CN111278974B

CN111278974B - Hook probe, nucleic acid ligation method, and method for constructing sequencing library

Info

Publication number: CN111278974B
Application number: CN201780096314.8A
Authority: CN
Inventors: 江媛; 席阳; 章文蔚; 刘鹏娟; 赵霞; 李巧玲; 沈寒婕; 张永卫; 拉多杰·德马纳克
Original assignee: MGI Tech Co Ltd
Current assignee: MGI Tech Co Ltd
Filing date: 2017-11-09
Publication date: 2024-06-11
Anticipated expiration: 2037-11-09

Abstract

The invention provides a hook probe, a nucleic acid ligation method and a method of constructing a sequencing library, the hook probe comprising a target specific region and a ligated hook region, the target specific region comprising a sequence complementary to and pairing with at least part of a single strand of a nucleic acid fragment to be ligated, the hook region comprising a sequence unpaired with the nucleic acid fragment, the end of the hook region being a ligatable end, the ligatable end being capable of ligating to a single stranded end of the nucleic acid fragment.

Description

Hook probe, nucleic acid ligation method, and method for constructing sequencing library

Technical Field

The invention relates to the technical field of molecular biology, in particular to a hook-shaped probe, a nucleic acid connection method and a sequencing library construction method.

Background

High throughput sequencing technology is a revolutionary change to traditional sequencing, and hundreds of thousands to millions of DNA molecules are sequenced at a time to carefully analyze the transcriptome and genome of a species to find genes or gene mutation sites associated with phenotypes, providing a theoretical basis for scientific research and application. High throughput sequencing libraries are collections of amplified DNA or cDNA sequence fragments formed by adding known synthetic sequences to fragmented DNA or RNA through a series of biochemical reactions. The added known synthetic sequences, commonly referred to as adaptors, function primarily to amplify the library and provide for hybridization of the complementary sequences to the sequencing primers. The basic flow of library construction generally includes steps of nucleic acid extraction, nucleic acid fragmentation (no fragmentation is required if free DNA), fragmented nucleic acid end repair, modification, adaptor ligation, fragment amplification, or no amplification. The library construction process is slightly different based on the basic process according to different research purposes and different initial sample types, for example, the library construction of free DNA is not required to break the DNA, the library construction of RNA is required to carry out additional treatment of reverse transcription into cDNA, the library construction of a target region is required to adopt a hybridization or amplification method to enrich the sequence of the target region from the DNA or the RNA, and the like.

In recent 10 years, the cost of high-throughput sequencing is rapidly reduced in a mode of superMoore's law, so that the high-throughput sequencing is expanded from the scientific research field to more fields such as clinical detection and the like, and a novel and reliable detection method is provided for precise medical treatment. The DNA, RNA, cfDNA, ctDNA target region sequencing technology only needs to carry out high-depth sequencing on the gene of interest, has the advantages of more detection sites, large sample flux, low economic cost, higher detection sensitivity and the like, and is widely applied to disease diagnosis and targeted drug treatment. The library construction and sequencing technology with high efficiency, high speed, accuracy, reliability and low price is provided, and the method is a key break for high-throughput sequencing applied to accurate medical treatment.

The main library construction technology for enriching the target area is divided into two types, namely a solid phase hybridization technology and a liquid phase hybridization technology based on a probe hybridization technology, and the wide application of the liquid phase hybridization technology is realized at present, such as an RNA probe liquid phase hybridization technology of Agilent company, a DNA probe liquid phase hybridization technology of Roche NimbleGen company and a transposase breaking combined DNA probe liquid phase hybridization technology of Illumina company. The second category is based on amplification techniques, which are divided into single pair post-amplification mixed libraries (pooling) and multiplex amplification techniques, and currently, multiplex amplification techniques, such as Life Technologies Ion Torrent AmpliSeq multiplex PCR techniques, are widely used.

The probe liquid phase hybridization capture technology is very suitable for a high-throughput sequencing library establishment process requiring highly parallelized sample preparation. This technique utilizes blocking nucleic acids such as Cot-1 DNA and/or sequence-specific blocking oligonucleotides to reduce non-specific hybridization and enhance the specificity of the hybridization reaction between the probe and the sample nucleic acid. However, the usual hybridization capture methods require very long hybridization times to reach equilibrium and/or to achieve efficient capture and enrichment of target nucleic acids. Even so, the method still has at least about 40% contamination of the non-target area. Furthermore, there is also a risk of random loss of the target sequence during hybridization, washing, elution, or reactions upstream (e.g., linker ligation) or downstream (e.g., binding of biotin-labeled hybridization complexes to streptavidin magnetic beads) of the hybridization step. In addition, reagents (e.g., probes, blocking reagents, streptavidin magnetic beads, etc.) used in this method are expensive and have a low cost and space for reduction.

The multiplex PCR technology can more efficiently and specifically enrich the target region sequence, has lower cost than the probe liquid phase hybridization capture technology, but is not beneficial to enriching the target region of small fragment cfDNA which is naturally fragmented.

Disclosure of Invention

The invention provides a hook probe, a nucleic acid connection method and a sequencing library construction method, wherein the hook probe can be used for adding a section of tool known sequence to the single-chain end of a nucleic acid fragment to be connected, and the section of tool known sequence can be used for carrying out subsequent operation reaction, so that different applications can be realized.

According to a first aspect, the present invention provides a hook probe comprising a target specific region comprising a sequence complementary to and pairing with at least part of a single strand of a nucleic acid fragment to be ligated, and an attached hook region comprising a sequence unpaired with the nucleic acid fragment, the ends of the hook region being ligatable ends capable of ligating to single stranded ends of the nucleic acid fragment.

According to a second aspect, the present invention provides a kit comprising a hook probe of the first aspect, optionally together with at least one ligase for ligating the ligatable end of the hook probe to the end of a nucleic acid fragment to be ligated.

According to a third aspect, the present invention provides the use of a hook probe of the first aspect in the construction of a nucleic acid sequencing library.

According to a fourth aspect, the present invention provides a method of ligating nucleic acids, the method comprising: annealing and hybridizing the hook probe of the first aspect to the denatured nucleic acid fragment to be ligated; and ligating the ligatable end of the hook probe to the single-stranded end of the nucleic acid fragment in the presence of a ligase.

According to a fifth aspect, the present invention provides a method of constructing a nucleic acid sequencing library, the method comprising: annealing and hybridizing the hook probe of the first aspect to the denatured nucleic acid fragment to be ligated; and a step of ligating the ligatable end of the hook-shaped probe to the single-stranded end of the nucleic acid fragment in the presence of a ligase.

The hook-shaped probe provided by the invention can be used for realizing rapid hybridization and capturing of a nucleic acid fragment (such as a target nucleic acid fragment) to be connected through ingenious design and cooperation with ligase, and can be applied differently through the ingenious design and subsequent operation reaction by applying a section of tool known sequence.

In particular, the invention has wide applicable sample type range, wide applicable detection type and wide application field (not only limited to high-flux library construction, but also applicable to the fields of molecular cloning, synthetic biology and the like). The realization of the invention greatly simplifies the flow, shortens the time and saves the cost, breaks through the limitation of applicable sample types, is beneficial to various scientific research applications and kit packaging, and has very wide market potential and prospect.

Drawings

FIG. 1 shows a schematic composition of target-specific 5 'hook probes and 3' hook probes.

FIG. 2 shows a flow chart of a PCR protocol after hybridization ligation of double sided hook probes.

FIG. 3 shows a flow chart of a PCR (PCR-free) unnecessary protocol after hybridization ligation of double-sided hook probes.

FIG. 4 shows a flow chart of one scheme of PCR/no PCR after hybridization ligation of single-sided 3' hook probes.

FIG. 5 shows a flow chart of another scheme of PCR/no-PCR after hybridization ligation of single-sided 3' hook probes.

FIG. 6 shows a flow chart of a single sided 5' hook probe hybridization post ligation PCR/no PCR protocol.

FIG. 7 shows a flow chart of a single sided 3' hook probe hybridization ligation post PCR protocol.

