Lys Thr Thr Asn Ser Ala Asp Ser Val Lys

1 5 10 15

Gly

<210>33

<211>21

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2HCDR3

<400>33

Phe Arg Val Pro Thr Tyr Cys Val Asn Gly Ile Cys Tyr Gln Gly Leu

1 5 10 15

Pro Gly Phe Asp Ile

20

<210>34

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2 LCDR1

<400>34

Gln Ala Ser Gln Asp Ile Ser Asp Tyr Leu Asn

1 5 10

<210>35

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2 LCDR2

<400>35

Asp Ala Ser Asn Leu Glu Thr

1 5

<210>36

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2 LCDR3

<400>36

Gln His Tyr His Asn Leu Pro

1 5

<210>37

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 HCDR1

<400>37

Asn Tyr Gly Met His

1 5

<210>38

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 HCDR2

<400>38

Ile Ile Ser Tyr Asp Glu Ser Thr Thr Leu Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210>39

<211>14

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 HCDR3

<400>39

Asp His Phe Asp Pro Ser Gly Tyr Phe Trp Tyr Phe Asp Leu

1 5 10

<210>40

<211>16

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 LCDR1

<400>40

Lys Ser Ser Gln Ser Leu Leu Gln Arg Asp Gly Lys Thr Tyr Leu Tyr

1 5 10 15

<210>41

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 LCDR2

<400>41

Glu Val Ser Ser Arg Phe Ser

1 5

<210>42

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 LCDR3

<400>42

Met Gln Gly Ile Arg Leu Pro

1 5

<210>43

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1L HCDR1

<400>43

Arg Tyr Val Ile Thr

1 5

<210>44

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1L HCDR2

<400>44

Gly Ser Ile Pro Ile Ile Asp Thr Ser Thr Tyr Ala Gln Lys Phe Gln

1 5 10 15

Asp

<210>45

<211>19

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1L HCDR3

<400>45

Val Phe Phe Phe Ser Asn Ser Ser Gly Pro Pro Thr Glu Gly Pro Ala

1 5 10 15

Phe Asp Val

<210>46

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1L LCDR1

<400>46

Ser Gly His Glu Leu Gly Asp Lys Tyr Val Ser

1 5 10

<210>47

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1 LCDR2

<400>47

Gln Asp Thr Asn Arg Pro Ala

1 5

<210>48

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1 LCDR3

<400>48

Gln Ala Trp Asp Asn Ser His

1 5

<210>49

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L HCDR1

<400>49

Ser Asn Ile His Tyr Trp Ala

1 5

<210>50

<211>16

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L HCDR2

<400>50

Tyr Met Phe Tyr Gly Gly Val Ala Phe Tyr Asn Pro Ser Leu Lys Ser

1 5 10 15

<210>51

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L HCDR3

<400>51

Val Leu Val Ala Ser Thr Asn Trp Phe Asp Pro

1 5 10

<210>52

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L LCDR1

<400>52

Gly Gly Asp Asn Ile Gly Thr Lys Gly Val His

1 5 10

<210>53

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L LCDR2

<400>53

Tyr Asn Ser Asp Arg Pro Thr

1 5

<210>54

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L LCDR3

<400>54

His Val Trp Asp Ser Ser Gly Ser Asp His Val

1 5 10

<210>55

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L HCDR1

<400>55

Asn Tyr Ala Val His

1 5

<210>56

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L HCDR2

<400>56

Val Ile Ser His Asp Gly Val Asn Lys Asp Tyr Ala Asp Ser Val Lys

1 5 10 15

Gly

<210>57

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L HCDR3

<400>57

Asp Arg Ser Tyr Tyr Phe Gly Gly Ser Val Phe His Leu Tyr Phe Asp

1 5 10 15

Tyr

<210>58

<211>14

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L LCDR1

<400>58

Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly His Asp Val His

1 5 10

<210>59

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L LCDR2

<400>59

Ala Asn Thr Asn Arg Pro Ser

1 5

<210>60

<211>9

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L LCDR3

<400>60

Gln Ser His Asp Ser Ser Leu Ser Gly

1 5

<210>61

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.2L HCDR1

<400>61

Asn Tyr Val Val Ser

1 5

<210>62

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.2L HCDR2

<400>62

Gly Ile Ile Pro Met Phe Gly Thr Thr Asn Tyr Ala Gln Arg Phe Gln

1 5 10 15

Gly

<210>63

<211>21

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.2L HCDR3

<400>63

Asp Arg Tyr Tyr Glu Val Arg Ala Gly Gly Lys Val Leu Asn Thr Tyr

1 5 10 15

Tyr Tyr Met Asp Val

20

<210>64

<211>11

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.1L LCDR1

<400>64

Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Thr Asn

1 5 10

<210>65

<211>6

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.2L LCDR2

<400>65

Glu Asp Asn Arg Pro Ser

1 5

<210>66

<211>9

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.2L LCDR3

<400>66

Asn Ser Arg Asp Ser Ser Gly Asn Leu

1 5

<210>67

<211>5

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 HCDR1

<400>67

Ser Tyr Ser Phe His

1 5

<210>68

<211>17

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 HCDR2

<400>68

Ser Val Ser Ala Asp Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val Arg

1 5 10 15

Gly

<210>69

<211>12

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 HCDR3

<400>69

Gln Pro Ser Leu Leu Trp Phe Gly Asp Leu Arg Ser

1 5 10

<210>70

<211>16

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 LCDR1

<400>70

Arg Ser Ser Gln Ser Leu Leu His Ser Asn Gly Tyr Asn Tyr Leu Asp

1 5 10 15

<210>71

<211>7

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 LCDR2

<400>71

Leu Ser Ser Asn Arg Ala Ser

1 5

<210>72

<211>6

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 LCDR3

<400>72

Met Gln Ser Leu Gln Thr

1 5

<210>73

<211>122

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L VH

<400>73

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Glu Ala Ser Gly Phe Met Phe Ser Val Tyr

20 25 30

Ala Ile His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Val Ile Trp His Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val

5055 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asp Thr Met Tyr

65 70 75 80

Leu Gln Met Lys Thr Leu Arg Val Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Pro Ile Val Gly Ser Lys Thr Asp Gly Met Asp Val Trp

100 105 110

Gly Gln Gly Thr Thr Val Thr Val Ser Ser

115 120

<210>74

<211>108

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.3L VL

<400>74

Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln

1 5 10 15

Thr Ala Arg Ile Thr Cys Ser Gly Asp Ala Leu Ala Asp Gln Tyr Ala

20 25 30

Tyr Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Met Val Ile Phe

35 40 45

Lys Asp Asn Glu Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser

50 55 60

Ser Ser Gly Thr Thr Val Thr Leu Thr Val Ser Gly Val Gln Ser Glu

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Val Asp Ser Ser Gly Thr Tyr

85 90 95

Trp Met Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105

<210>75

<211>122

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.5L VH

<400>75

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Thr Phe Ser Val Tyr

20 25 30

Ala Met His Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Val

35 40 45

Ala Ile Ile Trp Tyr Asp Gly Ser Asn Lys Tyr Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Glu Thr Leu Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Val Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Pro Ile Val Gly His Thr Arg Asp Gly Leu Asp Val Trp

100 105 110

Gly Gln Gly Thr Thr Val Thr Val Ser Ser

115 120

<210>76

<211>108

<212>PRT

<213> Artificial sequence

<220>

<223>CB017.5L VL

<400>76

Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln

1 5 10 15

Thr Ala Arg Val Thr Cys Ser Gly Asp Ala Met Ala Glu Gln Tyr Thr

20 25 30

Tyr Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Ile Ile Phe

35 40 45

Lys Asp Thr Glu Arg Pro Ser Gly Ile Pro Glu Arg Phe Ser Gly Ser

50 55 60

Ser Ser Gly Thr Thr Val Thr Leu Thr Ile Ser Gly Val Gln Thr Glu

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Gln Ser Thr Asp Ser Ser Gly Thr Ser

85 90 95

Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105

<210>77

<211>132

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 VH

<400>77

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala

1 5 10 15

Ser Val Gln Val Ser Cys Lys Thr Ser Gly Tyr Thr Phe Ser Ser Tyr

20 25 30

Gly Ile Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Pro Glu Trp Met

35 40 45

Gly Trp Ile Ser Thr His Ile Gly Thr Thr Asn Tyr Ala Gln Lys Leu

50 55 60

Gln Gly Arg Val Thr Met Thr Thr Asp Thr Ser Thr Thr Thr Ala Tyr

65 70 75 80

Met Glu Leu Arg Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Leu Ala Lys Trp Tyr Cys Ser Gly Asp Thr Cys Phe Cys

100 105 110

Ser Gly Gly Arg Cys Tyr Ser Asp His Trp Gly Gln Gly Thr Leu Val

115 120 125

Thr Val Ser Ser

130

<210>78

<211>107

<212>PRT

<213> Artificial sequence

<220>

<223>CB028.1 VK

<400>78

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Gln Ser Ile Asn Asp Cys

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Lys Leu Leu Ile

35 40 45

Ser Ala Ala Ser Asn Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Glu Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Ala Tyr Tyr Cys Gln Gln Ser Phe Ser Thr Pro Leu

85 90 95

Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210>79

<211>122

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 VH

<400>79

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Met Lys Arg Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Thr Phe

