CN111303250A

CN111303250A - Tissue repair protein CHRD, and coding gene and application thereof

Info

Publication number: CN111303250A
Application number: CN202010073742.2A
Authority: CN
Inventors: 彭志平; 陈晓良
Original assignee: Chongqing Medical University
Current assignee: Chongqing Medical University
Priority date: 2020-01-22
Filing date: 2020-01-22
Publication date: 2020-06-19
Anticipated expiration: 2040-01-22
Also published as: CN111303250B

Abstract

The invention relates to the field of biomedicine and daily necessities, in particular to a tissue repair protein CHRD, a coding gene thereof and application thereof. The protein is a1 or a2 protein: a1. the amino acid sequence is a protein shown as a sequence 1 in a sequence table; a2. the protein which is formed by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 1 in the sequence table and is related to the skin wound repair. Experiments prove that the CHRD protein has obvious repairing effects on simple skin wound repair and radiation-accompanied skin injury wounds, and compared with sterile medical gauze, the CHRD protein improves the healing speed of the radiation-accompanied skin injury wounds by about 30%.

Description

Tissue repair protein CHRD, and coding gene and application thereof

Technical Field

The invention relates to the field of biomedicine and daily necessities, in particular to a recombinant protein CHRD for repairing skin wounds, and a coding gene and application thereof.

Background

The skin is an important barrier of human body, and various operations, traumas, burns, dermatitis and the like can cause skin damage and defects, thereby causing various traumas. The wound repair is a series of pathophysiological processes of repairing local tissues through regeneration, repair and reconstruction after the tissues are damaged (such as wounds, wound surfaces and the like) due to trauma or other pathological changes of injuries, is an important field of medical development, and has important significance for relieving the pain of patients and avoiding scars from being left after the repair.

The process of wound repair requires the use of novel medical materials, in particular biomedical materials, a class of natural or synthetic, specifically functioning materials, also known as biomedical materials, which are used to contact and interact with living systems and to carry out diagnostic treatments, replacement repairs or induced regeneration of their cells, tissues and organs. According to different materials, biomedical materials can be classified into medical high polymer materials, medical metal materials, civil nonmetal materials and the like. Conventional dressings, which are primarily referred to as medical absorbent cotton gauze, have many advantages, but their use is not satisfactory. For example, the liquid absorption amount is not large enough, thick dressing is needed, and the dressing is frequently replaced; the dressing is easy to dry after imbibing, and is adhered to the wound to cause secondary wound, inconvenient use and the like. Protein materials are widely used as biomedical materials due to their good biocompatibility and biodegradability. The recombinant protein expression has the advantages of rapid large-scale production, environmental friendliness, quality control easiness and the like, and is an important means for designing and producing protein biomaterials.

Therefore, the development of protein dressings for wound repair is a good choice.

Disclosure of Invention

In order to meet the requirements of the fields, the invention designs a brand-new amino acid sequence and obtains a brand-new protein named CHRD protein by applying a recombinant protein expression method. Experiments prove that the CHRD protein has obvious repairing effects on simple skin wound repair and radiation combined skin wound compared with gauze.

The protein provided by the invention is a protein of a1 or a 2:

a1. the amino acid sequence is a protein shown as a sequence 1 in a sequence table;

a2. the protein which is formed by substituting and/or deleting and/or adding one or more amino acid residues to the amino acid sequence shown in the sequence 1 in the sequence table and is related to the skin wound repair.

The invention also provides a coding gene of the protein.

The coding gene is a DNA molecule of b1 or b2 as follows:

b1. the nucleotide sequence is a DNA molecule shown as a sequence 2 in a sequence table;

b2. a DNA molecule which hybridizes under stringent conditions to the DNA molecule defined in b1.

An expression cassette, a vector or a recombinant bacterium containing the coding gene also belongs to the protection scope of the invention.

The application of the protein in preparing external products for repairing skin wounds also belongs to the protection scope of the invention.

The invention also provides an external preparation for repairing the skin wound, which comprises the protein.

In some embodiments of the invention, the topical preparation further comprises an excipient useful in skin wound repair.

In some embodiments of the present invention, the formulation of the external preparation is powder, gel, cream or cream.

In some embodiments of the invention, the protein is present in the topical preparation in an amount of 10% to 100% by weight.

The invention also provides a method for preparing an external preparation for repairing a skin wound, which comprises the following steps: introducing the coding gene into an expression host bacterium to obtain a recombinant bacterium; culturing recombinant bacteria, inducing protein expression, collecting bacteria, extracting and purifying protein.