FIG. 8 shows a 10% denaturing polyacrylamide gel (U-PAGE) gel of a single-stranded fragment of the target region nucleic acid (YJ-439) incubated with a target-specific 5' hook probe (YJ-765) at different reaction temperatures with CIRLIGASE I.

FIG. 9 shows a 10% U-PAGE gel of target region nucleic acid single-stranded fragment (YJ-439) incubated with a non-target specific 5 'hook probe (YJ-890) and a non-target specific 3' hook probe (YJ-891) at different reaction temperatures with CIRLIGASE I.

Fig. 10 shows a schematic diagram of sequence connections in a test example for verifying the basic principle.

FIG. 11 shows the result of polyacrylamide gel electrophoresis of a part of the product of example 1 of the present invention.

FIG. 12 shows the result of polyacrylamide gel electrophoresis of a part of the product of example 2 of the present invention.

FIG. 13 shows the distribution of sequencing reads on chromosome 10 in example 2 of the present invention, wherein A, B is the WGS control library and the negative control library, respectively; c is a double sided hook probe hybridization library, and the area indicated by two arrows in C is 2 ROIs enrichment areas.

FIG. 14 shows the case where the capturing read length and the target read length are respectively covered to the ROI area in example 2 of the present invention.

FIG. 15 shows the result of polyacrylamide gel electrophoresis of a part of the product of example 3 of the present invention.

Detailed Description

The invention will be described in further detail below with reference to the drawings by means of specific embodiments. In the following embodiments, numerous specific details are set forth in order to provide a better understanding of the present invention. However, one skilled in the art will readily recognize that some of the features may be omitted, or replaced by other elements, materials, or methods in different situations. In some instances, related operations of the present invention have not been shown or described in the specification in order to avoid obscuring the core portions of the present invention, and may be unnecessary to persons skilled in the art from a detailed description of the related operations, which may be presented in the description and general knowledge of one skilled in the art.

The invention provides a hook probe (or called a hook nucleic acid probe), which can rapidly capture a nucleic acid fragment and simultaneously add a linker by utilizing the basic principle of single-chain connection reaction between the hook probe and molecules, and provides a series of technical schemes based on the hook probe and the basic principle, including but not limited to oligonucleotide sequence compositions, enzyme and reagent components, reaction conditions, method steps and the like required for realizing the technical scheme.

The basic principle of the invention is as follows: under appropriate reaction conditions, a nucleic acid fragment, such as a single-stranded fragment of a target region nucleic acid (with a phosphate group at the 5 'end or a hydroxyl group at the 3' end) and a target-specific hook probe (with a phosphate group at the 5 'end or a hydroxyl group at the 3' end) with a partial sequence complementary to the single-stranded fragment of the target region nucleic acid form a hybridization complex whose proportion of products of intermolecular single-stranded ligation is higher than that of single-stranded circularization products within the single-stranded fragment of the target region nucleic acid under the catalysis of certain ligases. And the proportion of single-stranded intermolecular products formed between single-stranded fragments without complementary pairing region is extremely low.

The invention relates to the following basic concepts: hook probes, nucleic acid fragments (e.g., target region nucleic acid fragments), ligases. The present invention has at least one of the following advantages: the applicable template is not limited by the sample type, the hybridization time is fast, no additional joint step is needed, the flow is simple, the reaction time is short, the cost is low, and the application field is wide.

In one embodiment of the present invention, a hook probe is provided, the hook probe comprising a target specific region comprising a sequence complementary to at least a portion of a single strand of a nucleic acid fragment to be ligated, and an attached hook region comprising a sequence unpaired with the nucleic acid fragment, the end of the hook region being an ligatable end capable of ligating to a single strand end of the nucleic acid fragment.

Some basic concepts and specific definitions of their constituent elements are described in detail below.

1. Hook probe

The hook probe may be a 5 'hook probe or a 3' hook probe, and FIG. 1 is a schematic view of the hook probe. The Hook probe provided by embodiments of the present invention includes a target specific Region (TARGET SPECIFIC Region, TSR) and a Hook Region (Hook Region, HR). The sequence of the specific region of interest (i.e., the gene-specific binding site in FIG. 1) is complementarily paired with a sequence in the vicinity of the nucleic acid fragment (e.g., target sequence) to be ligated in the sample, performing a hybridization capture function. The hook region of the 5' hook probe may include a universal primer binding site, a unique molecular tag sequence, a sample tag sequence, a cell tag sequence, and other useful elements, or any combination thereof. Similarly, the hook region of the 3' hook probe may include a universal primer binding site, a unique molecular tag sequence, a sample tag sequence, a cell tag sequence, and other useful elements, or any combination thereof. In particular, the hook region can also be designed as a random sequence for use in a library-building scheme for non-sequence capture (e.g., whole genome library construction). The universal primer binding site of the hook probe can be involved in subsequent intermolecular ligation of hybridization complexes or PCR amplification of the hook ligation product or without PCR (PCR-free) pooling. Sample tag sequences and/or unique molecular tag sequences on the hook probes are used to identify different sample and/or target sequence fragments.

In some embodiments, the 5' hook probe has the following structure: 5'- (target specific area) - (hook area) -3'. Preferably, the 5' hook probe has the structure 5' - (target specific region) - (unique molecular tag and/or sample tag) - (universal primer binding site) -3'. In some embodiments, the 3' hook probe has the following structure: 5'- (hook area) - (target specific area) -3'. Preferably, the 3' hook probe has the structure 5' - (universal primer binding site) - (unique molecular tag(s) and/or sample tag) - (target specific region) -3'.

The biochemical component of the hook probe may be deoxyribonucleic acid, ribonucleic acid, or a mixture of deoxyribonucleic acid and ribonucleic acid.

1.1 Target Specific Region (TSR)

The target-specific region in the hook probe can be of any suitable length and sequence for target-specific hybridization with a target nucleic acid in a reaction mixture containing the target nucleic acid and a non-target nucleic acid. The specific region of interest is typically less than 200 nucleotides in length.

It should be noted that the specific region of interest is not specific for hybridization with the target nucleic acid, but is a specific example of an application of the specific region of interest. In other examples of application, the target specific region functions to hybridize to a sequence in the nucleic acid fragment to be ligated, so as to be able to ligate to the end of the nucleic acid fragment to be ligated. That is, the subject specific regions of the present invention are also suitable for use in non-sequence capture protocols (e.g., whole genome library construction) where the subject specific regions are not required to capture specific sequence regions.

As shown in FIG. 2, 1 or more hook probes can be designed to hybridize to the target site and/or sequences near the target site. The combination of hook probes for capturing the same target sequence is referred to as a hook probe set. The set of hook probes may include one 5 'hook probe and/or one 3' hook probe, and may also include a plurality of 5 'hook probes and/or a plurality of 3' hook probes. The hook probe may be designed at a position flanking the target site and/or within the target site, or at a position flanking the site linked to the target site and/or within the site linked to the target site. The term "target site" may be a specific site within a target nucleic acid (particularly a target region in the target nucleic acid) in the present invention, and may be, for example, a mutation site and/or a gene site (such as a SNP, an indel site, a gene fusion site, a methylation site, etc.) associated with a biological function.

1.2 Hook Region (HR)

The hook region of the hook probe is all or part of the nucleic acid sequence necessary for template-dependent primer extension or primer-mediated PCR amplification reactions, and is also all or part of the adaptor necessary for sequencing reactions, which may or may not be used for amplification. The hook region sequence has no homology to the template DNA (or RNA), no complete complementary mating sequence and no partial complementary mating sequence with both the target nucleic acid and the non-target nucleic acid. When applied to NGS library construction, the universal primer binding sequences of the hook region can be matched according to the sequencing primer and/or linker sequences of the different sequencing platforms. The length of the hook region can have any suitable length and sequence, typically less than 200 nucleotides.

In various embodiments, the hook region may include a specific primer binding site or universal primer binding site, a unique molecular tag (Unique Identifiers/Unique Molecular Identifiers, UMI), a Sample tag (SB), such as a cell Barcode, sample Barcode or other Barcode, and other useful elements or any combination thereof. Each 5 'hook probe and/or 3' hook probe may include one or more unique molecular tags (UMIs) whose positions in the hook region, number of bases, base composition are designed according to the amount of starting template and/or the purpose of application and/or sequencing strategy, among other purposes. Each 5 'hook probe and/or 3' hook probe may comprise a sample tag (SB), the location of the SB in the hook region, the number of bases, the base composition being designed according to the number of samples and/or the purpose of application and/or sequencing strategy, among other purposes.