20 25 30

Ala Ile Asn Trp Val Arg Gln Ala Pro Gly Gln Gly Phe Glu Trp Met

35 40 45

Gly Gly Val Ile Pro Gly Phe Asp Ser Ala Asn Tyr Ala Gln Lys Phe

50 55 60

Gln Gly Arg Leu Thr Met Ser Ala Asp Glu Ser Thr Ser Thr Val Tyr

65 70 75 80

Met Glu Leu Ser Ser Leu Arg Ser Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Gly Asn Ser Gly Tyr Cys Ser Gly Asp Ser Cys Ala Pro Asn Trp

100 105 110

Gly Pro Gly Thr Leu Val ThrVal Ser Ser

115 120

<210>80

<211>111

<212>PRT

<213> Artificial sequence

<220>

<223>CB030.1 VK

<400>80

Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly

1 5 10 15

Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Val His Ser

20 25 30

Asn Gly Tyr Ser Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Gln Leu Leu Ile Tyr Leu Gly Ser Asn Arg Pro Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Phe Cys Met Gln Asn

85 90 95

Leu Gln Thr Pro Thr Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105 110

<210>81

<211>130

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 VH

<400>81

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Ser Phe Ser Asn Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Asp Ile Ser Gly Ser Gly Asn Ser Thr Asn Phe Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Tyr

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ala Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Lys Phe Arg Val Pro Thr Tyr Cys Val Asn Gly Ile Cys Tyr Gln

100 105 110

Gly Leu Pro Gly Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val

115 120 125

Ser Ser

130

<210>82

<211>107

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.1 VK

<400>82

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser Asp Tyr

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Ile Ala Thr Tyr Tyr Cys Gln His Tyr His Asn Leu Pro Pro

85 90 95

Leu Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210>83

<211>130

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2 VH

<400>83

Glu Val Gln Leu Val Glu Ser Gly Gly Gly Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Asn Phe Ser Asn Tyr

20 25 30

Ala Met Ser Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ser Asp Ile Ser Ser Ser Gly Lys Thr Thr Asn Ser Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Phe

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Ala Asp Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Lys Phe Arg Val Pro Thr Tyr Cys Val Asn Gly Ile Cys Tyr Gln

100 105 110

Gly Leu Pro Gly Phe Asp Ile Trp Gly Gln Gly Thr Met Val Thr Val

115 120 125

Ser Ser

130

<210>84

<211>107

<212>PRT

<213> Artificial sequence

<220>

<223>CB047.2 VK

<400>84

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Gln Ala Ser Gln Asp Ile Ser Asp Tyr

20 25 30

Leu Asn Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Asp Ala Ser Asn Leu Glu Thr Gly Val Pro Ser Arg Phe Ser Ala

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Phe Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln His Tyr His Asn Leu Pro Pro

85 90 95

Leu Phe Gly Gly Gly Thr Lys Val Glu Ile Lys

100 105

<210>85

<211>123

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 VH

<400>85

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Ser Asn Tyr

20 25 30

Gly Met His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Thr Ile Ile Ser Tyr Asp Glu Ser Thr Thr Leu Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Phe Thr Ile Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Met Asn Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp His Phe Asp Pro Ser Gly Tyr Phe Trp Tyr Phe Asp Leu

100 105 110

Trp Gly Arg Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>86

<211>112

<212>PRT

<213> Artificial sequence

<220>

<223>CB065.1 VK

<400>86

Asp Ile Val MetThr Gln Ser Pro Leu Ser Leu Ser Val Thr Pro Gly

1 5 10 15

Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu Leu Gln Arg

20 25 30

Asp Gly Lys Thr Tyr Leu Tyr Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Gln Leu Leu Ile Tyr Glu Val Ser Ser Arg Phe Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Val Gly Val Tyr Tyr Cys Met Gln Gly

85 90 95

Ile Arg Leu Pro Arg Thr Phe Gly Gln Gly Thr Lys Val Glu Ile Lys

100 105 110

<210>87

<211>128

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1L VH

<400>87

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Arg Val Ser Cys Lys Ala Ser Gly Gly Thr Phe Ser Arg Tyr

20 25 30

Val Ile Thr Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ser Ile Pro Ile Ile Asp Thr Ser Thr Tyr Ala Gln Lys Phe

50 55 60

Gln Asp Arg Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Val Tyr

65 70 75 80

Leu Glu Leu Ser Ser Leu Arg Pro Glu Asp Thr Ala Ile Tyr Tyr Cys

85 90 95

Ala Lys Val Phe Phe Phe Ser Asn Ser Ser Gly Pro Pro Thr Glu Gly

100 105 110

Pro Ala Phe Asp Val Trp Gly Gln Gly Thr Met Val Thr Val Ser Ser

115 120 125

<210>88

<211>106

<212>PRT

<213> Artificial sequence

<220>

<223>CB071.1L VL

<400>88

Ser Tyr Glu Leu Thr Gln Pro Pro Ser Val Ser Val Ser Pro Gly Gln

1 5 10 15

Thr Ala Ser Ile Thr Cys Ser Gly His Glu Leu Gly Asp Lys Tyr Val

20 25 30

Ser Trp Tyr Gln Gln Lys Pro Gly Gln Ser Pro Val Leu Leu Ile Tyr

35 40 45

Gln Asp Thr Asn Arg Pro Ala Gly Ile Pro Glu Arg Phe Ser Gly Ser

50 55 60

Asn Ser Gly Ser Thr Ala Phe Leu Thr Ile Ser Ala Thr Gln Ala Met

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Gln Ala Trp Asp Asn Ser His Val Val

85 90 95

Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105

<210>89

<211>121

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L VH

<400>89

Gln Leu Gln Leu Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Ser Glu

1 5 10 15

Thr Leu Ser Leu Thr Cys Thr Val Ser Gly Gly Ser Ile Ser Ser Asn

20 25 30

Ile His Tyr Trp Ala Trp Ile Arg Gln Thr Pro Gly Lys Gly Leu Glu

35 40 45

Trp Ile Gly Tyr Met Phe Tyr Gly Gly Val Ala Phe Tyr Asn Pro Ser

50 55 60

Leu Lys Ser Arg Val Ala Ile Ser Val Asp Thr Ser Lys Asn Gln Phe

65 70 75 80

Ser Leu Arg Leu Thr Ser Ala Ser Ala Ala Asp Thr Ala Val Tyr Tyr

85 90 95

Cys Ala Arg Val Leu Val Ala Ser Thr Asn Trp Phe Asp Pro Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>90

<211>110

<212>PRT

<213> Artificial sequence

<220>

<223>CB072.1L VL

<400>90

Ser Tyr Val Leu Thr Gln Pro Pro Ser Val Ser Val Ala Pro Gly Gly

1 5 10 15

Thr Ala Arg Ile Thr Cys Gly Gly Asp Asn Ile Gly Thr Lys Gly Val

20 25 30

His Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Met Tyr

3540 45

Tyr Asn Ser Asp Arg Pro Thr Gly Val Pro Glu Arg Phe Ser Gly Ser

50 55 60

Asn Ser Gly Asn Thr Ala Thr Leu Thr Ile Ser Arg Leu Glu Ala Gly

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys His Val Trp Asp Ser Ser Gly Ser Asp

85 90 95

His Val Glu Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210>91

<211>126

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L VH

<400>91

Gln Val Gln Leu Val Glu Ser Gly Gly Gly Val Val Gln Pro Gly Arg

1 5 10 15

Ser Leu Arg Leu Ser Cys Ala Ala Ser Gly Phe Thr Phe Tyr Asn Tyr

20 25 30

Ala Val His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Val

35 40 45

Ala Val Ile Ser His Asp Gly Val Asn Lys Asp Tyr Ala Asp Ser Val

50 55 60

Lys Gly Arg Ile Thr Leu Ser Arg Asp Asn Ser Lys Asn Thr Val Tyr

65 70 75 80

Leu Gln Leu Asn Ser Leu Arg Pro Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Arg Ser Tyr Tyr Phe Gly Gly Ser Val Phe His Leu Tyr

