CN111299568B

CN111299568B - Method for quickly modifying nanogold through polyA-mediated nucleic acid ligand

Info

Publication number: CN111299568B
Application number: CN202010083484.6A
Authority: CN
Inventors: 程潇羽; 何赛灵; 叶杨
Original assignee: Zhejiang University ZJU
Current assignee: Zhejiang University ZJU
Priority date: 2020-02-09
Filing date: 2020-02-09
Publication date: 2021-11-30
Anticipated expiration: 2040-02-09
Also published as: CN111299568A

Abstract

The invention discloses a method for quickly modifying nanogold by using a polyA-mediated nucleic acid ligand. The method comprises the following steps: 1) heating a nucleic acid ligand with a 3 'or 5' end polyA sequence at 95 ℃ and then unfolding; 2) mixing with nano gold, and freezing the mixed solution at low temperature; 3) and unfreezing the frozen nucleic acid ligand nano-gold system at room temperature to obtain the nucleic acid modified gold nano-particles. The method is rapid, efficient and economical, avoids the use of nucleic acid ligand with sulfhydryl group and the addition of extra reagent, simplifies the nucleic acid ligand modification steps of the gold nanoparticles, improves the efficiency, reduces the cost and greatly shortens the modification time.

Description

Method for quickly modifying nanogold through polyA-mediated nucleic acid ligand

Technical Field

The invention relates to the field of gold nano materials, in particular to a nucleic acid modification method of gold nanospheres and gold nanorods.

Background

Gold nanoparticles are the most typical colloidal nanoparticles, and the unique optical characteristics of the gold nanoparticles enable the gold nanoparticles to be widely applied to nano-biophotonics, which is a typical representative of the application of nano-technology in biological systems.

Gold nanoparticles comprise many different nanostructures, among which gold nanospheres and gold nanorods are common. The synthesis of gold nanospheres is known as a sodium citrate reduction method which is completed by Frens in 1973, in the method, sodium citrate is used as a reducing agent to reduce gold ions and is also used as a surface stabilizer of the gold nanospheres, and the stable gold nanospheres with the size of 10-150nm are synthesized by controlling the proportion of sodium citrate and chloroauric acid. The synthesis of gold nanorods was first proposed by the U.S. El-Sayed and Murphy laboratories, and the photoelectric characteristics of the gold nanorods were adjusted by obtaining the gold nanorods with different sizes and length-diameter ratios through CTAB (cetyl trimethyl ammonium bromide) mediated seed growth by generally adopting a seed growth method.

The surface interface behavior has a key effect on the colloidal stability of the gold nanoparticle aqueous solution. The dispersion stability of nanoparticles varies depending on the surfactant thereof. Sodium citrate is used as a surfactant, so that the gold nanospheres coated by the sodium citrate are easy to aggregate, and CTAB is used as a surfactant, so that the sodium citrate is more stable, but also shows certain biological toxicity. Therefore, the gold nanospheres coated with sodium citrate and the gold nanorods coated with CTAB are sometimes required to be further modified, so that the stability of the particles in an aqueous solution is improved, the biotoxicity of the particles is reduced, and a foundation is provided for subsequent biological application. Among various ligands for modifying gold nanoparticles, nucleic acids (hereinafter, DNA is taken as an example) can be assembled not only by base complementary pairing, but also can be used as probes of complementary sequences and interact with targets such as metal ions, small molecules and proteins, and the DNA modification of gold nanoparticles has important significance in various applications such as self-assembly nanoparticles, gene therapy, biosensing, cell targeting, drug loading and the like.

The traditional method of gold nanoparticle DNA modification was the salt aging method first proposed by the Mirkin group. In the method, the sulfydryl (-SH) modified DNA and the surface of the gold nanoparticle form Au-S bond for ligand adsorption. Thiol modification has two problems: firstly, DNA with sulfhydryl groups has high cost and is often several times of nucleic acid without modification; secondly, the disulfide bond is generally required to be opened by a reducing agent when the catalyst is used, so that the operation process is more complicated. Aiming at the two problems, a preparation method of a polyA-mediated nanogold probe is provided in 2012 by Shanghai applied physical research institute of Chinese academy of sciences, and the basic principle is that DNA Adenine nucleotide (Adenine) has strong adhesion to the surface of gold, a section of continuous polyA sequence is designed at the tail end of DNA to serve as a binding region with the surface of a gold nanosphere, and modification is carried out without adding sulfydryl. However, the method still continues to use the salt aging method, and needs to slowly increase the salt concentration in the solution, and the proper salt concentration is utilized to play a role in charge shielding, so that the electrostatic repulsion among DNA molecules is reduced, and the adsorption and combination of the DNA molecules on the surface of the gold nanospheres are promoted. However, the change of the salt concentration is difficult to control, and operations such as ultrasound, vortex, oscillation and the like are required to be assisted to prevent the problem of instantaneous coagulation of the gold nanospheres caused by rapid increase of the local salt concentration. The whole process generally needs at least 24 hours to complete, and still faces the problems of long time consumption, complex operation and the like. In addition, due to the existence of a CTAB bilayer with a compact surface of the gold nanorod, the DNA modification of the gold nanorod is more difficult, and at present, no effective method for modifying the gold nanorod exists, although salt aging method, acid method and ligand exchange method are provided, the methods have the problems of complex process, addition of other chemical reagents and the like.