In some embodiments, the hook region may comprise a cleavage site that is a restriction enzyme recognition binding site and/or one or more modified nucleotides that can be cleaved, such that the hook ligation product is achieved without PCR (PCR-free) pooling and/or removal of the sequence of the TSR region (see fig. 3). Examples of modified nucleotide/enzyme combinations include, but are not limited to: (i) Deoxyuridine and E.coli Uracil DNA Glycosylase (UDG) or A.fulgidis UDG (Afu UDG) with one or more enzymes that can remove the AP site, such as human AP (apurinic/APYRIMIDINIC) endonuclease (APE 1), endonuclease III (Endo III), endonuclease IV (Endo IV), endonuclease VIII (Endo VIII), formamidine [ fapy ] -DNA glycosylase (Fpg), human 8-oxyguanine glycosylase (hOGG 1) or human Endo-membrane glycosylase 1 (hNEIL 1) endonuclease VIII (Endo VIII); (ii) Deoxyinosine and endonuclease V or human 3-alkyladenine DNA glycosylase (hAGG) to produce an AP site and one or more enzymes that remove the AP site, such as APE1, endo III, endo IV, endo VIII, fpg, hOGG1 or hNEIL; (iii) Oxidized pyrimidine nucleotides (e.g., 5, 6-dihydroxythymine, thymine glycol, 5-hydroxy-5-methylhydantoin, uracil glycol, 6-hydroxy-5, 6-dihydro thymine or methyltrimethylene urea) and Endo VIII, endo III, hNEIL1, or combinations thereof; (iv) Oxidized purine nucleotides (e.g., 8-oxyguanine, 8-hydroxyguanine, 8-oxyadenine, fapy-guanine, methyl-guanine or fapy-adenine) and Fpg, alogg 1, hNEIL1 or combinations thereof; (v) Alkylating purines (e.g., 3-methyladenine, 7-methylguanine, 1, N6-vinyladenine and hypoxanthine) and hAGG to produce an AP site and one or more enzymes that can remove the AP site, e.g., APE1, endo III, endo IV, endo VIII, fpg, hOGG1 or hNEIL1; and (vi) 5-hydroxyuracil, 5-hydroxymethyl uracil or 5-formyluracil and a human single-stranded selective single-function uracil DNA glycosylase SMUG1 (hSMUG 1) to produce an AP site and one or more enzymes that remove the AP site, such as APE1,Endo III,Endo IV,Endo VIII,Fpg,hOGG1 or hNEIL1.

1.3 Modification of the hook Probe end

The hook probe comprises an ligatable end capable of ligating to a single stranded end of a nucleic acid fragment (e.g., a target nucleic acid).

The 5' hook probe has a functional 3' hydroxyl group capable of attaching to the 5' end of a nucleic acid fragment (e.g., a target nucleic acid), and the 5' end of the 5' hook probe has a 5' blocking group (including but not limited to a 5' hydroxyl group, a dideoxy mononucleotide, etc.) that blocks its ligation with other single strands or with its own single strand. The 3' hook probe includes a functional 5' phosphate group capable of ligating to the 3' end of a nucleic acid fragment (e.g., a target nucleic acid), the 3' end of the 3' hook probe containing a 3' blocking group that blocks ligation to other single strands or to self single strands (including, but not limited to, 3' phosphates, 3' ring-opening sugars such as 3' -phospho- α, β -unsaturated aldehydes (PA), 3' amino modifications, 3' dideoxynucleotides, 3' Phosphorothioate (PS) linkages, or 3' phosphates, and the like).

2. Nucleic acid fragment

2.1 Target region and target nucleic acid

The nucleic acid fragments to be ligated according to the invention include, in particular, target region nucleic acid fragments. Wherein, the target region refers to one or more continuous nucleotide base sequences and/or one or more nucleotide bases, which can be mutation sites and/or gene sites (such as SNP, inDel, SV, CNV, gene fusion, methylation sites and the like) related to a certain biological function, a known DNA sequence and/or RNA sequence and/or artificially synthesized nucleotide sequence, one or more genes or a specific gene set related to a certain function and/or a gene set of interest, even a specific genome and/or transcriptome and/or a certain RNA (such as 16S ribosomal RNA, ribozyme, antisense RNA, guide RNA and the like).

The nucleic acid fragment containing the target region is simply referred to as a target nucleic acid. The target nucleic acid may be double-stranded and/or single-stranded (e.g., dsDNA, cfDNA, ctDNA, ssDNA, DNA/RNA hybrid, RNA, mRNA, cDNA first strand, cDNA second strand, cDNA, etc.).

2.2 Sample

The mixture of target nucleic acid and non-target region fragments is referred to as a sample. The sample containing the target nucleic acid may be obtained from any suitable source. For example, the sample may be obtained or provided from any organism of interest. These organisms include plants, animals (e.g., mammals, including humans and non-human primates), pathogens (e.g., bacteria and viruses). In some cases, the sample is obtained directly or extracted from cells, tissues, secretions, and the like of the biological population of interest. As another example, the sample may be a microbiota or microbiota. Optionally, the sample is an environmental sample, such as a sample of water, air or soil.

Samples from an organism of interest or population of these organisms of interest may include, but are not limited to, body fluid samples (including, but not limited to, blood, urine, serum, lymph, saliva, anal and vaginal secretions, sweat, semen, and the like), cells, tissues, biopsy samples, experimental samples (e.g., products of nucleic acid amplification reactions, such as PCR amplification reactions, and the like), purified samples (e.g., purified genomic DNA, RNA, and the like), and original samples (e.g., bacteria, viruses, genomic DNA, and the like). Methods for obtaining target polynucleotides (e.g., genomic DNA, total RNA, etc.) from organisms are well known in the art.

2.3 Fragmentation

In addition to naturally fragmented samples (e.g., cfDNA, ctDNA, a synthetic nucleic acid, etc.), most of the examples (e.g., genomic DNA, etc.) require treatment by fragmentation to produce one or more fragments of a particular size or to produce fragment populations with a narrow fragment length distribution. Any method of fragmenting may be used, either by physical means (e.g., ultrasonic cutting, sonic cutting, needle cutting, nebulization, or sonication), by chemical means (e.g., heating and divalent metal cations), or by enzymatic means (e.g., using endonucleases, nickases, or transposases). Crushing methods are known in the art, see for example US 2012/0004126.

2.4 Nucleic acid fragment size selection

Depending on the embodiment, the fragmented sample requires size selection processing of the target nucleic acid or nucleic acid fragment (e.g., fragmented genomic DNA or RNA) to obtain a nucleic acid fragment having a particular fragment size or a particular fragment range. Any method of fragment selection may be used, for example, in some embodiments, fragmented target nucleic acids may be separated by gel electrophoresis, and a piece of gel corresponding to a particular fragment size or particular fragment range extracted and purified from the gel. In some embodiments, purification columns may be used to select fragments with a particular minimum size. In some embodiments, paramagnetic beads may be used to selectively bind DNA fragments having a desired fragment range. In some embodiments, a Solid Phase Reversible Immobilization (SPRI) method may be used to enrich for nucleic acid fragments having a particular fragment size or a particular fragment range. In some embodiments, a combination of the above fragment selection methods may be used.

The size of the fragmented nucleic acid is selected to be in the range of about 50 to about 3000 bases, and may be a fragment of a specific size, a fragment of a specific average size, or a fragment of a specific range.

3. Ligase enzyme

The formation of a hook probe ligation product requires the use of a hook probe in combination with one or more ligases. The ligase used in the present invention is capable of ligating between molecules of a polynucleotide having a single-stranded end under appropriate conditions and at appropriate substrate concentrations.