100 105 110

Phe Asp Tyr Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser

115 120 125

<210>92

<211>111

<212>PRT

<213> Artificial sequence

<220>

<223>CB073.1L VL

<400>92

Gln Ser Val Leu Thr Gln Pro Pro Ser Val Ser Gly Ala Pro Gly Gln

1 5 10 15

Arg Val Ile Ile Ser Cys Thr Gly Ser Ser Ser Asn Ile Gly Ala Gly

20 25 30

His Asp Val His Trp Tyr Gln Gln Leu Pro Gly Thr Ala Pro Arg Leu

35 40 45

Leu Ile Tyr Ala Asn Thr Asn Arg Pro Ser Gly Val Pro Asp Arg Phe

50 5560

Ser Ala Ser Lys Ser Gly Asn Ser Ala Ser Leu Val Ile Thr Gly Leu

65 70 75 80

Gln Ala Glu Asp Glu Ala Asp Tyr Phe Cys Gln Ser His Asp Ser Ser

85 90 95

Leu Ser Gly Val Leu Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105 110

<210>93

<211>130

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.2L VH

<400>93

Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ser

1 5 10 15

Ser Val Lys Val Ser Cys Lys Thr Ser Gly Asp Thr Phe Ser Asn Tyr

20 25 30

Val Val Ser Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met

35 40 45

Gly Gly Ile Ile Pro Met Phe Gly Thr Thr Asn Tyr Ala Gln Arg Phe

50 55 60

Gln Gly Arg Val Thr Ile Ser Ala Asp Glu Ser Thr Ser Thr Ala Tyr

65 70 7580

Met Glu Met Ser Ser Leu Lys Ser Glu Asp Thr Ala Val Tyr Tyr Cys

85 90 95

Ala Arg Asp Arg Tyr Tyr Glu Val Arg Ala Gly Gly Lys Val Leu Asn

100 105 110

Thr Tyr Tyr Tyr Met Asp Val Trp Gly Lys Gly Thr Thr Val Thr Val

115 120 125

Ser Ser

130

<210>94

<211>108

<212>PRT

<213> Artificial sequence

<220>

<223>CB076.2L VL

<400>94

Ser Ser Glu Leu Thr Gln Asp Pro Ala Val Ser Val Ala Leu Gly His

1 5 10 15

Thr Val Arg Ile Thr Cys Gln Gly Asp Ser Leu Arg Ser Tyr Tyr Thr

20 25 30

Asn Trp Tyr Gln Gln Lys Pro Gly Gln Ala Pro Val Leu Val Ile Phe

35 40 45

Gly Glu Asp Asn Arg Pro Ser Gly Ile Pro Asp Arg Phe Ser Gly Ser

50 55 60

Ser Ser Gly Asp Thr Ala Ser Leu Thr Ile Thr Gly Thr Gln Ala Glu

65 70 75 80

Asp Glu Ala Asp Tyr Tyr Cys Asn Ser Arg Asp Ser Ser Gly Asn Leu

85 90 95

Trp Val Phe Gly Gly Gly Thr Lys Leu Thr Val Leu

100 105

<210>95

<211>121

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 VH

<400>95

Glu Val Gln Leu Val Glu Ser Gly Gly Asp Leu Val Gln Pro Gly Gly

1 5 10 15

Ser Leu Arg Leu Ser Cys Ser Ala Ser Gly Phe Val Phe Thr Ser Tyr

20 25 30

Ser Phe His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Tyr Val

35 40 45

Ser Ser Val Ser Ala Asp Gly Gly Ser Thr Tyr Tyr Ala Asp Ser Val

50 55 60

Arg Gly Arg Phe Leu Ile Ser Arg Asp Asn Ser Lys Asn Thr Leu Ser

65 70 75 80

Leu Gln Met Ser Ser Leu Arg Pro Asp Asp Thr Ala Leu Tyr Tyr Cys

85 90 95

Val Pro Gln Pro Ser Leu Leu Trp Phe Gly Asp Leu Arg Ser Trp Gly

100 105 110

Gln Gly Thr Leu Val Thr Val Ser Ser

115 120

<210>96

<211>111

<212>PRT

<213> Artificial sequence

<220>

<223>CB079.1 VK

<400>96

Asp Ile Val Met Thr Gln Ser Pro Leu Ser Leu Pro Val Thr Pro Gly

1 5 10 15

Glu Pro Ala Ser Ile Ser Cys Arg Ser Ser Gln Ser Leu Leu His Ser

20 25 30

Asn Gly Tyr Asn Tyr Leu Asp Trp Tyr Leu Gln Lys Pro Gly Gln Ser

35 40 45

Pro Gln Leu Leu Ile Tyr Leu Ser Ser Asn Arg Ala Ser Gly Val Pro

50 55 60

Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr Leu Lys Ile

65 70 75 80

Ser Arg Val Glu Ala Glu Asp Ile Gly Ile Tyr Tyr Cys Met Gln Ser

85 9095

Leu Gln Thr Leu Thr Phe Gly Gln Gly Thr Arg Leu Glu Ile Lys

100 105 110

<210>97

<211>259

<212>PRT

<213> Artificial sequence

<220>

<223> RSV G A/length

<400>97

Ala Asn His Lys Val Thr Leu Thr Thr Ala Ile Ile Gln Asp Ala Thr

1 5 10 15

Ser Gln Ile Lys Asn Thr Thr Pro Thr Tyr Leu Thr Gln Asp Pro Gln

20 25 30

Leu Gly Ile Ser Phe Ser Asn Leu Ser Glu Ile Thr Ser Gln Thr Thr

35 40 45

Thr Ile Leu Ala Ser Thr Thr Pro Gly Val Lys Ser Asn Leu Gln Pro

50 55 60

Thr Thr Val Lys Thr Lys Asn Thr Thr Thr Thr Gln Thr Gln Pro Ser

65 70 75 80

Lys Pro Thr Thr Lys Gln Arg Gln Asn Lys Pro Pro Asn Lys Pro Asn

85 90 95

Asn Asp Phe His Phe Glu Val Phe Asn Phe Val Pro Cys Ser Ile Cys

100 105110

Ser Asn Asn Pro Thr Cys Trp Ala Ile Cys Lys Arg Ile Pro Asn Lys

115 120 125

Lys Pro Gly Lys Lys Thr Thr Thr Lys Pro Thr Lys Lys Pro Thr Phe

130 135 140

Lys Thr Thr Lys Lys Asp Leu Lys Pro Gln Thr Thr Lys Pro Lys Glu

145 150 155 160

Val Pro Thr Thr Lys Pro Thr Glu Glu Pro Thr Ile Asn Thr Thr Lys

165 170 175

Thr Asn Ile Thr Thr Thr Leu Leu Thr Asn Asn Thr Thr Gly Asn Pro

180 185 190

Lys Leu Thr Ser Gln Met Glu Thr Phe His Ser Thr Ser Ser Glu Gly

195 200 205

Asn Leu Ser Pro Ser Gln Val Ser Thr Thr Ser Glu His Pro Ser Gln

210 215 220

Pro Ser Ser Pro Pro Asn Thr Thr Arg Gln Gln Ala Tyr Val Glu Gln

225 230 235 240

Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser Ala Val Asp His His His

245 250 255

His His His

<210>98

<211>260

<212>PRT

<213> Artificial sequence

<220>

<223>RSV G B/B1

<400>98

Ala Asn His Lys Val Thr Leu Thr Thr Val Thr Val Gln Thr Ile Lys

1 5 10 15

Asn His Thr Glu Lys Asn Ile Thr Thr Tyr Leu Thr Gln Val Pro Pro

20 25 30

Glu Arg Val Ser Ser Ser Lys Gln Pro Thr Thr Thr Ser Pro Ile His

35 40 45

Thr Asn Ser Ala Thr Thr Ser Pro Asn Thr Lys Ser Glu Thr His His

50 55 60

Thr Thr Ala Gln Thr Lys Gly Arg Thr Thr Thr Ser Thr Gln Thr Asn

65 70 75 80

Lys Pro Ser Thr Lys Pro Arg Leu Lys Asn Pro Pro Lys Lys Pro Lys

85 90 95

Asp Asp Tyr His Phe Glu Val Phe Asn Phe Val Pro Cys Ser Ile Cys

100 105 110

Gly Asn Asn Gln Leu Cys Lys Ser Ile Cys Lys Thr Ile Pro Ser Asn

115 120 125

Lys Pro Lys Lys Lys Pro Thr Ile Lys Pro Thr Asn Lys Pro Thr Thr

130 135 140

Lys Thr Thr Asn Lys Arg Asp Pro Lys Thr Pro Ala Lys Thr Thr Lys

145 150 155 160

Lys Glu Thr Thr Thr Asn Pro Thr Lys Lys Pro Thr Leu Thr Thr Thr

165 170 175

Glu Arg Asp Thr Ser Thr Ser Gln Ser Thr Val Leu Asp Thr Thr Thr

180 185 190

Leu Glu His Thr Ile Gln Gln Gln Ser Leu His Ser Thr Thr Pro Glu

195 200 205

Asn Thr Pro Asn Ser Thr Gln Thr Pro Thr Ala Ser Glu Pro Ser Thr

210 215 220

Ser Asn Ser Thr Gln Asn Thr Gln Ser His Ala Gln Ala Tyr Val Glu

225 230 235 240

Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Ser Ala Val Asp His His

245 250 255

His His His His

260

<210>99

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH1a

<400>99

atggactgga cctggaggtt cctc 24

<210>100

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH1b

<400>100

atggactgga cctggaggat cctc 24

<210>101

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH1c

<400>101

atggactgga cctggagggt cttc 24

<210>102

<211>22

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH1d

<400>102

atggactgga cctggagcat cc 22

<210>103

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH2

<400>103

ggacatactt tgttccacgc tcctgc 26

<210>104

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH3a

<400>104

aggtgtccag tgtcaggtgc agc 23

<210>105

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH3b

<400>105

aggtgtccag tgtgaggtgc agc 23

<210>106

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH3c

<400>106

aggtgtccag tgtcaggtac agc 23

<210>107

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH4

<400>107

gcagctccca gatgggtcct g 21

<210>108

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH5

<400>108

tcaaccgcca tcctcgccct c 21

<210>109

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVH6

<400>109

gtctgtctcc ttcctcatct tcctgc 26

<210>110

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223>3?CgCH1

<400>110

ggaaggtgtg cacgccgctg gtc 23

<210>111

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk1a

<400>111

atgagggtcc ccgctcagct c 21

<210>112

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk1b

<400>112