Animal experiments show that the CHRD protein has obvious repairing effects on simple skin wound repair and radiation combined skin wound. For a pure rat skin wound, 70.38% of the skin wound can be repaired by the CHRD protein on the 7 th day after the wound, and the skin wound can be completely repaired on the 21 st day. For rat radiation in combination with skin wounds, the CHRD protein repaired 97.36% of skin wounds on day 21 post-trauma. Compared with gauze, CHRD protein can improve the wound healing speed by about 30 percent. The CHRD protein provided by the invention has good biocompatibility, and only needs to be applied to a wound surface when in use, compared with gauze, the CHRD protein does not cause secondary injury to the wound, can more effectively repair traumatic skin, and relieves pain of a wounded person.

Drawings

FIG. 1. plasmid map of pET-20 b.

FIG. 2 is an electropherogram of CHRD protein; wherein, the left lane is the protein molecular marker, and the right lane is the purified CHRD protein.

FIG. 3 effect of CHRD protein on survival of mouse fibroblast L929; wherein the horizontal axis represents CHRD protein concentration in the culture medium, the vertical axis represents cell survival rate (%), and the survival rate of the control group cells without CHRD protein in the culture medium is 100%.

Detailed Description

The present invention is further illustrated below by reference to examples, which are to be understood as being illustrative and illustrative only and not limiting in any way to the scope of the present invention.

Materials and reagents

SD rat: male, weight 250-.

Mouse fibroblast L929: purchased from the national academy of sciences cell bank of the culture collection, catalog number SCSP-5039, cell name: NCTC clone 929[ L cell, L-929, derivantof Strain L ], animal species: mouse, strain C3H/An.

pET-20b, also known as pET20b +, available from Novagen as Cat 69739-3, was formulated as a dry plasmid powder. The pET-20b plasmid is an Escherichia coli protein expression vector, the size of the plasmid is 3716bp, the prokaryotic resistance is Amp, a T7 promoter and a T7 terminator.

A5 ml His Trap FF column from Bogalong (Shanghai) Biotechnology, Inc., cat # AH 221311.

Coli BL21(DE3) competent cells, Ampicillin (Ampicillin), IPTG, DMEM medium, dimethyl sulfoxide (DMSO), MTT were purchased from Beijing Solebao technologies, Inc.

Chloral hydrate: alias chloral hydrate, CAS number 302-17-0, available from Sigma-Aldrich, cat # C8383.

MTT formulation

MTT was dissolved in PBS and the solution was assisted in a 60 ℃ water bath. PBS formulation: NaCl 8g, KCl 0.2g, Na₂HPO₄1.44g，KH₂PO₄0.24g, dissolved in 950ml ddH₂And in O, adjusting the pH value to 7.4, and fixing the volume to 1L.

LB Medium

Each 100ml of LB medium contained: 1g tryptone, 0.5g yeast extract, 1g sodium chloride, pH 7.4.

The preparation method comprises the following steps: at 950ml ddH₂Dissolving 10g tryptone, 5g yeast extract, 10g sodium chloride in O, adjusting pH to 7.4 with NaOH, and adding ddH₂And O is metered to 1L. If a solid medium is prepared, 15g of agar per liter are added. Sterilizing with high pressure steam at 121 deg.C for 20 min.

The experimental reagents which are not particularly described in the invention are all conventional reagents in the field, and can be prepared according to the conventional method in the field or obtained commercially; the experimental procedures not specifically described are conventional in the art and may be referred to, for example, in a Molecular cloning laboratory Manual (Sambrook J & Russell DW, Molecular cloning: a laboratory Manual, 2001), or the manufacturer's instructions.

Example 1 CHRD Gene design and protein expression

1. Gene design

The inventor designs a gene, the nucleotide sequence of which is shown as sequence 2 in a sequence table, and the total length of which is 1719 bp. The gene codes a protein, the amino acid sequence of which is shown as sequence 1 in a sequence table, and the full-length 572 amino acids are named CHRD protein. The gene was synthesized in its entirety by the firm of Compton Biotechnology engineering (Shanghai) Co., Ltd.and Ndel cleavage sites (CATATG) and Xhol cleavage sites (CTCGAG) were added to the 5 'and 3' ends of the gene, respectively. The gene sequence with the enzyme cutting site is shown as a sequence 3 in a sequence table. Sequencing and verifying the synthesized gene, and using the gene with the correct sequence for subsequent vector construction.