In some embodiments, the ligase is a "single stranded DNA/RNA ligase". As used herein CIRLIGASE can catalyze the formation of covalent phosphodiester bonds between two different nucleic acid strands under appropriate reaction conditions. For example, a ligase catalyzes the synthesis of a phosphodiester linkage between the 3 '-hydroxyl of one polynucleotide and the 5' -phosphoryl of a second polynucleotide. In some cases, hybridization of the hook probe to the target nucleic acid can result in a substrate for ligation. For example, hybridization of a 5' hook probe to a target nucleic acid can result in a 3' hydroxyl group suitable for ligation to the 5' end of the target nucleic acid. Optionally, the 5 'hook probe comprises a blocked 5' end that is not suitable for ligation. Similarly, hybridization of the 3' hook probe to the target nucleic acid can result in a free 5' phosphate that can be attached to the 3' end of the target nucleic acid. Optionally, the 3 'hook probe comprises a blocked 3' end that is not suitable for ligation.

In some embodiments, the ligase is a thermostable RNA ligase, including but not limited to TS2126RNA ligase or an adenylated version of TS2126RNA ligase, CIRCLIGASE TM SSDNA ligase or CIRCLIGASE II TM SSDNA ligase (see EPICENTER BIOTECHNOLOGIES, madison, wisconsin; lucks et al, 2011,Proc.Natl.Acad.Sci.USA 108:11063-11068;Li et al,2006,Anal.Biochem.349:242-246; blondal et al, 2005,NucleicAcids Res.33:135-142), thermoautotrophic lipoprotein RNA ligase 1 or "MthRn1 ligase" (see U.S. Pat. No. 7,303,901, U.S. Pat. No. 9217167 and International publication No. WO 2010/094040), T4 RNA ligase (e.g., T4 RNA ligase I; zhang et al, 1996,Nucleic Acids Res.24:990-991; tessier et al, 1986,Anal.Biochem 158:171-178), thermostable 5' ApA/DNA ligase.

The invention further provides a kit comprising the hook probe of the invention, optionally together with at least one ligase for ligating the ligatable end of the hook probe to the end of a nucleic acid fragment to be ligated, which ligase may be any of the ligases described above.

On the basis of the hook probe, the invention also provides the application of the hook probe in constructing a nucleic acid sequencing library, in particular to the application in constructing a high-throughput sequencing library. It will be appreciated that the use of the hook probe of the present invention is very broad and is not limited to the construction of nucleic acid sequencing libraries, but is only one of the primary uses listed herein.

On the basis of the hook probe of the present invention, the present invention also provides a nucleic acid ligation method comprising:

annealing and hybridizing the hook probe of the present invention with denatured nucleic acid fragments to be ligated; and

Ligating the ligatable end of the hook probe to the single stranded end of the nucleic acid fragment in the presence of a ligase.

It is to be understood that the nucleic acid ligation method of the present invention is a basic method, and its application is not particularly limited, and it can be used in any application scenario where ligation of the hook probe of the present invention with a nucleic acid fragment is required. A typical but non-limiting application scenario is in the construction of nucleic acid sequencing libraries, as follows:

On the basis of the hook probe, the invention also provides a construction method of a nucleic acid sequencing library, which comprises the following steps:

annealing and hybridizing the hook probe of the present invention to the denatured nucleic acid fragment to be ligated; and

In order to eliminate the influence of unwanted nucleic acids on subsequent reactions, the method for constructing a nucleic acid sequencing library may further comprise:

Removing the linear non-specific ligation product, the excess nucleic acid fragment and the excess hook probe; preferably, the linear non-specific ligation products, excess nucleic acid fragments, and excess hook probes are digested with single stranded exonucleases.

The products after ligation by the ligase and/or the products after elimination of unwanted nucleic acids have two alternative paths in the subsequent construction of the nucleic acid sequencing library, namely the PCR amplification path and the PCR-free path.

For the PCR amplification path, the method further comprises:

PCR amplification of the ligation product of the hook probe and the nucleic acid fragment using a universal primer.

For a PCR-free (PCR-free) path, the hook region may include a restriction enzyme binding site cleavable by a restriction enzyme and/or one or more modified nucleotides that can be cleaved, the method further comprising:

A step of restriction enzyme cleavage of the restriction enzyme binding site using a restriction enzyme and/or cleavage of one or more modified nucleotides using a cleavage enzyme.

Based on the basic principle and element design, the invention provides a series of methods for constructing nucleic acid sequencing libraries, which can be applied to different sequencing platforms, and each specific library construction scheme will be described in detail below. In particular, other similar embodiments and variations thereof, in addition to the embodiments described below, are also included within the scope of the claims.

The double sided hook probe hybridization protocol is shown in FIGS. 2 and 3. The hybridized nucleic acid fragments are captured by 5 'hook probes and 3' hook probes that match the 5 'and 3' end portions of the nucleic acid fragments (e.g., target nucleic acids), and specific double hook ligation products are formed after intermolecular ligation of the hybridization complexes is completed. PCR amplification of the ligation products was achieved by the hook region (FIG. 2) or PCR (PCR-free) library construction was not required (FIG. 3). When the GSP region is a specific target nucleic acid hybridization sequence, the scheme can be used for target sequence capturing and library building flow, and can also be used for rapidly detecting unknown flanking sequences at two ends of a known sequence (such as rapid cloning of cDNA ends by PCR, namely RACE (rapid-amplification of cDNA ends)) or manual sequence splicing in synthetic biology. When the GSP region is a random sequence, this scheme can be used for PCR pooling of genomic DNA or RNA or without PCR (PCR-free) pooling.

In one embodiment, the hook probes comprise a5 'hook probe and a 3' hook probe, the 3 'end of the hook region of the 5' hook probe having a functional 3 'hydroxyl group capable of ligating to the 5' end of the nucleic acid fragment; the 5 'end of the hook region of the 3' hook probe has a functional 5 'phosphate group capable of ligating to the 3' end of the nucleic acid fragment; the hook region of the 5 'hook probe and the hook region of the 3' hook probe each comprise a universal primer binding site. As shown in FIG. 2, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Annealing and hybridizing the hook probes (e.g., 1 pair at most) to denatured nucleic acid fragments to be ligated (e.g., fragmented DNA, plasma free DNA, or reverse transcribed cDNA, etc.); (2) In the presence of a ligase, a functional 3 'hydroxyl group of the 5' hook probe is attached to the 5 'end of the nucleic acid fragment, and a functional 5' phosphate group of the 3 'hook probe is attached to the 3' end of the nucleic acid fragment; (3) Single strand exonuclease digests linear non-specific ligation products, excess nucleic acid fragments, and excess hook probes; (4) PCR amplification is performed on the ligation products of the hook probe and the nucleic acid fragment using universal primers that match the sequences of the hook region, wherein the universal primers are complementarily paired with the universal primer binding sites of the 5 'hook probe and the 3' hook probe, respectively, and the primers can be provided with sample tags. The amplified product is a target nucleic acid molecule with sequencing adapter sequences added at two ends, and can be used for subsequent library construction and on-line.

In another embodiment, the hook probes comprise a 5 'hook probe and a 3' hook probe, the 3 'end of the hook region of the 5' hook probe having a functional 3 'hydroxyl group capable of ligating to the 5' end of the nucleic acid fragment; the 5 'end of the hook region of the 3' hook probe has a functional 5 'phosphate group capable of ligating to the 3' end of the nucleic acid fragment; the hook region of the 5 'hook probe and the hook region of the 3' hook probe each comprise a restriction enzyme binding site cleavable by a restriction enzyme and/or one or more modified nucleotides capable of being cleaved. As shown in FIG. 3, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Annealing and hybridizing the hook probes (e.g., 1 pair at most) to denatured nucleic acid fragments to be ligated (e.g., fragmented DNA, plasma free DNA, or reverse transcribed cDNA, etc.); (2) In the presence of a ligase, a functional 3 'hydroxyl group of the 5' hook probe is attached to the 5 'end of the nucleic acid fragment, and a functional 5' phosphate group of the 3 'hook probe is attached to the 3' end of the nucleic acid fragment; (3) Single strand exonuclease digests linear non-specific ligation products, excess nucleic acid fragments, and excess hook probes; (4) either or both of: 4.1. when the hook region sequence is provided with a restriction enzyme recognition sequence, the ligation product is denatured and hybridized with a sequence complementary to the restriction enzyme recognition sequence to form a restriction enzyme recognition site, the restriction enzyme recognition site is cut by the corresponding restriction enzyme, and unnecessary sequences (such as GSP region and/or hook region sequence irrelevant to sequencing) on the hook probe are cut off; 4.2. when the sequence of the hook region has U base, the USER enzyme is added to cut, and unnecessary sequences (such as GSP region and/or sequence of the hook region irrelevant to sequencing) on the hook probe are excised, and the excised fragments can be used for subsequent library construction and on-machine.