atgagggtcc ctgctcagct c 21

<210>113

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk1c

<400>113

atgagagtcc tcgctcagct c 21

<210>114

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk2

<400>114

tggggctgct aatgctctgg 20

<210>115

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk3

<400>115

cctcctgcta ctctggctcc cag 23

<210>116

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk4

<400>116

tctctgttgc tctggatctc tggtgc 26

<210>117

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk5

<400>117

ctcctcagct tcctcctcct ttgg 24

<210>118

<211>26

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5?LVk6

<400>118

aactcattgg gtttctgctg ctctgg 26

<210>119

<211>23

<212>DNA

<213> Artificial sequence

<220>

<223>3'Ck-Rev494

<400>119

gtgctgtcct tgctgtcctg ctc 23

<210>120

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5? LVlam1

<400>120

ctcctcgctc actgcacagg 20

<210>121

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5? LVlam2

<400>121

ctcctctctc actgcacagg 20

<210>122

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5? LVlam3

<400>122

ctcctcactc gggacacagg 20

<210>123

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5? LVlam4

<400>123

atggcctgga cccctctctg 20

<210>124

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>CB-5? LVlam5

<400>124

atggcatgga tccctctctt cctc 24

<210>125

<211>24

<212>DNA

<213> Artificial sequence

<220>

<223>3?Clam-Rev

<400>125

caagccaaca aggccacact agtg 24

<210>126

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH1a

<400>126

gctcgcagca tagccggcca tggcccaggt gcagctggtg cagtc 45

<210>127

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH1b

<400>127

gctcgcagca tagccggcca tggcccaggt ccagctggtg cagtc 45

<210>128

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH1c

<400>128

gctcgcagca tagccggcca tggcccaggt tcagctggtg cagtc 45

<210>129

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH1d

<400>129

gctcgcagca tagccggcca tggcccaggt ccagcttgtg cagtc 45

<210>130

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH2a

<400>130

gctcgcagca tagccggcca tggcccaggt caccttgagg gagtctgg 48

<210>131

<211>48

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH2b

<400>131

gctcgcagca tagccggcca tggcccaggt caccttgaag gagtctgg 48

<210>132

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH3a

<400>132

gctcgcagca tagccggcca tggcccaggt gcagctggtg gagtc 45

<210>133

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH3b

<400>133

gctcgcagca tagccggcca tggccgaggt gcagctgttg gagtc 45

<210>134

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH3c

<400>134

gctcgcagca tagccggcca tggccgaggt gcagctggtg gagtc 45

<210>135

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH3d

<400>135

gctcgcagca tagccggcca tggcccaggt acagctggtg gagtctg 47

<210>136

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH4a

<400>136

gctcgcagca tagccggcca tggcccagst gcagctgcag gag 43

<210>137

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH4b

<400>137

gctcgcagca tagccggcca tggcccaggt gcagctacag cagtgg 46

<210>138

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH5

<400>138

gctcgcagca tagccggcca tggccgaggt gcagctggtg cagtc 45

<210>139

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH6

<400>139

gctcgcagca tagccggcca tggcccaggt acagctgcag cagtcag 47

<210>140

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VH7

<400>140

gctcgcagca tagccggcca tggcccaggt gcagctggtg caatctg 47

<210>141

<211>32

<212>DNA

<213> Artificial sequence

<220>

<223>3?SalIJH 1/2/4/5

<400>141

tgcgaagtcg acgctgagga gacggtgacc ag 32

<210>142

<211>34

<212>DNA

<213> Artificial sequence

<220>

<223>3?SalIJH3

<400>142

tgcgaagtcg acgctgaaga gacggtgacc attg 34

<210>143

<211>33

<212>DNA

<213> Artificial sequence

<220>

<223>3?SalIJH6

<400>143

tgcgaagtcg acgctgagga gacggtgacc gtg 33

<210>144

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VK1a

<400>144

ctaccgtggc ctaggcggcc gacatccaga tgacccagtc tcc 43

<210>145

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VK1b

<400>145

ctaccgtggc ctaggcggcc gacatccagt tgacccagtc tcc 43

<210>146

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VK1c

<400>146

ctaccgtggc ctaggcggcc gccatccagt tgacccagtc tcc 43

<210>147

<211>47

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VK2a

<400>147

ctaccgtggc ctaggcggcc gatrttgtga tgactcagtc tccactc 47

<210>148

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VK3a

<400>148

ctaccgtggc ctaggcggcc gaaattgtgt tgacgcagtc tccag 45

<210>149

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VK3b

<400>149

ctaccgtggc ctaggcggcc gaaattgtgt tgacacagtc tccag 45

<210>150

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VK3c

<400>150

ctaccgtggc ctaggcggcc gaaatagtga tgacgcagtc tccag 45

<210>151

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>CB-Vk4

<400>151

ctaccgtggc ctaggcggcc gacatcgtga tgacccagtc tcc 43

<210>152

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>CB-Vk5

<400>152

ctaccgtggc ctaggcggcc gaaacgacac tcacgcagtc tcc 43

<210>153

<211>45

<212>DNA

<213> Artificial sequence

<220>

<223>CB-Vk6

<400>153

ctaccgtggc ctaggcggcc gaaattgtgc tgactcagtc tccag 45

<210>154

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>3'Jk1/4 Rev IIa-L

<400>154

gaagacagat ggtgcagcca cagttcgttt gatytccacc ttggtc 46

<210>155

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>3'Jk2 Rev IIb-L

<400>155

gaagacagat ggtgcagcca cagttcgttt gatctccagc ttggtc 46

<210>156

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>3'Jk3 Rev IIc-L

<400>156

gaagacagat ggtgcagcca cagttcgttt gatatccact ttggtc 46

<210>157

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>3'Jk5 Rev IId-L

<400>157

gaagacagat ggtgcagcca cagttcgttt aatctccagt cgtgtc 46

<210>158

<211>46

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VL1

<400>158

ctaccgtggc ctaggcggcc aattttatgc tgactcagcc ccactc 46

<210>159

<211>40

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VL2

<400>159

ctaccgtggc ctaggcggcc tcctatgtgc tgactcagcc 40

<210>160

<211>40

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VL3

<400>160

ctaccgtggc ctaggcggcc cagtctgtgc tgacgcagcc 40

<210>161

<211>40

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VL4

<400>161

ctaccgtggc ctaggcggcc cagtctgtcg tgacgcagcc 40

<210>162

<211>40

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VL5

<400>162

ctaccgtggc ctaggcggcc cagtctgccc tgactcagcc 40

<210>163

<211>42

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VL6

<400>163

ctaccgtggc ctaggcggcc tcttctgagc tgactcagga cc 42

<210>164

<211>43

<212>DNA

<213> Artificial sequence

<220>

<223>CB-VL7

<400>164

ctaccgtggc ctaggcggcc tcctatgagc tgactcagcc acc 43

<210>165

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223>3' Clam-step II

<400>165

ctcagaggag ggygggaaca gagtgac 27

<210>166

<211>414

<212>DNA

<213> Artificial sequence

<220>

<223>IGKC

<400>166

cgaactgtgg ctgcaccatc tgtcttcatc ttcccgccat ctgatgagca gcttaaatct 60

ggaactgcct ctgttgtgtg ccttctaaat aacttctatc cccgtgaggc caaagtacag 120

tggaaggtgg ataacgccct ccaatcgggt aactcccagg agagtgtcac agagcaggac 180

agcaaggaca gcacctacag cctcagcagc acccttacgc ttagcaaagc agactacgag 240

aaacacaaag tctacgcctg cgaagtcacc catcagggcc tcagctcgcc cgtcacaaag 300

agcttcaacc gcggagagtg ttaatctaga aataaggagg atataattat gaaatacctg 360

ctgccgaccg cagccgctgg tctgctgctg ctcgcagcat agccggccat ggcc 414

<210>167

<211>387

<212>DNA

<213> Artificial sequence

<220>

<223>IGLC2

<400>167