Amino acid sequence of CHRD (572aa)

MSSGVDLGTENLYFQSNAMSDSEVNQEAKPEVKPEVKPETHINLKVSDGSSEIFFKIKKTTPLRRLMEAFAKRKKMKGVQLKLEQGALEEQCATYEAGCYRNHVHLQLLEHQETEFSAKMISQLESRQKEQGLTDGELKEAQQTPEYLKNVSLRALQDELCLSLSQMRERSERVNLEEDSQLARRAVREQLTSLCSAAERAIQDEEPQKSRVQACELTVADQESQGCLSRAGEEQCETERLLKEQTPSLSAQCAVEEQSSRAKSLKANAQNLFDTLESTRQGKEMDSLRFLYDGIRIQADQTPEDLDMEDNDIIEAHREQIGGMLLALYEKEELNTELELAEAQLNIPSMTPQCLSMSCKVEVLAHLQELERLFQYYEISMDTACGTMLQRNLAMNALALTCALQQTSARVNSEYTANSIEQVAMSMPYAANRYKMQCEMGKEDNSLSVNLKEQSMCSVFTRIKRLEDTLEENECLQEQQVETTRSKEIGELGIEEESLAHRTLSLNELDESEAEDKNYVRHAQVQEDVDREIADLIMASDEQHACTSKCSECMQEEALHAACTVTHHHHHH。

Nucleotide sequence of CHRD (1719bp)

atgagcagcggcgtggatctgggcaccgaaaacctgtattttcagagcaacgcgatgagcgatagcgaagtgaaccaggaagcgaaaccggaagtgaaaccggaagtgaaaccggaaacccatattaacctgaaagtgagcgatggcagcagcgaaattttttttaaaattaaaaaaaccaccccgctgcgccgcctgatggaagcgtttgcgaaacgcaaaaaaatgaaaggcgtgcagctgaaactggaacagggcgcgctggaagaacagtgcgcgacctatgaagcgggctgctatcgcaaccatgtgcatctgcagctgctggaacatcaggaaaccgaatttagcgcgaaaatgattagccagctggaaagccgccagaaagaacagggcctgaccgatggcgaactgaaagaagcgcagcagaccccggaatatctgaaaaacgtgagcctgcgcgcgctgcaggatgaactgtgcctgagcctgagccagatgcgcgaacgcagcgaacgcgtgaacctggaagaagatagccagctggcgcgccgcgcggtgcgcgaacagctgaccagcctgtgcagcgcggcggaacgcgcgattcaggatgaagaaccgcagaaaagccgcgtgcaggcgtgcgaactgaccgtggcggatcaggaaagccagggctgcctgagccgcgcgggcgaagaacagtgcgaaaccgaacgcctgctgaaagaacagaccccgagcctgagcgcgcagtgcgcggtggaagaacagagcagccgcgcgaaaagcctgaaagcgaacgcgcagaacctgtttgataccctggaaagcacccgccagggcaaagaaatggatagcctgcgctttctgtatgatggcattcgcattcaggcggatcagaccccggaagatctggatatggaagataacgatattattgaagcgcatcgcgaacagattggcggcatgctgctggcgctgtatgaaaaagaagaactgaacaccgaactggaactggcggaagcgcagctgaacattccgagcatgaccccgcagtgcctgagcatgagctgcaaagtggaagtgctggcgcatctgcaggaactggaacgcctgtttcagtattatgaaattagcatggataccgcgtgcggcaccatgctgcagcgcaacctggcgatgaacgcgctggcgctgacctgcgcgctgcagcagaccagcgcgcgcgtgaacagcgaatataccgcgaacagcattgaacaggtggcgatgagcatgccgtatgcggcgaaccgctataaaatgcagtgcgaaatgggcaaagaagataacagcctgagcgtgaacctgaaagaacagagcatgtgcagcgtgtttacccgcattaaacgcctggaagataccctggaagaaaacgaatgcctgcaggaacagcaggtggaaaccacccgcagcaaagaaattggcgaactgggcattgaagaagaaagcctggcgcatcgcaccctgagcctgaacgaactggatgaaagcgaagcggaagataaaaactatgtgcgccatgcgcaggtgcaggaagatgtggatcgcgaaattgcggatctgattatggcgagcgatgaacagcatgcgtgcaccagcaaatgcagcgaatgcatgcaggaagaagcgctgcatgcggcgtgcaccgtgacccatcatcatcatcatcattga。

CHRD protein coding gene with enzyme cutting site (1728bp)