The single sided hook probe hybridization protocol is shown in FIGS. 4-7. The hybridized nucleic acid fragments are captured by a 5 'hook probe or a 3' hook probe that mates to the 5 'or 3' end portion of the nucleic acid fragment (e.g., the target nucleic acid), and specific single hook ligation products are formed after intermolecular ligation of the hybridization complex is completed. The PCR of the nucleic acid fragments or the enrichment detection without PCR (PCR-free) is realized by combining the technologies of primer extension, branch connection and the like. Similarly, the single-sided hook probe hybridization scheme is also suitable for target sequence capturing and library building processes (especially gene fusion and SV detection), whole genome library building processes, RNA-seq library building processes, RACE, sequence manual splicing and the like.

In one embodiment, the hook probe comprises a 3' hook probe, the 5' end of the hook region of the 3' hook probe having a functional 5' phosphate group capable of ligating to the 3' end of the nucleic acid fragment. As shown in FIG. 4, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Annealing and hybridizing the hook probe(s) to denatured nucleic acid fragments to be ligated (e.g., fragmented DNA, plasma free DNA, or reverse transcribed cDNA, etc.); (2) Ligating a functional 5' phosphate group of a 3' hook probe to the 3' end of the nucleic acid fragment in the presence of a ligase; (3) Digesting the linear non-specific ligation product, the excess nucleic acid fragment, and the excess hook probe with a single strand exonuclease; (4) Performing primer extension reaction by using a primer sequence which is fully or partially complementary with the hook region sequence of the 3' hook probe and is used for a PCR library construction scheme; (5) Ligating a 5' linker (e.g., a 5' blunt end linker or a T-A ligation linker) at the 5' end of the product of the extension reaction; (6) PCR amplification was performed using primer sequences that are fully or partially complementary to the hook region sequences of the 5 'adapter and 3' hook probes, and the amplified products were used for subsequent library construction and set-up.

In another embodiment, the hook probe comprises a 3' hook probe, the 5' end of the hook region of the 3' hook probe having a functional 5' phosphate group capable of ligating to the 3' end of the nucleic acid fragment; the hook region of the 3' hook probe includes a restriction enzyme binding site cleavable by a restriction enzyme and/or one or more modified nucleotides that can be cleaved. As shown in FIG. 4, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Annealing and hybridizing the hook probe(s) to denatured nucleic acid fragments to be ligated (e.g., fragmented DNA, plasma free DNA, or reverse transcribed cDNA, etc.); (2) Ligating a functional 5' phosphate group of a 3' hook probe to the 3' end of the nucleic acid fragment in the presence of a ligase; (3) Digesting the linear non-specific ligation product, the excess nucleic acid fragment, and the excess hook probe with a single strand exonuclease; (4) The scheme for PCR-free is implemented in either or both of the following ways: 4.1. when the hook region sequence is provided with a restriction enzyme recognition sequence, the ligation product is denatured and hybridized with a sequence complementary to the restriction enzyme recognition sequence to form a restriction enzyme recognition site, the restriction enzyme recognition site is cut by the corresponding restriction enzyme, and unnecessary sequences (such as GSP region and/or hook region sequence irrelevant to sequencing) on the hook probe are cut off; 4.2. when the sequence of the hook region has U base, the USER enzyme is added to cut, and unnecessary sequences (such as GSP region and/or sequence of the hook region irrelevant to sequencing) on the hook probe are excised, and the excised fragments can be used for subsequent library construction and on-machine.

In another embodiment, the hook probe comprises a 3' hook probe, the 5' end of the hook region of the 3' hook probe having a functional 5' phosphate group capable of ligating to the 3' end of the nucleic acid fragment; the nucleic acid fragment includes a target region sequence. As shown in FIG. 5, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Annealing and hybridizing the hook probe(s) to denatured nucleic acid fragments to be ligated (e.g., fragmented DNA, plasma free DNA, or reverse transcribed cDNA, etc.); (2) Ligating a functional 5' phosphate group of a 3' hook probe to the 3' end of the nucleic acid fragment in the presence of a ligase; (3) Digesting the linear non-specific ligation product, the excess nucleic acid fragment, and the excess hook probe with a single strand exonuclease; (4) Performing a primer extension reaction using a primer sequence that is fully or partially complementary to the target region sequence or a region adjacent thereto; (5) Ligating a 5' linker (e.g., a 5' blunt end linker or a T-A ligation linker) at the 5' end of the product of the extension reaction; (6) PCR amplification was performed using primer sequences that are fully or partially complementary to the hook region sequences of the 5 'adapter and 3' hook probes, and the amplified products were used for subsequent library construction and set-up. PCR (PCR-free) library construction may also be performed in a manner similar to that of FIG. 4.

In another embodiment, the hook probe comprises a 5' hook probe, the 3' end of the hook region of the 5' hook probe having a functional 3' hydroxyl group capable of ligating to the 5' end of the nucleic acid fragment; the hook region of the 5' hook probe includes a universal primer binding site. As shown in FIG. 6, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Performing end repair and dephosphorylation treatment on fragmented nucleic acid fragments to be ligated (e.g., fragmented DNA or plasma free DNA); (2) Ligating a 3' adaptor (e.g., blunt end adaptor) to the 3' end of the end-repaired and dephosphorylated nucleic acid fragment, the 3' adaptor having a universal primer binding site; (3) Annealing and hybridizing the hook probe (e.g., 1 to more) to the denatured nucleic acid fragment after ligation of the 3' linker; (4) After the phosphorylation treatment, the functional 5' phosphate group of the 3' hook probe is ligated to the 3' end of the nucleic acid fragment in the presence of a ligase; (5) Digesting the linear non-specific ligation product, the excess nucleic acid fragment, and the excess hook probe with a single strand exonuclease; (6) PCR amplification is performed using universal primers complementary to the universal primer binding sites of the 5 'hook probe and the 3' adaptor, respectively, for the ligation products of the hook probe and the nucleic acid fragment.

In another embodiment, the hook probe comprises a 5' hook probe, the 3' end of the hook region of the 5' hook probe having a functional 3' hydroxyl group capable of ligating to the 5' end of the nucleic acid fragment; the hook region of the 5' hook probe includes a restriction enzyme binding site cleavable by a restriction enzyme and/or one or more modified nucleotides that can be cleaved. As shown in FIG. 6, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Performing end repair and dephosphorylation treatment on fragmented nucleic acid fragments to be ligated (e.g., fragmented DNA or plasma free DNA); (2) Ligating a 3' adaptor (e.g., blunt end adaptor) to the 3' end of the end-repaired and dephosphorylated nucleic acid fragment, the 3' adaptor having a universal primer binding site; (3) Annealing and hybridizing the hook probe (e.g., 1 to more) to the denatured nucleic acid fragment after ligation of the 3' linker; (4) After the phosphorylation treatment, the functional 5' phosphate group of the 3' hook probe is ligated to the 3' end of the nucleic acid fragment in the presence of a ligase; (5) Digesting the linear non-specific ligation product, the excess nucleic acid fragment, and the excess hook probe with a single strand exonuclease; (6) Restriction enzyme cleavage of the restriction enzyme binding site using a restriction enzyme and/or cleavage of one or more modified nucleotides using a cleavage enzyme allows for a PCR-free (PCR-free) library construction protocol.