Disclosure of Invention

Aiming at the problems that the modification of nucleic acid ligands by existing gold nanoparticles is time-consuming and tedious, the invention aims to provide a method for quickly modifying nanogold by using polyA-mediated nucleic acid ligands, which is quick, simple and efficient.

A method for quickly modifying nano-gold by a polyA-mediated nucleic acid ligand,

1) heating a nucleic acid ligand with a 3 'or 5' end polyA sequence at 95 ℃ and then unfolding;

2) mixing with nano gold, and freezing the mixed solution at low temperature;

3) and unfreezing the frozen nucleic acid ligand nano-gold system at room temperature to obtain the nucleic acid modified gold nano-particles.

The nucleic acid ligand comprises DNA or RNA.

The polyA sequence is 5-30 bases.

The nano gold comprises gold nanospheres or gold nanorods; the gold nanospheres are prepared by adopting a chloroauric acid-sodium citrate reduction method; the gold nanorods are prepared by a CTAB seed growth method.

In the step 2), the low temperature is below-20 ℃, and the freezing time is 5 minutes to 2 hours.

In the step 3), the nucleic acid ligand nano-gold system is thawed at room temperature and then centrifuged to remove free excess nucleic acid in the solution.

The gold nanospheres are resuspended by adopting a PBS solution, the concentration of the resuspended gold nanospheres is 1-10nmol/L, the concentration of the used nucleic acid ligand is 100 mu mol/L, and the mass ratio of the nucleic acid ligand to the gold nanospheres is 200:1-1000: 1.

The gold nanorods are resuspended by water or CTAB solution, the concentration of the CTAB solution is not more than 80 mu mol/L, the concentration of the gold nanorods after the resuspension is 1-10nmol/L, the concentration of the used nucleic acid ligand is 100 mu mol/L, and the mass ratio of the nucleic acid ligand to the gold nanorods is 800:1-1600: 1.

Technical effects of the invention

Compared with the prior art, the invention has the advantages that:

(1) compared with the most common method for adsorbing the DNA modified by the sulfydryl (-SH) and the Au-S bond on the surface of the gold nanoparticle, the method gets rid of the dependence of the DNA modification on the sulfydryl, thereby greatly reducing the cost. And thiol-modified DNA usually requires strong reducing agents to open disulfide bonds during use, not only requiring additional treatment for as long as two or more hours, but also purification of reduced DNA may bring about introduction of impurities, loss of DNA products, and additional treatment costs. The DNA of the polyA sequence used by the invention effectively avoids a series of problems of sulfhydryl DNA, does not need additional reagent, and is very simple and easy to use.

(2) Compared with the preparation method of the polyA-mediated nanogold compound provided by the Yanchunhai topic group, the method provided by the invention avoids a salt aging process for 32 hours by freezing, is extremely short in time consumption, does not need to add an additional reagent, is simple in operation method, and has the advantages of rapidness and economy.

(3) Compared with the preparation method of the polyA-mediated gold nanoparticle compound provided by the Yanchunhai topic group, the DNA modified gold nanospheres obtained by the method provided by the invention have higher surface DNA density, namely higher DNA modification efficiency.

(4) Compared with other gold nanorod modification methods, the method has the advantages of being fast, efficient and economical, and good in repeatability and stability.

Drawings

FIG. 1 is an electron microscope representation of gold nanorods.

FIG. 2 is a quantitative representation of the DNA number on the surface of gold nanospheres modified by the present invention, which is much higher than that of the gold nanospheres modified by the present invention in the case of a long polyA sequence compared to the method of the Gonghai.

FIG. 3 is the ultraviolet-visible light extinction spectrum of the modified gold nanorods.

Detailed Description

In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention. For example, in the following examples, DNA is used as the nucleic acid ligand, and it is obvious to those skilled in the art that RNA can be easily modified as the nucleic acid ligand.

Example 1 Synthesis of gold nanospheres

Adding 0.2mL of 25mM chloroauric acid aqueous solution into 10mL of deionized water, stirring and heating to the temperature of the reaction solution of 95 ℃, adding 10mL of sodium citrate aqueous solution with different concentrations, and carrying out chemical reaction on the solution to generate color change. When the color change of the solution stops (-30 min), stopping heating and continuing stirring until the solution is slowly cooled to room temperature. The synthesis conditions for gold nanospheres of different sizes are shown in table 1.