catatgagcagcggcgtggatctgggcaccgaaaacctgtattttcagagcaacgcgatgagcgatagcgaagtgaaccaggaagcgaaaccggaagtgaaaccggaagtgaaaccggaaacccatattaacctgaaagtgagcgatggcagcagcgaaattttttttaaaattaaaaaaaccaccccgctgcgccgcctgatggaagcgtttgcgaaacgcaaaaaaatgaaaggcgtgcagctgaaactggaacagggcgcgctggaagaacagtgcgcgacctatgaagcgggctgctatcgcaaccatgtgcatctgcagctgctggaacatcaggaaaccgaatttagcgcgaaaatgattagccagctggaaagccgccagaaagaacagggcctgaccgatggcgaactgaaagaagcgcagcagaccccggaatatctgaaaaacgtgagcctgcgcgcgctgcaggatgaactgtgcctgagcctgagccagatgcgcgaacgcagcgaacgcgtgaacctggaagaagatagccagctggcgcgccgcgcggtgcgcgaacagctgaccagcctgtgcagcgcggcggaacgcgcgattcaggatgaagaaccgcagaaaagccgcgtgcaggcgtgcgaactgaccgtggcggatcaggaaagccagggctgcctgagccgcgcgggcgaagaacagtgcgaaaccgaacgcctgctgaaagaacagaccccgagcctgagcgcgcagtgcgcggtggaagaacagagcagccgcgcgaaaagcctgaaagcgaacgcgcagaacctgtttgataccctggaaagcacccgccagggcaaagaaatggatagcctgcgctttctgtatgatggcattcgcattcaggcggatcagaccccggaagatctggatatggaagataacgatattattgaagcgcatcgcgaacagattggcggcatgctgctggcgctgtatgaaaaagaagaactgaacaccgaactggaactggcggaagcgcagctgaacattccgagcatgaccccgcagtgcctgagcatgagctgcaaagtggaagtgctggcgcatctgcaggaactggaacgcctgtttcagtattatgaaattagcatggataccgcgtgcggcaccatgctgcagcgcaacctggcgatgaacgcgctggcgctgacctgcgcgctgcagcagaccagcgcgcgcgtgaacagcgaatataccgcgaacagcattgaacaggtggcgatgagcatgccgtatgcggcgaaccgctataaaatgcagtgcgaaatgggcaaagaagataacagcctgagcgtgaacctgaaagaacagagcatgtgcagcgtgtttacccgcattaaacgcctggaagataccctggaagaaaacgaatgcctgcaggaacagcaggtggaaaccacccgcagcaaagaaattggcgaactgggcattgaagaagaaagcctggcgcatcgcaccctgagcctgaacgaactggatgaaagcgaagcggaagataaaaactatgtgcgccatgcgcaggtgcaggaagatgtggatcgcgaaattgcggatctgattatggcgagcgatgaacagcatgcgtgcaccagcaaatgcagcgaatgcatgcaggaagaagcgctgcatgcggcgtgcaccgtgacccatcatcatcatcatcattgactcgag。

2. Vector construction

pET-20b plasmid and the target gene (SEQ ID NO: 3) were subjected to double digestion with restriction enzymes Ndel and Xhol, respectively, using pET-20b plasmid as an expression vector, and then the target gene was ligated into pET-20b vector by ligation. Vector construction was carried out by committee bioengineering (shanghai) ltd.

3. Transformation of

(1) Coli BL21(DE3) competent cells were removed from the freezer at-80 ℃ and ice-cooled for 5 min.

(2) After the glycerol of the preserved cells is melted, the competent cells are added into the ligation product, the pipette tip is sucked and placed for 3 times, and the mixture is uniformly mixed and kept for 30min in ice bath.

(3) The water on the tube wall is quickly wiped dry by absorbent paper, then the tube is thermally shocked for 90s at 42 ℃, and the tube is immediately ice-cooled for 2-3 min.

(4) Add 800. mu.l LB liquid medium under aseptic conditions, incubate at 37 ℃ and 150rpm for 45 min.

(5) The cells were collected by centrifugation at 5000rpm for 5min, and most of the supernatant was discarded, and about 100. mu.l of the supernatant was left to resuspend E.coli, which was then spread uniformly on LB solid medium containing 100. mu.g/ml ampicilin (Ampicillin) (abbreviated as LB + Amp), placed in a 37 ℃ incubator, and subjected to inverted culture for 12 to 16 hours.

(6) Selecting a single clone, inoculating the single clone into an LB + Amp culture medium, culturing at 37 ℃ for 12-16 h, sending the bacterial liquid to a biological engineering (Shanghai) company Limited, performing PCR reaction by using a T7 universal primer, sequencing a PCR product, and identifying a positive clone.

4. Protein expression and purification

(1) Mass culture

Positive clones with correct sequencing were inoculated into 1L LB medium containing 50. mu.g/ml antibiotic (Ampicillin), cultured at 37 ℃ at 110rpm, and OD was allowed to stand₆₀₀When equal to 0.6Adding 0.5mM IPTG inducer, culturing at 37 deg.C for 4 hr, and centrifuging to collect thallus.

(2) Protein purification

And (3) balancing a chromatographic column: the syringe was filled with distilled water. The plug of a 5ml His Trap FF chromatography column (Shanghai Bogelong) was removed and the column was connected to a syringe. The liquid is always kept at the joint, and air bubbles are prevented from being introduced into the system. The seal at the bottom of the column was removed. The ethanol is washed away with 3-5 column volumes of deionized water. The column was equilibrated with at least 5 column volumes of conjugate Buffer at a flow rate of 5 ml/min. The formula of the combined buffer is as follows: 0.15M NaCl, 20mM Na₂HPO₄，pH 7.0。

Loading: 20g of the cultured cells were collected, and the cells were resuspended in 100ml of cell lysate (B-Per lysate, available from ThermoFisher Co., Ltd.), disrupted by a homogenizer, centrifuged at 10000rpm for 30 minutes, 10ml of the supernatant was collected, and the supernatant was added to 5ml of His Trap FF column (equilibrated with Buffer) by a syringe at a flow rate of 5 ml/min.