In another embodiment, the hook probe comprises a 3' hook probe, the 5' end of the hook region of the 3' hook probe having a functional 5' phosphate group capable of ligating to the 3' end of the nucleic acid fragment. As shown in FIG. 7, the construction method of the nucleic acid sequencing library in this embodiment specifically comprises the following steps: (1) Annealing and hybridizing the hook probe (e.g., 1 to more) to denatured nucleic acid fragments to be ligated (e.g., fragmented DNA or plasma free DNA); (2) Ligating a functional 5' phosphate group of a 3' hook probe to the 3' end of the nucleic acid fragment in the presence of a ligase; (3) In the presence of polymerase, taking the 3 'end of the 3' hook-shaped probe as a polymerase reaction starting point to carry out extension reaction; (4) Digesting the linear non-specific ligation product, the excess nucleic acid fragment and the excess hook probe with a single strand exonuclease; (5) Ligating a 5' linker (a 5' blunt end linker or a T-A ligation linker) to the 5' end of the product of the extension reaction; (6) PCR amplification was performed using primer sequences that are fully or partially complementary to the hook region sequences of the 5 'adapter and 3' hook probes, and the amplified products were used for subsequent library construction and set-up.

The construction method of the nucleic acid sequencing library, which is an improved rapid target region enrichment method, solves the problems of complicated library construction process, long time consumption and high cost of the existing probe liquid phase hybridization capture technology, is applicable to various types of samples including but not limited to whole genome DNA, cfDNA, ctDNA, FFPE DNA, RNA, mRNA and the like, and can detect various types of genetic variations such as SNP (single nucleotide polymorphism ), inDel (insertion-deletion), CNV (Copy number variations, genetic copy number variation), SV (Structural variation, genomic structure variation), gene fusion and the like. The variant of the invention can also be used for rapid direct library construction of whole genome DNA, cfDNA, ctDNA, FFPE DNA and the like.

The invention realizes rapid hybridization capture of nucleic acid fragments (such as target sequences) by smart design of the hook-shaped probes and cooperation of the hook-shaped probes with the ligase, and simultaneously adds a section of tool known sequence, and can realize different applications by smart design and subsequent operation reaction by using the section of tool known sequence. In particular, the invention has wide applicable sample type range, wide applicable detection type and wide application field (not only limited to high-flux library construction, but also applicable to the fields of molecular cloning, synthetic biology and the like). It is expected that the implementation of the invention will greatly simplify the process, shorten the time and save the cost, break through the limitation of applicable sample types, will benefit from various scientific research applications and kit packaging, and has very broad market potential and prospect.

The following detailed description of the technical solutions and effects of the present invention will be given by way of test examples and examples, which are to be understood as merely illustrative and are not to be construed as limiting the scope of the present invention.

The following test examples 1 and 2 demonstrate the basic principle of the present invention. That is, under appropriate reaction conditions, a nucleic acid fragment, such as a single-stranded fragment of a target region nucleic acid (having a phosphate group at the 5 '-end or a hydroxyl group at the 3' -end) and a target-specific hook probe (having a phosphate group at the 5 '-end or a hydroxyl group at the 3' -end) having a partial sequence complementary to the single-stranded fragment of the target region nucleic acid form a hybridization complex, and the proportion of the product of the intermolecular single-stranded ligation of the non-complementary region (the 5 '-end of the single-stranded nucleic acid of the target region and the 3' -end of the hook probe) of the hybridization complex is higher than the proportion of the single-stranded circularization product in the single-stranded fragment of the target region nucleic acid under the catalysis of some ligase. And the proportion of single-stranded intermolecular products formed between single-stranded fragments without complementary pairing region is extremely low.

Test example 1

In this test example, the occurrence of incubation of the target region nucleic acid single-stranded fragment (YJ-439) with the target-specific 5' -hook probe (YJ-765) (FIG. 10) at different reaction temperatures with CIRLIGASE I (EPICENTER Co.) was investigated.

FIG. 8 shows a 10% denaturing polyacrylamide gel (U-PAGE) gel of the product. The results show that:

Lane 1: the target region nucleic acid single-stranded fragment YJ-439 (synthesized by IDT, 90 nt) has the following sequence:

P-CTCATGCCCTTCGGCTGCCTCCTGGACTATGTCCGGGAACACAAAGACaatattggctcccagtacctgctcaactggtgtgtgcagatc(SEQ ID NO：1).

Lane 2: target-specific 5' hook probe YJ-765 (synthesized from IDT, 59nt, containing a sequence complementary to YJ-439 at 20 nt) was as follows:

CAGGAGGCAGCCGAAGGGCAGAACGACATGGCTACGATCCGACTTNNNNNNCATTTCAT(SEQID NO：2)。

Lane 3: YJ-439 and CIRLIGASE I were treated with exonucleases I and III after reaction at an optimum temperature of 55 ℃.

Lane 4: YJ-439 reacted with CIRLIGASE I at an optimum temperature of 55 ℃.

Lanes 5-9: YJ-439/YJ-765 and CIRLIGASEI were reacted together at different temperatures (25 ℃,37 ℃,45 ℃,55 ℃ and 60 ℃).

Lanes 3 (containing exonuclease I and III treatments) and 4 (without exonuclease I and III treatments) show that YJ-439 forms a single-stranded loop by itself (at about 150nt, marked by triangles) at an optimal temperature of 55℃with CIRLIGASE I. When incubated with the hook probe (YJ-765) at the different temperatures shown in lanes 5-9 (25 ℃,37 ℃,45 ℃,55 ℃ and 60 ℃), most YJ-439 formed products (149 nt, marked with arrows) attached to the hook probe instead of single-stranded loops, as these products could be degraded by exonucleases I and III.

Test example 2

In this test example, the occurrence of incubation reaction of the target region nucleic acid single-stranded fragment (YJ-439) with the non-target specific 5 'hook probe (YJ-890) and the non-target specific 3' hook probe (YJ-891) (FIG. 10) at different reaction temperatures with CIRLIGASE I (EPICENTER Co.) was investigated.

FIG. 9 shows a 10% U-PAGE gel of the product. The results show that:

Lane 1: target region nucleic acid single-stranded fragment YJ-439 (synthesized from IDT, 90 nt).

Lane 2: YJ-439 and CIRLIGASE I were treated with exonucleases I and III after reaction at an optimum temperature of 55 ℃.

Lane 3: non-target specific 5' hook probe YJ-890 (synthesized by IDT, 46 nt) with a sequence of 20bp in YJ-765 complementary to YJ-439 replaced with a random base sequence:

NNNNNNNNNNNNNNNGAACGACATGGCTACGATCCGACTTNNNNNN(SEQ ID NO：3)。

lane 4: non-target specific 3' hook probe YJ-891 (synthesized by IDT, 40 nt) has the sequence:

P-NNNNNNNNNNNNNNNGAACGACATGGCTACGATCCGACTTNNNNNN-P(SEQ ID NO：4)。

Lane 5: the product after the reaction of YJ-890/YJ-891 with CIRLIGASE I at an optimum temperature of 55 ℃.

Lanes 6-10: the products after the YJ-439/YJ-890/YJ-891 and CIRLIGASE I were reacted together at different temperatures (25 ℃,37 ℃,45 ℃,55 ℃ and 60 ℃).

Lane 2 (containing exonuclease I and III treatments) shows that YJ-439 forms a single-stranded loop by itself (at about 150nt, marked by triangles) at an optimal temperature of 55℃with CIRLIGASE I. Lane 5 shows that non-target specific hook probes YJ890 and YJ-891 form intermolecular ligation products (86 nt, marked by long arrows in lanes 5-10) with CIRLIGASE I at an optimal temperature of 55 ℃. When incubated with non-target specific hook probes (YJ-890/YJ-891) at the different temperatures shown in lanes 6-10 (25 ℃,37 ℃,45 ℃,55 ℃ and 60 ℃), most ligation products were single-stranded loops (at about 150nt, marked by triangles) that were not readily treated by exonuclease (data not shown) and intermolecular ligation products (86 nt, marked by long arrows in lanes 5-10) formed by 5 'and 3' hook probes that were degradable by exonucleases I and III (data not shown), whereas random intermolecular ligation products (136 nt and/or 130 nt) of the template (YJ-439) with non-target specific hook probes (YJ 890 and YJ-891) were barely seen. Therefore, comparing the results of FIG. 8, it is assumed that only a partial sequence hybridization reaction between the template (YJ-439) and the target-specific hook probe (YJ-765) is followed by the formation of a template 5 'single strand and a target-specific probe 3' single strand which are closely spaced, and that the probability of intermolecular ligation reaction between the template and the probe is significantly increased.