TABLE 1 Synthesis conditions for gold nanospheres of different sizes

Concentration of sodium citrate	3mM	2mM	1.5mM	0.4mM
					Diameter of gold nanosphere	8nm	15nm	30nm	60nm

EXAMPLE 2 Synthesis of gold nanorods

Firstly, synthesizing gold seeds required by the growth of gold nanorods: to 10mL of a 0.1M aqueous CTAB solution was added 100. mu.L of a 25mM chloroauric acid solution, and 600. mu.L of a10 mM ice (0 ℃) sodium borohydride solution was rapidly added in a 25 ℃ water bath, rapidly stirred for 2 minutes and then left to stand for 30 minutes to decompose the excess sodium borohydride. After preparing a fresh seed solution, adding 200 mu L of 25mM chloroauric acid solution, 1.5mL of 10mM silver nitrate solution and 800 mu L of 100mM vitamin C solution into 100mL of 0.1M CTAB aqueous solution at room temperature, uniformly stirring, adding 100 mu L of seed solution, and standing overnight to obtain the gold nanorods. The morphology of the prepared gold nanorods is shown in figure 1.

Example 3 DNA cryomodification and quantification of gold nanospheres

1mL of the gold nanosphere solution with the size of 15nm synthesized in example 1 is taken, centrifuged for 15min at 14000rpm, supernatant is removed, and then the gold nanosphere solution is resuspended in 100 μ L of deionized water, and then 6 μ L of 100 μ M DNA solution to be modified after being stretched at 95 ℃ is added, wherein the DNA sequence adopted in the example is polyA-TTTTTATGATGTTCGTTGTG-FAM, wherein polyA represents a polyA sequence with a certain length, and the polyA represents A5, A10, A15, A20 and TTTTTATGATGTTCGTTGTG represent a specific DNA probe sequence, and the FAM is a fluorescent group for subsequent fluorescence quantification. After ultrasonic mixing, the mixture was frozen in a refrigerator at-20 ℃ for two hours. And after the solution is completely frozen, thawing at room temperature, and carrying out heavy suspension three times by using a PBS solution to obtain the DNA modified gold nanosphere. And adding mercaptoethanol into the PBS heavy suspension to enable the final concentration of the mercaptoethanol to reach 20mM, and after incubating overnight at room temperature, substituting DNA on the surfaces of the gold nanospheres with the mercaptoethanol to enable the gold nanospheres to agglomerate and the solution to be colorless. The supernatant was obtained by centrifugation at 14000rpm for 15min and the fluorescence intensity thereof was measured. The concentration of the DNA modified on the gold nanospheres can be obtained by comparing the standard working curve of the fluorescence intensity and concentration of the DNA in the supernatant, and the number of the DNA modified on the surface of a single gold nanosphere is shown in FIG. 2.

Example 4 DNA Freeze modification of gold nanorods

1mL of the gold nanorod solution synthesized in example 2 was centrifuged at 9600rpm for 15min, the supernatant was removed, and after resuspension three times with aqueous solutions of CTAB of different concentrations, 6. mu.L of 100. mu.M DNA solution to be modified, which had been heated and stretched, was added, and the DNA sequence used in this example was AAAAAAAAAA TTTTTATGATGTTCGTTGTG. After ultrasonic mixing, the mixture was frozen in a refrigerator at-20 ℃ for two hours. After the solution was completely frozen, thawed at room temperature, centrifuged and resuspended in water to remove excess DNA. The UV-visible absorption spectrum of the gold nanorods after freezing modification is shown in FIG. 3. As can be seen from the figure, the gold nanorods after freezing modification still have two obvious surface plasma resonance peaks, which shows that DNA is effectively modified to the surface of the gold nanorods, thereby protecting the gold nanorods from aggregation in the freezing process. And the slight red shift of the longitudinal surface plasmon resonance peak of longer wavelength corresponds to the medium refractive index change caused by the DNA on the surface of the gold nanorod.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Claims

1. A method for quickly modifying nano-gold by a polyA-mediated nucleic acid ligand is characterized in that,

2) mixing with nano gold, and freezing the mixed solution at low temperature; the low temperature is below-20 ℃, and the freezing time is 5 minutes to 2 hours;

2. The method of claim 1, wherein said nucleic acid ligand comprises DNA or RNA.

3. The method of claim 1, wherein the polyA sequence is between 5 bases and 30 bases.

4. The method of claim 1, wherein the nanogold comprises gold nanospheres or gold nanorods; the gold nanospheres are prepared by adopting a chloroauric acid-sodium citrate reduction method; the gold nanorods are prepared by a CTAB seed growth method.

5. The method as claimed in claim 1, wherein in the step 3), the nucleic acid ligand nanogold system is thawed at room temperature and then centrifuged to remove free excess nucleic acid in the solution.

6. The method of claim 4, wherein the gold nanospheres are resuspended in deionized water, the concentration of the resuspended gold nanospheres is 1-10nmol/L, the concentration of the nucleic acid ligand used is 100 μmol/L, and the mass ratio of the nucleic acid ligand to the gold nanospheres is 200:1-1000: 1.

7. The method of claim 4, wherein the gold nanorods are resuspended using water or a CTAB solution, the concentration of the CTAB solution is not more than 80 μmol/L, the concentration of the gold nanorods after resuspension is 1-10nmol/L, the concentration of the nucleic acid ligand used is 100 μmol/L, and the mass ratio of the nucleic acid ligand to the gold nanorods is 800:1-1600: 1.