Washing: the column was washed with binding buffer for 5-10 column volumes until no material was eluted from the effluent at a flow rate of 5 ml/min.

And (3) elution: the column was eluted with binding buffers containing different concentrations of imidazole (0mM, 10mM, 30mM, 500mM) at a flow rate of 5ml/min and the eluted protein was collected.

Wherein, the 500mM imidazole eluent is target protein, and the protein size is 64.9 kDa. The purified CHRD protein is freeze-dried and then ground up for subsequent testing.

Example 2 evaluation of wound healing Performance of CHRD protein

1. Evaluation of simple healing Effect of skin wound

Male SD rats weighing 250-300g were selected to create a back full-dermal wound model. 9 SD rats were randomly divided into 3 groups of 3, 2 of which were experimental groups and 1 of which was control group, and anesthetized by intraperitoneal injection of chloral hydrate (10 wt%) (0.5mL/100 g). Under sterile conditions, after shaving and conventional sterilization of the back, a 1.0X 1.0cm midline was created²Size skin was excised as a wound. The 2 experimental groups were treated with gauze and CHRD powder for repair treatment,wherein the gauze group was wound with sterile gauze (gauze was changed every 3 days) and the CHRD group was applied evenly to the wound with CHRD powder (dressing was changed every 3 days). The control group had exposed wounds after hemostasis with sterile gauze, was raised in sterile environment, and the healing process of the wound surface was observed. SD rats in the experimental group and the control group are kept in an environment with temperature of 22 ℃ and humidity of 50-60% and are normally fed. Wound repair was recorded and the rate of skin wound healing was calculated by taking pictures on days 7, 10, 14, and 21 post-traumatic. Skin wound healing rate (%) × (skin healing area/total skin wound area) × 100%. The skin wound healing rate of each group was the average of the skin wound healing rates of 3 rats in this group.

The results are shown in table 1, for the skin wound of rats alone, the repair effect of CHRD group > gauze group > blank group. The CHRD group healed 70.38% of the skin wounds on day 7 after wounding and the skin wounds healed completely on day 21. Compared with the gauze group, the wound healing speed of the CHRD group is improved by about 30 percent.

TABLE 1 CHRD protein effect on healing of skin wounds of rats alone

2. Radiation combined evaluation of healing effect of skin wound

Male SD rats with the weight of 250-300g were selected for the experiment. 9 SD rats were randomly divided into 3 groups of 3, 2 of which were experimental groups and 1 of which was control group, and anesthetized by intraperitoneal injection of chloral hydrate (10 wt%) (0.5mL/100 g). Under sterile conditions, after shaving and conventional sterilization of the back, a 1.0X 1.0cm midline was created²Size of skin excision wound, creation of a back full-dermis wound model, irradiation of the skin excision wound with β rays (1.5Gy), establishment of a radiation-compounded wound model 2 experimental groups were subjected to repair therapy with gauze and CHRD powder, respectively, wherein the gauze group wrapped the wound with sterile gauze (gauze was changed every 3 days), the CHRD group was uniformly applied to the wound with CHRD powder (dressing was changed every 3 days), the control group exposed the wound after hemostasis with sterile gauze,feeding in sterile environment, and observing wound healing process. SD rats in the experimental group and the control group are kept in an environment with temperature of 22 ℃ and humidity of 50-60% and are normally fed. Wound repair was recorded by taking photographs on days 7, 10, 14, and 21 post-traumatic. Skin wound healing rate (%) × (skin healing area/total skin wound area) × 100%. The skin wound healing rate of each group was the average of the skin wound healing rates of 3 rats in this group.

The results are shown in table 2, the repair speed of the skin wound of the rat is reduced after the skin wound is irradiated, the CHRD protein has the same obvious effect of promoting the healing of the skin wound combined with irradiation, and the repair effect of the CHRD group is greater than that of the gauze group and that of the blank group. The CHRD group has 97.36% of skin wound healing on the 21 st day after trauma, and compared with the gauze group, the wound healing speed is improved by about 30%.