Example 1: double sided hook probe hybridization test

1. Sample collection and processing

Human NA12878 (GM 12878, CORIELL INSTITUTE) genomic DNA was disrupted by means of a fragmenting enzyme (fragmentase), and then a 200-400bp DNA fragment was selected by means of a double selection method.

2. Denaturing hybridization

Preparing a hybridization reaction system: 20ng of restriction-disrupted human NA12878 (GM 12878, CORIELL INSTITUTE) (GM 12878, coriell institute) genomic DNA was taken per reaction, mixed with 2ul of 3' -hook probe of different concentrations (0.1 uM,0.01uM,0.005 uM), and 1. Mu.L of reaction buffer was added to make up to 10. Mu.L. Vortex mixing, and placing into a PCR instrument, the reaction procedure is as follows: 95 ℃,5 minutes, the temperature is reduced to 42 ℃ at the rate of 0.1 seconds, the reaction is carried out for 1 hour at 42 ℃, and the storage is carried out at 42 ℃. Wherein, the 3' hook probe is designed as follows:

5phos/ATGCTGACGGTCAAGTGGTCTTAGGNNNNNNNNNNNNNNNNN/3 AmMO/(SEQ ID NO: 5), underlined is the partial adaptor reverse complement, not the hybridization complement designed for the different ROI regions.

A portion of the probe sequence is shown in Table 1 below.

TABLE 1

3.3' Ligation reaction

The mixture was prepared as follows in table 2:

TABLE 2

Adding the mixed solution into a hybridization reaction system, uniformly mixing the mixed solution by a pipette, and placing the mixed solution at 42 ℃ for mixed incubation for 1 hour. Care should be taken that: when the mixture was added, the temperature of the mixture was room temperature and the hybridization mixture was still in the PCR apparatus.

4. Exonuclease digestion

To each reaction, 1. Mu.L of exonuclease 1 (Exo I, NEB) was added, and the mixture was mixed with a pipette, and reacted at 37℃for 30 minutes and at 80℃for 20 minutes.

5.5' Ligation reaction

Hybridization at 5' end: 1ul of 5' hook probe was added to each reaction period and mixed with its corresponding different concentrations (0.1 uM,0.01uM,0.005uM, 0.002um) and mixed with a pipette, followed by the following reaction procedure: 95 ℃,5 minutes, and the temperature is reduced to 42 ℃ at the rate of 0.1 seconds, the reaction is carried out for 30 minutes at 42 ℃, and the preservation is carried out at 42 ℃. Wherein the 5' hook probe is designed as follows:

NNNNNNNNNNNNNNNNNGAACGACATGGCTACGATCCGACTTNNNNNNT (SEQ ID NO: 10), underlined as part of the linker sequence, not as hybridization complement designed for different ROI regions.

A portion of the probe sequence is shown in Table 3 below.

TABLE 3 Table 3

5' -Terminal ligation:

the mixture was prepared as follows in table 4:

TABLE 4 Table 4

Adding the mixed solution into a hybridization reaction system, uniformly mixing the mixed solution by a pipette, and placing the mixed solution at 42 ℃ for mixed incubation for 1 hour and 20 minutes at 80 ℃. Care should be taken that: when the mixture was added, the temperature of the mixture was room temperature and the hybridization mixture was still in the PCR apparatus.

6. Magnetic bead purification

A) 39.6 mu L of Ampure XP magnetic beads are added into the reaction sample (22 mu L), the gun head blows the mixed solution of the uniformly mixed magnetic beads and the sample for 7-10 times, after 5 minutes of room temperature combination, the gun head is used for blowing and uniformly mixing for 7-10 times again, after 5 minutes of room temperature combination, the mixture is placed on a magnetic frame for 2 minutes of combination (until the liquid is clear), and the supernatant is carefully sucked and removed.

B) 180 mu L of 70% ethanol is added into the 8 connecting pipes on the magnetic rack, the pipe cover is covered tightly, the mixture is evenly mixed for 5 times in an upside down way, and the supernatant is discarded; the washing was repeated 1 time with 320. Mu.L of 70% ethanol, and the residual ethanol was discarded as much as possible with a small-scale pipette and dried at room temperature.

C) The magnetic beads are resuspended by 20 mu L of TE solution, the gun head is used for blowing and mixing for 7-10 times, after 5 minutes of room temperature combination, the gun head is used for blowing and mixing for 7-10 times again, after 5 minutes of room temperature combination, the magnetic beads are placed on a magnetic rack for combination for 2 minutes (until liquid is clear), 20 mu L of supernatant is carefully sucked out to a new 0.2mL PCR tube, and the next reaction or preservation at-20 ℃ is prepared.

PCR amplification

A reaction mixture of the following Table 5 was prepared, and 10ul of the above product was subjected to PCR:

TABLE 5

Primer 1 sequence:

/5Phos/CACAGAACGACATGGCTACGATCCGACT(SEQ ID NO：15)；

Primer 2 sequence:

TGTGAGCCAAGGAGTTGACTTTACTTGTCTTCCTAAGACCACTTGACCGTCAGCAT(SEQ ID NO：16)。

The reaction procedure is as follows in table 6:

TABLE 6

8. Polyacrylamide gel electrophoresis

6. Mu.L of the PCR product was subjected to polyacrylamide gel electrophoresis at 240V for 20 minutes. The results are shown in FIG. 11. The results show that:

Lane 1: only 3' hook probe and DNA, so there is no corresponding product after PCR amplification; lane 2: only 5' hook probe and DNA, and therefore no corresponding product after PCR amplification, the specificity of hook probe and PCR primer was good as seen in lanes 1 and 2.

Lane 3: contains 3 'hook probe and 5' hook probe and DNA, so that the PCR amplification has corresponding products. However, since the initial amount of the PCR is relatively small, the desired product can be obtained only when the number of PCR cycles is relatively large. The PCR cycle number in the reaction is lower than the theoretical value, so that the brighter the strip in the gel diagram, the higher the off-target efficiency is. Furthermore, an unknown band of 400bp appears in the PCR product.

Lanes 4-6: the concentration of the 3' hook probe is kept unchanged, the concentration of the 5' hook probe is reduced, and the result shows that the total amount of the PCR product is reduced along with the reduction of the concentration of the 5' hook probe, which indirectly reflects the gradual appearance of the real target product. And when the concentration is reduced to a certain value, the 400bp band disappears, so that subsequent attempts are made to further adjust the concentration of the hook probe.

Lanes 7-8: the concentration of the 5 'hook probe was kept unchanged and the concentration of the 3' hook probe was decreased, which showed that the 400bp band also disappeared under this condition, but the total amount of the non-specific PCR product also tended to decrease. Subsequent attempts were made to adjust the hook probe concentration to increase capture efficiency.

Lane 9: only the DNA template.

Example 2: double-sided hook probe hybridization enrichment target region

1. Sample collection and processing

2. Denaturing hybridization

Preparing a hybridization reaction system: 10ng of restriction-disrupted human NA12878 (GM 12878, CORIELL INSTITUTE) genomic DNA was taken and mixed with 1. Mu.L of 5 'and 3' hook probe 0.1. Mu.M, 1. Mu.L of reaction buffer was added and water was added to 10. Mu.L. Vortex mixing, and placing into a PCR instrument, the reaction procedure is as follows: 95 ℃,5 minutes, the temperature is reduced to 42 ℃ at the rate of 0.1 seconds, the reaction is carried out for 1 hour at 42 ℃, and the storage is carried out at 42 ℃.