gtcactctgt tcccgccctc ctctgaggag cttcaagcca acaaggccac actggtgtgt 60

ctcataagtg acttctaccc gggagccgtg acagtggcct ggaaggcaga tagcagcccc 120

gtcaaggcgg gagtggagac caccacaccc tccaaacaaa gcaacaacaa gtacgcggcc 180

agcagctacc tgagcctgac gcctgagcag tggaagtccc acagaagcta cagctgccag 240

gtcacgcatg aagggagcac cgtggagaag acagtggccc ctacagaatg ttcataatct 300

agaaataagg aggatataat tatgaaatac ctgctgccga ccgcagccgc tggtctgctg 360

ctgctcgcag catagccggc catggcc 387

<210>168

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> Fab linker-F

<400>168

cgaactgtgg ctgcaccatc tgtcttc 27

<210>169

<211>25

<212>DNA

<213> Artificial sequence

<220>

<223> Fab linker-R

<400>169

ggccatggcc ggctatgctg cgagc 25

<210>170

<211>27

<212>DNA

<213> Artificial sequence

<220>

<223> lambda-Fab linker F

<400>170

gtcactctgttcccrccctc ctctgag 27

<210>171

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223> overlap-F

<400>171

ctaccgtggc ctaggcggcc 20

<210>172

<211>21

<212>DNA

<213> Artificial sequence

<220>

<223> overlap-R

<400>172

tgcgaagtcg acgctgarga g 21

<210>173

<211>40

<212>PRT

<213> Artificial sequence

<220>

<223>SYM-1706

<400>173

Lys Gln Arg Gln Asn Lys Pro Pro Asn Lys Pro Asn Asn Asp Phe His

1 5 10 15

Phe Glu Val Phe Asn Phe Val Pro Cys Ser Ile Cys Ser Asn Asn Pro

20 25 30

Thr Cys Trp Ala Ile Cys Lys Arg

35 40

<210>174

<211>20

<212>DNA

<213> Artificial sequence

<220>

<223>SeqpCBFab-HCF

<400>174

tgaaatacct gctgccgacc 20

<210>175

<211>18

<212>DNA

<213> Artificial sequence

<220>

<223>Seq-PelB-Rev

<400>175

cagcagacca gcggctgc 18

<210>176

<211>8970

<212>DNA

<213> Artificial sequence

<220>

<223> pCP 9-kappa sequence

<400>176

tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 60

acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 120

aagtgccacc tgacgtcgac ggatcgggag atctcccgat cccctatggt gcactctcag 180

tacaatctgc tctgatgccg catagttaag ccagtatctg ctccctgctt gtgtgttgga 240

ggtcgctgag tagtgcgcga gcaaaattta agctacaaca aggcaaggct tgaccgacaa 300

ttgcatgaag aatctgctta gggttaggcg ttttgcgctg cttcgctagg tggtcaatat 360

tggccattag ccatattatt cattggttat atagcataaa tcaatattgg ctattggcca 420

ttgcatacgt tgtatccata tcataatatg tacatttata ttggctcatg tccaacatta 480

ccgccatgtt gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta 540

gttcatagcc catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc 600

tgaccgccca acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg 660

ccaataggga ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg 720

gcagtacatc aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa 780

tggcccgcct ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac 840

atctacgtat tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg 900

cgtggatagc ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg 960

agtttgtttt ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca 1020

ttgacgcaaa tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta 1080

gtgaaccgtc agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagaagacac 1140

cgggaccgat ccagcctccg cggccgggaa cggtgcattg gaagcttggt accgagctcg 1200

gatccttaat taactcgagg cccgagcccg ggcgagccca gacactggac gctgaacctc 1260

gcggacagtt aagaacccag gggcctctgc gccctgggcc cagctctgtc ccacaccgcg 1320

gtcacatggc accacctctc ttgcagcctc caccaagggc ccatcggtct tccccctggc 1380

accctcctcc aagagcacct ctgggggcac agcggccctg ggctgcctgg tcaaggacta 1440

cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgcc ctgaccagcg gcgtgcacac 1500

cttcccggct gtcctacagt cctcaggact ctactccctc agcagcgtgg tgaccgtgcc 1560

ctccagcagc ttgggcaccc agacctacat ctgcaacgtg aatcacaagc ccagcaacac 1620

caaggtggac aagagagttg gtgagaggcc agcacaggga gggagggtgt ctgctggaag 1680

ccaggctcag cgctcctgcc tggacgcatc ccggctatgc agtcccagtc cagggcagca 1740

aggcaggccc cgtctgcctc ttcacccgga ggcctctgcc cgccccactc atgctcaggg 1800

agagggtctt ctggcttttt ccccaggctc tgggcaggca cgggctaggt gcccctaacc 1860

caggccctgc acacaaaggg gcaggtgctg ggctcagacc tgccaagagc catatccggg 1920

aggaccctgc ccctgaccta agcccacccc aaaggccaaa ctctccactc cctcagctcg 1980

gacaccttct ctcctcccag attccagtaa ctcccaatct tctctctgca gagcccaaat 2040

cttgtgacaa aactcacaca tgcccaccgt gcccaggtaa gccagcccag gcctcgccct 2100

ccagctcaag gcgggacagg tgccctagag tagcctgcat ccagggacag gccccagccg 2160

ggtgctgaca cgtccacctc catctcttcc tcagcacctg aactcctggg gggaccgtca 2220

gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 2280

acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 2340

gacggcgtgg aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg 2400

taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 2460

aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 2520

aaaggtggga cccgtggggt gcgagggcca catggacaga ggccggctcg gcccaccctc 2580

tgccctgaga gtgaccgctg taccaacctc tgtccctaca gggcagcccc gagaaccaca 2640

ggtgtacacc ctgcccccat cccgggagga gatgaccaag aaccaggtca gcctgacctg 2700

cctggtcaaa ggcttctatc ccagcgacat cgccgtggag tgggagagca atgggcagcc 2760

ggagaacaac tacaagacca cgcctcccgt gctggactcc gacggctcct tcttcctcta 2820

tagcaagctc accgtggaca agagcaggtg gcagcagggg aacgtcttct catgctccgt 2880

gatgcatgag gctctgcaca accactacac gcagaagagc ctctccctgt ctccgggtaa 2940

atgagctagc gaattcaccg gtaccaagct taagtttaaa ccgctgatca gcctcgactg 3000

tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg 3060

aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga 3120

gtaggtgtca ttctattctg gggggtgggg tggggcagga cagcaagggg gaggattggg 3180

aagacaatag caggcatgct ggggatgcgg tgggctctat ggcttctgag gcggaaagaa 3240

ccagctgggg ctctaggggg tatccccacg cgccctgtag cggcgcatta agcgcggcgg 3300

gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgcctagcgc ccgctccttt 3360

cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg 3420

ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga 3480

ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac 3540

gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa cactcaaccc 3600

tatctcggtc tattcttttg atttataagg gattttgccg atttcggcct attggttaaa 3660

aaatgagctg atttaacaaa aatttaacgc gaattaattc tgtggaatgt gtgtcagtta 3720

gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 3780

tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc 3840

atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta 3900

actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca 3960

gaggccgagg ccgcctctgc ctctgagcta ttccagaagt agtgaggagg cttttttgga 4020

ggcctaggct tttgcaaaaa gctcccggga gcttggatat ccattttcgg atctgatcaa 4080

gagacaggat gaggatcgtt tcgcatgatt gaacaagatg gattgcacgc aggttctccg 4140

gccgcttggg tggagaggct attcggctat gactgggcac aacagacaat cggctgctct 4200

gatgccgccg tgttccggct gtcagcgcag gggcgcccgg ttctttttgt caagaccgac 4260

ctgtccggtg ccctgaatga actgcaggac gaggcagcgc ggctatcgtg gctggccacg 4320

acgggcgttc cttgcgcagc tgtgctcgac gttgtcactg aagcgggaag ggactggctg 4380

ctattgggcg aagtgccggg gcaggatctc ctgtcatctc accttgctcc tgccgagaaa 4440

gtatccatca tggctgatgc aatgcggcgg ctgcatacgc ttgatccggc tacctgccca 4500

ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta ctcggatgga agccggtctt 4560

gtcgatcagg atgatctgga cgaagagcat caggggctcg cgccagccga actgttcgcc 4620

aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc 4680

ttgccgaata tcatggtgga aaatggccgc ttttctggat tcatcgactg tggccggctg 4740

ggtgtggcgg accgctatca ggacatagcg ttggctaccc gtgatattgc tgaagagctt 4800

ggcggcgaat gggctgaccg cttcctcgtg ctttacggta tcgccgctcc cgattcgcag 4860

cgcatcgcct tctatcgcct tcttgacgag ttcttctgag cgggactctg gggttcggtg 4920

ctacgagatt tcgattccac cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc 4980