TABLE 2 CHRD proteins for the treatment of radiation in rats in combination with healing of skin wounds

Group of	7 days	14 days	21 days
				Control group	15.99％	35.03％	55.17％
Gauze group	30.09％	45.14％	67.34％
				CHRD group	55.18％	79.98％	97.36％

Example 3 evaluation of biological safety of CHRD proteins

Toxicity of CHRD protein on mouse fibroblast L929 (cell bank of the China academy of sciences type culture Collection) was studied using the MTT method to evaluate the biological safety of CHRD protein. Mouse fibroblast cells L929 were cultured at 1X 10⁴Concentration/well was inoculated into DMEM medium (beijing solibao) in 96-well plates. Five experimental groups and one control group were set, and each group was provided with three duplicate wells. After culturing the cells at 37 ℃ for 24 hours, CHRD protein was added to the wells of the experimental groups so that the final CHRD protein concentrations of the five experimental groups were 50mg/L, 100mg/L, 200mg/L, 400mg/L, and 800mg/L, respectively. Control group did not contain CHRD protein. Culturing is continued for 24h at 37 ℃, and then the number of living cells is detected by using an MTT method, and the steps are as follows: mu.l of MTT solution (5mg/ml) was added to each well and incubation was continued at 37 ℃ for 4 h. Centrifuging at 1000rpm for 10min, carefully sucking off the supernatant, adding 100 μ l dimethyl sulfoxide (Beijing Solibao) into each well, and shaking on a shaker at low speed for 10min to dissolve the crystals completely. The absorbance of each well was then measured in an enzyme linked immunosorbent assay OD570nm (630nm calibration).

The cell viability was calculated using the measured absorbance values. The calculation method comprises the following steps: treatment absorbance/control absorbance x 100%. Cell viability for each group was the average of cell viability for the three replicate wells of the group. When the cell survival rate of the control group is plotted as 100%, the results are shown in FIG. 3, and the cells show higher survival rate after adding CHRD protein in the concentration range of 50-800mg/L, which proves that the CHRD protein has good biocompatibility.

Sequence listing

<110> Chongqing university of medical science

<120> tissue repair protein CHRD and application thereof

<130>P1931435-CQD-CQ

<141>2020-01-22

<160>3

<170>SIPOSequenceListing 1.0

<210>1

<211>572

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Ser Ser Gly Val Asp Leu Gly Thr Glu Asn Leu Tyr Phe Gln Ser