cgggacgccg gctggatgat cctccagcgc ggggatctca tgctggagtt cttcgcccac 5040

cccaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc 5100

acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta 5160

tcttatcatg tctgtatacc gtcgacctct agctagagct tggcgtaatc atggtcatag 5220

ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatacg agccggaagc 5280

ataaagtgta aagcctgggg tgcctaatga gtgagctaac tcacattaat tgcgttgcgc 5340

tcactgcccg ctttccagtc gggaaacctg tcgtgccaga attgcatgaa gaatctgctt 5400

agggttaggc gttttgcgct gcttcgctag gtggtcaata ttggccatta gccatattat 5460

tcattggtta tatagcataa atcaatattg gctattggcc attgcatacg ttgtatccat 5520

atcataatat gtacatttat attggctcat gtccaacatt accgccatgt tgacattgat 5580

tattgactag ttattaatag taatcaatta cggggtcatt agttcatagc ccatatatgg 5640

agttccgcgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc 5700

gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg actttccatt 5760

gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc 5820

atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg 5880

cccagtacat gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg 5940

ctattaccat ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact 6000

cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa 6060

atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta 6120

ggcgtgtacg gtgggaggtc tatataagca gagctcgttt agtgaaccgt cagatcgcct 6180

ggagacgcca tccacgctgt tttgacctcc atagaagaca ccgggaccga tccagcctcc 6240

gcggccggga acggtgcatt ggaagcttgg taccggtgaa ttcggcgcgc cagatctgcg 6300

gccgctagga agaaactcaa aacatcaaga ttttaaatac gcttcttggt ctccttgcta 6360

taattatctg ggataagcat gctgttttct gtctgtccct aacatgccct gtgattatcc 6420

gcaaacaaca cacccaaggg cagaactttg ttacttaaac accatcctgt ttgcttcttt 6480

cctcaggaac tgtggctgca ccatctgtct tcatcttccc gccatctgat gagcagttga 6540

aatctggaac tgcctctgtt gtgtgcctgc tgaataactt ctatcccaga gaggccaaag 6600

tacagtggaa ggtggataac gccctccaat cgggtaactc ccaggagagt gtcacagagc 6660

aggacagcaa ggacagcacc tacagcctca gcagcaccct gacgctgagc aaagcagact 6720

acgagaaaca caaagtctac gcctgcgaag tcacccatca gggcctgagc tcgcccgtca 6780

caaagagctt caacagggga gagtgttagt taacggatcg atccgagctc ggtaccaagc 6840

ttaagtttaa accgctgatc agcctcgact gtgccttcta gttgccagcc atctgttgtt 6900

tgcccctccc ccgtgccttc cttgaccctg gaaggtgcca ctcccactgt cctttcctaa 6960

taaaatgagg aaattgcatc gcattgtctg agtaggtgtc attctattct ggggggtggg 7020

gtggggcagg acagcaaggg ggaggattgg gaagacaata gcaggcatgc tggggatgcg 7080

gtgggctcta tggcttctga ggcggaaaga accagctgca ttaatgaatc ggccaacgcg 7140

cggggagagg cggtttgcgt attgggcgct cttccgcttc ctcgctcact gactcgctgc 7200

gctcggtcgt tcggctgcgg cgagcggtat cagctcactc aaaggcggta atacggttat 7260

ccacagaatc aggggataac gcaggaaaga acatgtgagc aaaaggccag caaaaggcca 7320

ggaaccgtaa aaaggccgcg ttgctggcgt ttttccatag gctccgcccc cctgacgagc 7380

atcacaaaaa tcgacgctca agtcagaggt ggcgaaaccc gacaggacta taaagatacc 7440

aggcgtttcc ccctggaagc tccctcgtgc gctctcctgt tccgaccctg ccgcttaccg 7500

gatacctgtc cgcctttctc ccttcgggaa gcgtggcgct ttctcatagc tcacgctgta 7560

ggtatctcag ttcggtgtag gtcgttcgct ccaagctggg ctgtgtgcac gaaccccccg 7620

ttcagcccga ccgctgcgcc ttatccggta actatcgtct tgagtccaac ccggtaagac 7680

acgacttatc gccactggca gcagccactg gtaacaggat tagcagagcg aggtatgtag 7740

gcggtgctac agagttcttg aagtggtggc ctaactacgg ctacactaga agaacagtat 7800

ttggtatctg cgctctgctg aagccagtta ccttcggaaa aagagttggt agctcttgat 7860

ccggcaaaca aaccaccgct ggtagcggtg gtttttttgt ttgcaagcag cagattacgc 7920

gcagaaaaaa aggatctcaa gaagatcctt tgatcttttc tacggggtct gacgctcagt 7980

ggaacgaaaa ctcacgttaagggattttgg tcatgagatt atcaaaaagg atcttcacct 8040

agatcctttt aaattaaaaa tgaagtttta aatcaatcta aagtatatat gagtaaactt 8100

ggtctgacag ttaccaatgc ttaatcagtg aggcacctat ctcagcgatc tgtctatttc 8160

gttcatccat agttgcctga ctccccgtcg tgtagataac tacgatacgg gagggcttac 8220

catctggccc cagtgctgca atgataccgc gagacccacg ctcaccggct ccagatttat 8280

cagcaataaa ccagccagcc ggaagggccg agcgcagaag tggtcctgca actttatccg 8340

cctccatcca gtctattaat tgttgccggg aagctagagt aagtagttcg ccagttaata 8400

gtttgcgcaa cgttgttgcc attgctacag gcatcgtggt gtcacgctcg tcgtttggta 8460

tggcttcatt cagctccggt tcccaacgat caaggcgagt tacatgatcc cccatgttgt 8520

gcaaaaaagc ggttagctcc ttcggtcctc cgatcgttgt cagaagtaag ttggccgcag 8580

tgttatcact catggttatg gcagcactgc ataattctct tactgtcatg ccatccgtaa 8640

gatgcttttc tgtgactggt gagtactcaa ccaagtcatt ctgagaatag tgtatgcggc 8700

gaccgagttg ctcttgcccg gcgtcaatac gggataatac cgcgccacat agcagaactt 8760

taaaagtgct catcattgga aaacgttctt cggggcgaaa actctcaagg atcttaccgc 8820

tgttgagatc cagttcgatg taacccactc gtgcacccaa ctgatcttca gcatctttta 8880

ctttcaccag cgtttctggg tgagcaaaaa caggaaggca aaatgccgca aaaaagggaa 8940

taagggcgac acggaaatgt tgaatactca 8970

<210>177

<211>8969

<212>DNA

<213> Artificial sequence

<220>

<223> pCP 9-lambda sequence

<400>177

tactcttcct ttttcaatat tattgaagca tttatcaggg ttattgtctc atgagcggat 60

acatatttga atgtatttag aaaaataaac aaataggggt tccgcgcaca tttccccgaa 120

aagtgccacc tgacgtcgac ggatcgggag atctcccgat cccctatggt gcactctcag 180

tacaatctgc tctgatgccg catagttaag ccagtatctg ctccctgctt gtgtgttgga 240

ggtcgctgag tagtgcgcga gcaaaattta agctacaaca aggcaaggct tgaccgacaa 300

ttgcatgaag aatctgctta gggttaggcg ttttgcgctg cttcgctagg tggtcaatat 360

tggccattag ccatattatt cattggttat atagcataaa tcaatattgg ctattggcca 420

ttgcatacgt tgtatccata tcataatatg tacatttata ttggctcatg tccaacatta 480

ccgccatgtt gacattgatt attgactagt tattaatagt aatcaattac ggggtcatta 540

gttcatagcc catatatgga gttccgcgtt acataactta cggtaaatgg cccgcctggc 600

tgaccgccca acgacccccg cccattgacg tcaataatga cgtatgttcc catagtaacg 660

ccaataggga ctttccattg acgtcaatgg gtggagtatt tacggtaaac tgcccacttg 720

gcagtacatc aagtgtatca tatgccaagt acgcccccta ttgacgtcaa tgacggtaaa 780

tggcccgcct ggcattatgc ccagtacatg accttatggg actttcctac ttggcagtac 840

atctacgtat tagtcatcgc tattaccatg gtgatgcggt tttggcagta catcaatggg 900

cgtggatagc ggtttgactc acggggattt ccaagtctcc accccattga cgtcaatggg 960

agtttgtttt ggcaccaaaa tcaacgggac tttccaaaat gtcgtaacaa ctccgcccca 1020

ttgacgcaaa tgggcggtag gcgtgtacgg tgggaggtct atataagcag agctcgttta 1080

gtgaaccgtc agatcgcctg gagacgccat ccacgctgtt ttgacctcca tagaagacac 1140

cgggaccgat ccagcctccg cggccgggaa cggtgcattg gaagcttggt accgagctcg 1200

gatccttaat taactcgagg cccgagcccg ggcgagccca gacactggac gctgaacctc 1260

gcggacagtt aagaacccag gggcctctgc gccctgggcc cagctctgtc ccacaccgcg 1320

gtcacatggc accacctctc ttgcagcctc caccaagggc ccatcggtct tccccctggc 1380

accctcctcc aagagcacct ctgggggcac agcggccctg ggctgcctgg tcaaggacta 1440

cttccccgaa ccggtgacgg tgtcgtggaa ctcaggcgcc ctgaccagcg gcgtgcacac 1500

cttcccggct gtcctacagt cctcaggact ctactccctc agcagcgtgg tgaccgtgcc 1560

ctccagcagc ttgggcaccc agacctacat ctgcaacgtg aatcacaagc ccagcaacac 1620

caaggtggac aagagagttg gtgagaggcc agcacaggga gggagggtgt ctgctggaag 1680

ccaggctcag cgctcctgcc tggacgcatc ccggctatgc agtcccagtc cagggcagca 1740

aggcaggccc cgtctgcctc ttcacccgga ggcctctgcc cgccccactc atgctcaggg 1800

agagggtctt ctggcttttt ccccaggctc tgggcaggca cgggctaggt gcccctaacc 1860

caggccctgc acacaaaggg gcaggtgctg ggctcagacc tgccaagagc catatccggg 1920

aggaccctgc ccctgaccta agcccacccc aaaggccaaa ctctccactc cctcagctcg 1980

gacaccttct ctcctcccag attccagtaa ctcccaatct tctctctgca gagcccaaat 2040

cttgtgacaa aactcacaca tgcccaccgt gcccaggtaa gccagcccag gcctcgccct 2100

ccagctcaag gcgggacagg tgccctagag tagcctgcat ccagggacag gccccagccg 2160

ggtgctgaca cgtccacctc catctcttcc tcagcacctg aactcctggg gggaccgtca 2220

gtcttcctct tccccccaaa acccaaggac accctcatga tctcccggac ccctgaggtc 2280

acatgcgtgg tggtggacgt gagccacgaa gaccctgagg tcaagttcaa ctggtacgtg 2340

gacggcgtgg aggtgcataa tgccaagaca aagccgcggg aggagcagta caacagcacg 2400

taccgtgtgg tcagcgtcct caccgtcctg caccaggact ggctgaatgg caaggagtac 2460

aagtgcaagg tctccaacaa agccctccca gcccccatcg agaaaaccat ctccaaagcc 2520

aaaggtggga cccgtggggt gcgagggcca catggacaga ggccggctcg gcccaccctc 2580

tgccctgaga gtgaccgctg taccaacctc tgtccctaca gggcagcccc gagaaccaca 2640

ggtgtacacc ctgcccccat cccgggagga gatgaccaag aaccaggtca gcctgacctg 2700

cctggtcaaa ggcttctatc ccagcgacat cgccgtggag tgggagagca atgggcagcc 2760

ggagaacaac tacaagacca cgcctcccgt gctggactcc gacggctcct tcttcctcta 2820

tagcaagctc accgtggaca agagcaggtg gcagcagggg aacgtcttct catgctccgt 2880

gatgcatgag gctctgcaca accactacac gcagaagagc ctctccctgt ctccgggtaa 2940

atgagctagc gaattcaccg gtaccaagct taagtttaaa ccgctgatca gcctcgactg 3000

tgccttctag ttgccagcca tctgttgttt gcccctcccc cgtgccttcc ttgaccctgg 3060

aaggtgccac tcccactgtc ctttcctaat aaaatgagga aattgcatcg cattgtctga 3120

gtaggtgtca ttctattctg gggggtgggg tggggcaggacagcaagggg gaggattggg 3180

aagacaatag caggcatgct ggggatgcgg tgggctctat ggcttctgag gcggaaagaa 3240

ccagctgggg ctctaggggg tatccccacg cgccctgtag cggcgcatta agcgcggcgg 3300

gtgtggtggt tacgcgcagc gtgaccgcta cacttgccag cgcctagcgc ccgctccttt 3360

cgctttcttc ccttcctttc tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg 3420

ggggctccct ttagggttcc gatttagtgc tttacggcac ctcgacccca aaaaacttga 3480

ttagggtgat ggttcacgta gtgggccatc gccctgatag acggtttttc gccctttgac 3540

gttggagtcc acgttcttta atagtggact cttgttccaa actggaacaa cactcaaccc 3600

tatctcggtc tattcttttg atttataagg gattttgccg atttcggcct attggttaaa 3660

aaatgagctg atttaacaaa aatttaacgc gaattaattc tgtggaatgt gtgtcagtta 3720

gggtgtggaa agtccccagg ctccccagca ggcagaagta tgcaaagcat gcatctcaat 3780

tagtcagcaa ccaggtgtgg aaagtcccca ggctccccag caggcagaag tatgcaaagc 3840

atgcatctca attagtcagc aaccatagtc ccgcccctaa ctccgcccat cccgccccta 3900

actccgccca gttccgccca ttctccgccc catggctgac taattttttt tatttatgca 3960

gaggccgagg ccgcctctgc ctctgagcta ttccagaagt agtgaggagg cttttttgga 4020

ggcctaggct tttgcaaaaa gctcccggga gcttggatat ccattttcgg atctgatcaa 4080

gagacaggat gaggatcgtt tcgcatgatt gaacaagatg gattgcacgc aggttctccg 4140

gccgcttggg tggagaggct attcggctat gactgggcac aacagacaat cggctgctct 4200

gatgccgccg tgttccggct gtcagcgcag gggcgcccgg ttctttttgt caagaccgac 4260

ctgtccggtg ccctgaatga actgcaggac gaggcagcgc ggctatcgtg gctggccacg 4320

acgggcgttc cttgcgcagc tgtgctcgac gttgtcactg aagcgggaag ggactggctg 4380

ctattgggcg aagtgccggg gcaggatctc ctgtcatctc accttgctcc tgccgagaaa 4440

gtatccatca tggctgatgc aatgcggcgg ctgcatacgc ttgatccggc tacctgccca 4500

ttcgaccacc aagcgaaaca tcgcatcgag cgagcacgta ctcggatgga agccggtctt 4560

gtcgatcagg atgatctgga cgaagagcat caggggctcg cgccagccga actgttcgcc 4620

aggctcaagg cgcgcatgcc cgacggcgag gatctcgtcg tgacccatgg cgatgcctgc 4680

ttgccgaata tcatggtgga aaatggccgc ttttctggat tcatcgactg tggccggctg 4740

ggtgtggcgg accgctatca ggacatagcg ttggctaccc gtgatattgc tgaagagctt 4800

ggcggcgaat gggctgaccg cttcctcgtg ctttacggta tcgccgctcc cgattcgcag 4860

cgcatcgcct tctatcgcct tcttgacgag ttcttctgag cgggactctg gggttcggtg 4920

ctacgagatt tcgattccac cgccgccttc tatgaaaggt tgggcttcgg aatcgttttc 4980

cgggacgccg gctggatgat cctccagcgc ggggatctca tgctggagtt cttcgcccac 5040

cccaacttgt ttattgcagc ttataatggt tacaaataaa gcaatagcat cacaaatttc 5100

acaaataaag catttttttc actgcattct agttgtggtt tgtccaaact catcaatgta 5160

tcttatcatg tctgtatacc gtcgacctct agctagagct tggcgtaatc atggtcatag 5220

ctgtttcctg tgtgaaattg ttatccgctc acaattccac acaacatacg agccggaagc 5280

ataaagtgta aagcctgggg tgcctaatga gtgagctaac tcacattaat tgcgttgcgc 5340

tcactgcccg ctttccagtc gggaaacctg tcgtgccaga attgcatgaa gaatctgctt 5400

agggttaggc gttttgcgct gcttcgctag gtggtcaata ttggccatta gccatattat 5460

tcattggtta tatagcataa atcaatattg gctattggcc attgcatacg ttgtatccat 5520

atcataatat gtacatttat attggctcat gtccaacatt accgccatgt tgacattgat 5580

tattgactag ttattaatag taatcaatta cggggtcatt agttcatagc ccatatatgg 5640

agttccgcgt tacataactt acggtaaatg gcccgcctgg ctgaccgccc aacgaccccc 5700

gcccattgac gtcaataatg acgtatgttc ccatagtaac gccaataggg actttccatt 5760

gacgtcaatg ggtggagtat ttacggtaaa ctgcccactt ggcagtacat caagtgtatc 5820

atatgccaag tacgccccct attgacgtca atgacggtaa atggcccgcc tggcattatg 5880

cccagtacat gaccttatgg gactttccta cttggcagta catctacgta ttagtcatcg 5940

ctattaccat ggtgatgcgg ttttggcagt acatcaatgg gcgtggatag cggtttgact 6000

cacggggatt tccaagtctc caccccattg acgtcaatgg gagtttgttt tggcaccaaa 6060

atcaacggga ctttccaaaa tgtcgtaaca actccgcccc attgacgcaa atgggcggta 6120

ggcgtgtacg gtgggaggtc tatataagca gagctcgttt agtgaaccgt cagatcgcct 6180

ggagacgcca tccacgctgt tttgacctcc atagaagaca ccgggaccga tccagcctcc 6240

gcggccggga acggtgcatt ggaagcttgg taccggtgaa ttcggcgcgc cagatctgcg 6300

gccgctagga agaaactcaa aacatcaaga ttttaaatac gcttcttggt ctccttgcta 6360

taattatctg ggataagcat gctgttttct gtctgtccct aacatgccct gtgattatcc 6420

gcaaacaaca cacccaaggg cagaactttg ttacttaaac accatcctgt ttgcttcttt 6480

cctcaggtca gcccaaggct gccccctcgg tcactctgtt cccgccctcc tctgaggagc 6540

ttcaagccaa caaggccaca ctggtgtgtc tcataagtga cttctacccg ggagccgtga 6600

cagtggcctg gaaggcagat agcagccccg tcaaggcggg agtggagacc accacaccct 6660

ccaaacaaag caacaacaag tacgcggcca gcagctacct gagcctgacg cctgagcagt 6720

ggaagtccca cagaagctac agctgccagg tcacgcatga agggagcacc gtggagaaga 6780

cagtggcccc tacagaatgt tcatagagtt aacggatcga tccgagctcg gtaccaagct 6840

taagtttaaa ccgctgatca gcctcgactg tgccttctag ttgccagcca tctgttgttt 6900

gcccctcccc cgtgccttcc ttgaccctgg aaggtgccac tcccactgtc ctttcctaat 6960

aaaatgagga aattgcatcg cattgtctga gtaggtgtca ttctattctg gggggtgggg 7020

tggggcagga cagcaagggg gaggattggg aagacaatag caggcatgct ggggatgcgg 7080

tgggctctat ggcttctgag gcggaaagaa ccagctgcat taatgaatcg gccaacgcgc 7140

ggggagaggc ggtttgcgta ttgggcgctc ttccgcttcc tcgctcactg actcgctgcg 7200

ctcggtcgtt cggctgcggc gagcggtatc agctcactca aaggcggtaa tacggttatc 7260

cacagaatca ggggataacg caggaaagaa catgtgagca aaaggccagc aaaaggccag 7320

gaaccgtaaa aaggccgcgt tgctggcgtt tttccatagg ctccgccccc ctgacgagca 7380

tcacaaaaat cgacgctcaa gtcagaggtg gcgaaacccg acaggactat aaagatacca 7440

ggcgtttccc cctggaagct ccctcgtgcg ctctcctgtt ccgaccctgc cgcttaccgg 7500

atacctgtcc gcctttctcc cttcgggaag cgtggcgctt tctcatagct cacgctgtag 7560

gtatctcagt tcggtgtagg tcgttcgctc caagctgggc tgtgtgcacg aaccccccgt 7620

tcagcccgac cgctgcgcct tatccggtaa ctatcgtctt gagtccaacc cggtaagaca 7680

cgacttatcg ccactggcag cagccactgg taacaggatt agcagagcga ggtatgtagg 7740

cggtgctaca gagttcttga agtggtggcc taactacggc tacactagaa gaacagtatt 7800

tggtatctgc gctctgctga agccagttac cttcggaaaa agagttggta gctcttgatc 7860

cggcaaacaa accaccgctg gtagcggtgg tttttttgtt tgcaagcagc agattacgcg 7920

cagaaaaaaa ggatctcaag aagatccttt gatcttttct acggggtctg acgctcagtg 7980

gaacgaaaac tcacgttaag ggattttggt catgagatta tcaaaaagga tcttcaccta 8040

gatcctttta aattaaaaat gaagttttaa atcaatctaa agtatatatg agtaaacttg 8100

gtctgacagt taccaatgct taatcagtga ggcacctatc tcagcgatct gtctatttcg 8160

ttcatccata gttgcctgac tccccgtcgt gtagataact acgatacggg agggcttacc 8220

atctggcccc agtgctgcaa tgataccgcg agacccacgc tcaccggctc cagatttatc 8280

agcaataaac cagccagccg gaagggccga gcgcagaagt ggtcctgcaa ctttatccgc 8340

ctccatccag tctattaatt gttgccggga agctagagta agtagttcgc cagttaatag 8400

tttgcgcaac gttgttgcca ttgctacagg catcgtggtg tcacgctcgt cgtttggtat 8460

ggcttcattc agctccggtt cccaacgatc aaggcgagtt acatgatccc ccatgttgtg 8520

caaaaaagcg gttagctcct tcggtcctcc gatcgttgtc agaagtaagt tggccgcagt 8580

gttatcactc atggttatgg cagcactgca taattctctt actgtcatgc catccgtaag 8640

atgcttttct gtgactggtg agtactcaac caagtcattc tgagaatagt gtatgcggcg 8700

accgagttgc tcttgcccgg cgtcaatacg ggataatacc gcgccacata gcagaacttt 8760

aaaagtgctc atcattggaa aacgttcttc ggggcgaaaa ctctcaagga tcttaccgct 8820

gttgagatcc agttcgatgt aacccactcg tgcacccaac tgatcttcag catcttttac 8880

tttcaccagc gtttctgggt gagcaaaaac aggaaggcaa aatgccgcaa aaaagggaat 8940

aagggcgaca cggaaatgtt gaatactca 8969

<210>178

<211>57

<212>PRT

<213> Artificial sequence

<220>

<223>Sym-1705

<400>178

Lys Gln Arg Gln Asn Lys Pro Pro Asn Lys Pro Asn Asn Asp Phe His