1 5 10 15

Asn Ala Met Ser Asp Ser Glu Val Asn Gln Glu Ala Lys Pro Glu Val

20 25 30

Lys Pro Glu Val Lys Pro Glu Thr His Ile Asn Leu Lys Val Ser Asp

35 40 45

Gly Ser Ser Glu Ile Phe Phe Lys Ile Lys Lys Thr Thr Pro Leu Arg

50 55 60

Arg Leu Met Glu Ala Phe Ala Lys Arg Lys Lys Met Lys Gly Val Gln

65 70 75 80

Leu Lys Leu Glu Gln Gly Ala Leu Glu Glu Gln Cys Ala Thr Tyr Glu

85 90 95

Ala Gly Cys Tyr Arg Asn His Val His Leu Gln Leu Leu Glu His Gln

100 105 110

Glu Thr Glu Phe Ser Ala Lys Met Ile Ser Gln Leu Glu Ser Arg Gln

115 120 125

Lys Glu Gln Gly Leu Thr Asp Gly Glu Leu Lys Glu Ala Gln Gln Thr

130 135 140

Pro Glu Tyr Leu Lys Asn Val Ser Leu Arg Ala Leu Gln Asp Glu Leu

145 150 155 160

Cys Leu Ser Leu Ser Gln Met Arg Glu Arg Ser Glu Arg Val Asn Leu

165 170 175

Glu Glu Asp Ser Gln Leu Ala Arg Arg Ala Val Arg Glu Gln Leu Thr

180 185 190

Ser Leu Cys Ser Ala Ala Glu Arg Ala Ile Gln Asp Glu Glu Pro Gln

195 200 205

Lys Ser Arg Val Gln Ala Cys Glu Leu Thr Val Ala Asp Gln Glu Ser

210 215 220

Gln Gly Cys Leu Ser Arg Ala Gly Glu Glu Gln Cys Glu Thr Glu Arg

225 230 235 240

Leu Leu Lys Glu Gln Thr Pro Ser Leu Ser Ala Gln Cys Ala Val Glu

245 250 255

Glu Gln Ser Ser Arg Ala Lys Ser Leu Lys Ala Asn Ala Gln Asn Leu

260265 270

Phe Asp Thr Leu Glu Ser Thr Arg Gln Gly Lys Glu Met Asp Ser Leu

275 280 285

Arg Phe Leu Tyr Asp Gly Ile Arg Ile Gln Ala Asp Gln Thr Pro Glu

290 295 300

Asp Leu Asp Met Glu Asp Asn Asp Ile Ile Glu Ala His Arg Glu Gln

305 310 315 320

Ile Gly Gly Met Leu Leu Ala Leu Tyr Glu Lys Glu Glu Leu Asn Thr

325 330 335

Glu Leu Glu Leu Ala Glu Ala Gln Leu Asn Ile Pro Ser Met Thr Pro

340 345 350

Gln Cys Leu Ser Met Ser Cys Lys Val Glu Val Leu Ala His Leu Gln

355 360 365

Glu Leu Glu Arg Leu Phe Gln Tyr Tyr Glu Ile Ser Met Asp Thr Ala

370 375 380

Cys Gly Thr Met Leu Gln Arg Asn Leu Ala Met Asn Ala Leu Ala Leu

385 390 395 400

Thr Cys Ala Leu Gln Gln Thr Ser Ala Arg Val Asn Ser Glu Tyr Thr

405 410 415

Ala Asn Ser Ile Glu Gln Val Ala Met Ser Met Pro Tyr Ala Ala Asn

420425 430

Arg Tyr Lys Met Gln Cys Glu Met Gly Lys Glu Asp Asn Ser Leu Ser

435 440 445

Val Asn Leu Lys Glu Gln Ser Met Cys Ser Val Phe Thr Arg Ile Lys

450 455 460

Arg Leu Glu Asp Thr Leu Glu Glu Asn Glu Cys Leu Gln Glu Gln Gln

465 470 475 480

Val Glu Thr Thr Arg Ser Lys Glu Ile Gly Glu Leu Gly Ile Glu Glu

485 490 495

Glu Ser Leu Ala His Arg Thr Leu Ser Leu Asn Glu Leu Asp Glu Ser

500 505 510

Glu Ala Glu Asp Lys Asn Tyr Val Arg His Ala Gln Val Gln Glu Asp

515 520 525

Val Asp Arg Glu Ile Ala Asp Leu Ile Met Ala Ser Asp Glu Gln His

530 535 540

Ala Cys Thr Ser Lys Cys Ser Glu Cys Met Gln Glu Glu Ala Leu His

545 550 555 560

Ala Ala Cys Thr Val Thr His His His His His His

565 570

<210>2

<211>1719

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgagcagcg gcgtggatct gggcaccgaa aacctgtatt ttcagagcaa cgcgatgagc 60