1 5 10 15

Phe Glu Val Phe Asn Phe Val Pro Cys Ser Ile Cys Ser Asn Asn Pro

20 25 30

Thr Cys Trp Ala Ile Cys Lys Arg Ile Pro Asn Lys Lys Pro Gly Lys

35 40 45

Lys Thr Thr Thr Lys Pro Thr Lys Lys

50 55

<210>179

<211>57

<212>PRT

<213> Artificial sequence

<220>

<223>Sym-1788

<400>179

Lys Pro Arg Pro Lys Ser Pro Pro Lys Lys Pro Lys Asp Asp Tyr His

1 5 10 15

Phe Glu Val Phe Asn Phe Val Pro Cys Ser Ile Cys Gly Asn Asn Gln

20 25 30

Leu Cys Lys Ser Ile Cys Lys Thr Ile Pro Ser Asn Lys Pro Lys Lys

35 40 45

Lys Pro Thr Ile Lys Pro Thr Asn Lys

50 55

<210>180

<211>40

<212>PRT

<213> Artificial sequence

<220>

<223>Sym-1789

<400>180

Lys Pro Arg Pro Lys Ser Pro Pro Lys Lys Pro Lys Asp Asp Tyr His

1 5 10 15

Phe Glu Val Phe Asn Phe Val Pro Cys Ser Ile Cys Gly Asn Asn Gln

20 25 30

Leu Cys Lys Ser Ile Cys Lys Thr

35 40

Claims

1. Antibody capable of specifically binding to the G protein of the Respiratory Syncytial Virus (RSV) and capable of neutralizing RSV a and B strains, wherein the antibody binds to an epitope within the central conserved domain of the RSV G protein, wherein said epitope comprises one or more amino acid residues of amino acid 160-169 and one or more amino acid residues of amino acid 184-192 of the RSV G protein RSV a2 strain or corresponding amino acids in other strains, wherein the antibody is selected from the group consisting of:

a) an antibody comprising the heavy chain CDR1 region of SEQ ID NO. 1, the heavy chain CDR2 region of SEQ ID NO. 2, and the heavy chain CDR3 region of SEQ ID NO. 3, the light chain CDR1 region of SEQ ID NO. 4, the light chain CDR2 region of SEQ ID NO. 5, and the light chain CDR3 region of SEQ ID NO. 6;

b) an antibody comprising the heavy chain CDR1 region of SEQ ID NO. 13, the heavy chain CDR2 region of SEQ ID NO. 14, and the heavy chain CDR3 region of SEQ ID NO. 15, the light chain CDR1 region of SEQ ID NO. 16, the light chain CDR2 region of SEQ ID NO. 17, and the light chain CDR3 region of SEQ ID NO. 18;

c) an antibody comprising the heavy chain CDR1 region of SEQ ID NO 19, the heavy chain CDR2 region of SEQ ID NO 20, and the heavy chain CDR3 region of SEQ ID NO 21, the light chain CDR1 region of SEQ ID NO 22, the light chain CDR2 region of SEQ ID NO 23, and the light chain CDR3 region of SEQ ID NO 24;

d) an antibody comprising the heavy chain CDR1 region of SEQ ID NO. 25, the heavy chain CDR2 region of SEQ ID NO. 26, and the heavy chain CDR3 region of SEQ ID NO. 27, the light chain CDR1 region of SEQ ID NO. 28, the light chain CDR2 region of SEQ ID NO. 29, and the light chain CDR3 region of SEQ ID NO. 30;

e) an antibody comprising the heavy chain CDR1 region of SEQ ID NO. 31, the heavy chain CDR2 region of SEQ ID NO. 32, and the heavy chain CDR3 region of SEQ ID NO. 33, the light chain CDR1 region of SEQ ID NO. 34, the light chain CDR2 region of SEQ ID NO. 35, and the light chain CDR3 region of SEQ ID NO. 36;

f) an antibody comprising the heavy chain CDR1 region of SEQ ID NO 37, the heavy chain CDR2 region of SEQ ID NO 38, and the heavy chain CDR3 region of SEQ ID NO 39, the light chain CDR1 region of SEQ ID NO 40, the light chain CDR2 region of SEQ ID NO 41, and the light chain CDR3 region of SEQ ID NO 42;

g) an antibody comprising the heavy chain CDR1 region of SEQ ID NO 43, the heavy chain CDR2 region of SEQ ID NO 44, and the heavy chain CDR3 region of SEQ ID NO 45, the light chain CDR1 region of SEQ ID NO 46, the light chain CDR2 region of SEQ ID NO 47, and the light chain CDR3 region of SEQ ID NO 48;

h) an antibody comprising the heavy chain CDR1 region of SEQ ID NO 49, the heavy chain CDR2 region of SEQ ID NO 50, and the heavy chain CDR3 region of SEQ ID NO 51, the light chain CDR1 region of SEQ ID NO 52, the light chain CDR2 region of SEQ ID NO 53, and the light chain CDR3 region of SEQ ID NO 54; i) an antibody comprising the heavy chain CDR1 region of SEQ ID NO:55, the heavy chain CDR2 region of SEQ ID NO:56, and the heavy chain CDR3 region of SEQ ID NO:57, the light chain CDR1 region of SEQ ID NO:58, the light chain CDR2 region of SEQ ID NO:59, and the light chain CDR3 region of SEQ ID NO: 60;

j) an antibody comprising the heavy chain CDR1 region of SEQ ID NO 61, the heavy chain CDR2 region of SEQ ID NO 62, and the heavy chain CDR3 region of SEQ ID NO 63, the light chain CDR1 region of SEQ ID NO 64, the light chain CDR2 region of SEQ ID NO 65, and the light chain CDR3 region of SEQ ID NO 66; and

k) an antibody comprising the heavy chain CDR1 region of SEQ ID NO 67, the heavy chain CDR2 region of SEQ ID NO 68, and the heavy chain CDR3 region of SEQ ID NO 69, the light chain CDR1 region of SEQ ID NO 70, the light chain CDR2 region of SEQ ID NO 71, and the light chain CDR3 region of SEQ ID NO 72.

2. The antibody of claim 1, wherein the antibody is a human antibody.

3. An antigen-binding fragment of an antibody according to claim 1 or 2.

4. An immunoconjugate comprising an antibody according to claim 1 or 2, and/or an antigen-binding fragment according to claim 3, the immunoconjugate further comprising at least one therapeutic agent and/or detectable agent.

5. A nucleic acid molecule encoding the antibody of claim 1 or 2, and/or the antigen-binding fragment of claim 3.

6. A vector comprising at least one nucleic acid molecule according to claim 5.

7. A host cell comprising at least one vector according to claim 6.

8. A method of producing an antibody according to claim 1 or 2, and/or an antigen-binding fragment according to claim 3, wherein the method comprises the steps of:

a) culturing the host cell of claim 6 under conditions conducive to the expression of the antibody, and optionally,

b) recovering the expressed antibody, antigen binding fragment.

9. A pharmaceutical composition comprising an antibody according to claim 1 or 2, and/or an antigen-binding fragment according to claim 3, further comprising at least one pharmaceutically acceptable excipient.

10. An antibody according to claim 1 or 2, and/or an antigen-binding fragment according to claim 3, or a pharmaceutical composition according to claim 9, for use as a medicament.

11. The antibody according to claim 1 or 2, and/or the antigen-binding fragment according to claim 3, or the pharmaceutical composition according to claim 9, for use in the prevention or treatment of RSV infection or a combination thereof.

12. A kit comprising at least one of: the antibody according to claim 1 or 2, and/or the antigen-binding fragment according to claim 3, or the pharmaceutical composition according to claim 9, or a combination thereof.

13. Use of an antibody according to claim 1 or 2, an antigen-binding fragment according to claim 3, and/or an immunoconjugate according to claim 4 in the manufacture of a diagnostic agent for the detection of RSV infection.