gatagcgaag tgaaccagga agcgaaaccg gaagtgaaac cggaagtgaa accggaaacc 120

catattaacc tgaaagtgag cgatggcagc agcgaaattt tttttaaaat taaaaaaacc 180

accccgctgc gccgcctgat ggaagcgttt gcgaaacgca aaaaaatgaa aggcgtgcag 240

ctgaaactgg aacagggcgc gctggaagaa cagtgcgcga cctatgaagc gggctgctat 300

cgcaaccatg tgcatctgca gctgctggaa catcaggaaa ccgaatttag cgcgaaaatg 360

attagccagc tggaaagccg ccagaaagaa cagggcctga ccgatggcga actgaaagaa 420

gcgcagcaga ccccggaata tctgaaaaac gtgagcctgc gcgcgctgca ggatgaactg 480

tgcctgagcc tgagccagat gcgcgaacgc agcgaacgcg tgaacctgga agaagatagc 540

cagctggcgc gccgcgcggt gcgcgaacag ctgaccagcc tgtgcagcgc ggcggaacgc 600

gcgattcagg atgaagaacc gcagaaaagc cgcgtgcagg cgtgcgaact gaccgtggcg 660

gatcaggaaa gccagggctg cctgagccgc gcgggcgaag aacagtgcga aaccgaacgc 720

ctgctgaaag aacagacccc gagcctgagc gcgcagtgcg cggtggaaga acagagcagc 780

cgcgcgaaaa gcctgaaagc gaacgcgcag aacctgtttg ataccctgga aagcacccgc 840

cagggcaaag aaatggatag cctgcgcttt ctgtatgatg gcattcgcat tcaggcggat 900

cagaccccgg aagatctgga tatggaagat aacgatatta ttgaagcgca tcgcgaacag 960

attggcggca tgctgctggc gctgtatgaa aaagaagaac tgaacaccga actggaactg 1020

gcggaagcgc agctgaacat tccgagcatg accccgcagt gcctgagcat gagctgcaaa 1080

gtggaagtgc tggcgcatct gcaggaactg gaacgcctgt ttcagtatta tgaaattagc 1140

atggataccg cgtgcggcac catgctgcag cgcaacctgg cgatgaacgc gctggcgctg 1200

acctgcgcgc tgcagcagac cagcgcgcgc gtgaacagcg aatataccgc gaacagcatt 1260

gaacaggtgg cgatgagcat gccgtatgcg gcgaaccgct ataaaatgca gtgcgaaatg 1320

ggcaaagaag ataacagcct gagcgtgaac ctgaaagaac agagcatgtg cagcgtgttt 1380

acccgcatta aacgcctgga agataccctg gaagaaaacg aatgcctgca ggaacagcag 1440

gtggaaacca cccgcagcaa agaaattggc gaactgggca ttgaagaaga aagcctggcg 1500

catcgcaccc tgagcctgaa cgaactggat gaaagcgaag cggaagataa aaactatgtg 1560

cgccatgcgc aggtgcagga agatgtggat cgcgaaattg cggatctgat tatggcgagc 1620

gatgaacagc atgcgtgcac cagcaaatgc agcgaatgca tgcaggaaga agcgctgcat 1680

gcggcgtgca ccgtgaccca tcatcatcat catcattga 1719

<210>3

<211>1728

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

catatgagca gcggcgtgga tctgggcacc gaaaacctgt attttcagag caacgcgatg 60

agcgatagcg aagtgaacca ggaagcgaaa ccggaagtga aaccggaagt gaaaccggaa 120

acccatatta acctgaaagt gagcgatggcagcagcgaaa ttttttttaa aattaaaaaa 180

accaccccgc tgcgccgcct gatggaagcg tttgcgaaac gcaaaaaaat gaaaggcgtg 240

cagctgaaac tggaacaggg cgcgctggaa gaacagtgcg cgacctatga agcgggctgc 300

tatcgcaacc atgtgcatct gcagctgctg gaacatcagg aaaccgaatt tagcgcgaaa 360

atgattagcc agctggaaag ccgccagaaa gaacagggcc tgaccgatgg cgaactgaaa 420

gaagcgcagc agaccccgga atatctgaaa aacgtgagcc tgcgcgcgct gcaggatgaa 480

ctgtgcctga gcctgagcca gatgcgcgaa cgcagcgaac gcgtgaacct ggaagaagat 540

agccagctgg cgcgccgcgc ggtgcgcgaa cagctgacca gcctgtgcag cgcggcggaa 600

cgcgcgattc aggatgaaga accgcagaaa agccgcgtgc aggcgtgcga actgaccgtg 660

gcggatcagg aaagccaggg ctgcctgagc cgcgcgggcg aagaacagtg cgaaaccgaa 720

cgcctgctga aagaacagac cccgagcctg agcgcgcagt gcgcggtgga agaacagagc 780

agccgcgcga aaagcctgaa agcgaacgcg cagaacctgt ttgataccct ggaaagcacc 840

cgccagggca aagaaatgga tagcctgcgc tttctgtatg atggcattcg cattcaggcg 900

gatcagaccc cggaagatct ggatatggaa gataacgata ttattgaagc gcatcgcgaa 960

cagattggcg gcatgctgct ggcgctgtat gaaaaagaag aactgaacac cgaactggaa 1020

ctggcggaag cgcagctgaa cattccgagc atgaccccgc agtgcctgag catgagctgc 1080

aaagtggaag tgctggcgca tctgcaggaa ctggaacgcc tgtttcagta ttatgaaatt 1140

agcatggata ccgcgtgcgg caccatgctg cagcgcaacc tggcgatgaa cgcgctggcg 1200

ctgacctgcg cgctgcagca gaccagcgcg cgcgtgaaca gcgaatatac cgcgaacagc 1260

attgaacagg tggcgatgag catgccgtat gcggcgaacc gctataaaat gcagtgcgaa 1320

atgggcaaag aagataacag cctgagcgtg aacctgaaag aacagagcat gtgcagcgtg 1380

tttacccgca ttaaacgcct ggaagatacc ctggaagaaa acgaatgcct gcaggaacag 1440

caggtggaaa ccacccgcag caaagaaatt ggcgaactgg gcattgaaga agaaagcctg 1500

gcgcatcgca ccctgagcct gaacgaactg gatgaaagcg aagcggaaga taaaaactat 1560

gtgcgccatg cgcaggtgca ggaagatgtg gatcgcgaaa ttgcggatct gattatggcg 1620

agcgatgaac agcatgcgtg caccagcaaa tgcagcgaat gcatgcagga agaagcgctg 1680

catgcggcgt gcaccgtgac ccatcatcat catcatcatt gactcgag 1728

Claims

1. A protein which is a protein of a1 or a2 as follows:

2. A gene encoding the protein of claim 1.

3. The encoding gene of claim 2, wherein: the coding gene is a DNA molecule of b1 or b2 as follows:

4. An expression cassette, vector or recombinant bacterium comprising the coding gene of claim 2 or 3.

5. Use of a protein according to claim 1 for the preparation of a topical preparation for skin wound repair.

6. A topical preparation for dermal wound repair comprising the protein of claim 1.

7. The topical preparation according to claim 6, further comprising an excipient useful in skin wound repair.

8. The topical preparation according to claim 6, wherein the topical preparation is in the form of a powder, gel, cream or cream.

9. The external preparation according to any one of claims 6 to 8, wherein the protein is present in the external preparation in a mass fraction of 10% to 100%.

10. A method of preparing a topical preparation for skin wound repair, comprising the steps of: introducing the coding gene of claim 2 or 3 into an expression host bacterium to obtain a recombinant bacterium; culturing recombinant bacteria, inducing protein expression, collecting bacteria, extracting and purifying protein.