Wherein, the 5' hook probe is designed as follows:

The 3' hook probe was designed as follows:

A portion of the probe sequence is shown in table 7 below:

TABLE 7

/>

3. Double-sided hook probe ligation

The mixture was prepared as follows in table 8:

TABLE 8

Component (A)	Dosage of
		10 Xreaction buffer (Epicentre Co.)	1μL
0.025MM ATP (Epicentre Co.)	0.5μL
		50MM MnCl ₂ (Epicentre Co.)	1μL
100% DMSO (sigma company)	2μL
		CIRCLIGASE cyclase (100U/. Mu.L) (Epicentre Co.)	0.2μL
Enzyme-free pure water	5.3μL
		Total volume of	10μL

4. Exonuclease digestion

5. Magnetic bead purification

A) 37.8 mu L of Ampure XP magnetic beads are added into the reaction sample (21 mu L), the gun head blows the mixed solution of the uniformly mixed magnetic beads and the sample for 7-10 times, after 5 minutes of room temperature combination, the gun head is used for blowing and uniformly mixing for 7-10 times again, after 5 minutes of room temperature combination, the mixture is placed on a magnetic frame for 2 minutes of combination (until the liquid is clear), and the supernatant is carefully sucked and removed.

PCR amplification

A reaction mixture of the following Table 9 was prepared, and 10. Mu.L of the above-mentioned product was subjected to PCR reaction:

TABLE 9

Component (A)	Dosage of
		Ligation products	10μL
2×KAPA HiFi HotStart ReadyMix	25μL
		20 Mu M primer 1	1μL
20 Mu M primer 2	1μL
		Water and its preparation method	13μL
Total volume of	50μL

Primer 1 sequence:

/5Phos/CACAGAACGACATGGCTACGATCCGACT(SEQ ID NO：15)；

Primer 2 sequence:

TGTGAGCCAAGGAGTTGACTTTACTTGTCTTCCTAAGACCACTTGACCGTCAGCAT(SEQ ID NO：16)。

the reaction procedure is as follows in table 10:

Table 10

8. Polyacrylamide gel electrophoresis

6. Mu.L of the PCR product was subjected to polyacrylamide gel electrophoresis at 240V for 20 minutes. FIG. 12 shows the result of polyacrylamide gel electrophoresis of a part of the product of this example, in which lane 14 is the result of electrophoresis of the library product under the library construction conditions of this example.

PE50 sequencing results and analysis

FIG. 13 shows the distribution of sequencing reads (reads) on chromosome 10, wherein A, B is the WGS control library and the negative control library, respectively, without target region enrichment; c is a bilateral hook probe hybridization library, and it can be seen that there are significantly 2 ROIs enriched.

FIG. 14 shows the cases where the Capture read length (Capture reads) and the target read length (On TARGET READS) are respectively covered On the ROI region, showing that the Capture read length is significantly covered On the ROI region, the target region On the chromosome is significantly enriched, the red line (curve 1 in FIG. 14) is the Capture read length, the blue line (curve 2 in FIG. 14) is the target read length, the dark gray region (indicated by A in FIG. 14) is the ROI.+ -. 20bp, the light gray region (indicated by B in FIG. 14) is the ROI.+ -. 100bp, and the yellow line (indicated by C in FIG. 14) shows the length of the PE after the read lengths at both ends are turned On.

The above results indicate that PE50 sequencing data performs better at the target rate (On TARGET RATE) and Capture rate (Capture rate) under the conditions of this example.

Example 3:3' hook probe hybridization assay

1. Sample collection and processing

2. Dephosphorylation reaction

10Ng of the digested human NA12878 (GM 12878, CORIELL INSTITUTE) genomic DNA was taken, an appropriate amount of rSAP enzyme (NEB Co.) was added, 1. Mu.L of 10 Xreaction buffer (NEB Co.) was added, and water was added to 10. Mu.L. Vortex mixing, and placing into a PCR instrument, the reaction procedure is as follows: the reaction was carried out at 37℃for 30 minutes and at 65℃for 15 minutes, and the reaction was preserved at 4 ℃.

3. Denaturing hybridization

Preparing a hybridization reaction system: the above-mentioned dephosphorylation reaction solution was mixed with 1. Mu.L of 0.2. Mu.M 3' hook probe, and the total volume was 11. Mu.L. Vortex mixing, and placing into a PCR instrument, the reaction procedure is as follows: 95 ℃,5 minutes, the temperature is reduced to 42 ℃ at the rate of 0.1 seconds, the reaction is carried out for 1 hour at 42 ℃, and the storage is carried out at 42 ℃. Wherein, the 3' hook probe is designed as follows:

A portion of the probe sequence is shown in table 11 below:

TABLE 11

4.3' Ligation reaction

The mixture was prepared as follows in table 12:

Table 12

Component (A)	Dosage of
		10 Xreaction buffer (Epicentre Co.)	2μL
0.025MM ATP (Epicentre Co.)	0.5μL
		50MM MnCl ₂ (Epicentre Co.)	1μL
100% DMSO (sigma company)	1μL
		CIRCLIGASE cyclase (100U/. Mu.L) (Epicentre Co.)	0.2μL
Enzyme-free pure water	4.3μL
		Total volume of	9μL

5. Exonuclease digestion

To each reaction, 1. Mu.L of exonuclease 1 (Exo I, NEB) was added, and the mixture was homogenized by pipetting. The reaction was carried out at 37℃for 30 minutes and at 80℃for 20 minutes.

6. Primer extension reaction

An appropriate amount of PE primers with different tag sequences (barcode) were introduced and a mixture was prepared as shown in Table 13 below:

TABLE 13

Component (A)	Dosage of
		2X reaction buffer (Agilent Co.)	25μL
PfuTurbo Cx Hotstart DNA polymerase (Agilent Co.)	0.5μL
		PE primer (25 mu M)	2μL
Enzyme-free pure water	1.5μL
		Total volume of	29μL

The above-mentioned mixed solution was added to 21. Mu.L of an exonuclease digestion reaction system, and the mixture was homogenized by a pipette. Placing at 98 ℃ for 3 minutes; stored at 60℃for 30 minutes and at 4 ℃.

7. Joint ligation reaction

The mixtures were prepared as follows in table 14:

TABLE 14

Component (A)	Dosage of
		ATP (NEB company)	0.8μL
Ligase (NEB company)	2μL
		10 Xreaction buffer (NEB Co.)	8μL
50％PEG 8000	12μL
		Joint (10 mu M)	1μL
Enzyme-free pure water	6.2μL
		Total volume of	30μL

Wherein, the joint is short-chain: GCTACGATCCGACT/ddT/(SEQ ID NO: 17);

Long chain of joint: phos/AAGTCGGATCGTAGCCATGTCGTT/ddC/(SEQ ID NO: 18).

The above-mentioned mixed solution was added to 50. Mu.L of the primer extension reaction system, and the mixture was homogenized by a pipette. The mixture was kept at 37℃for 30 minutes and at 4 ℃.

8. Magnetic bead purification

A) 40 mu L of Ampure XP magnetic beads are added into the reaction sample (80 mu L), the gun head blows the mixed solution of the mixed magnetic beads and the sample for 7-10 times, after 5 minutes of room temperature combination, the gun head is used for blowing again for 7-10 times, after 5 minutes of room temperature combination, the mixture is placed on a magnetic rack for combination for 2 minutes (until the liquid is clear), and the supernatant is carefully sucked and removed.

PCR amplification

The reaction mixtures of Table 15 below were prepared and 20. Mu.L of the above purified product was subjected to PCR:

TABLE 15

Component (A)	Dosage of
		Ligation products	20μL
2×KAPA HiFi HotStart ReadyMix	25μL
		20 Mu M primer 3	2μL
20 Mu M primer 4	2μL
		Water and its preparation method	1μL
Total volume of	50μL

Primer 3: 5Phos/GAACGACATGGCTACGA (SEQ ID NO: 19);

primer 4: TGTGAGCCAAGGAGTTG (SEQ ID NO: 20).

The reaction procedure is as follows in table 16:

Table 16

10. Polyacrylamide gel electrophoresis

6. Mu.L of the PCR product was subjected to polyacrylamide gel electrophoresis at 240V for 20 minutes. FIG. 15 shows the result of polyacrylamide gel electrophoresis of a part of the product of this example, in which lane 12 is the result of electrophoresis of the library product under the library construction conditions of this example.

In addition, the library of the embodiment is subjected to PE50 sequencing and analysis, and PE50 sequencing data shows that the target rate (On TARGET RATE) and the Capture rate (Capture rate) of the PE50 sequencing data are better.

The foregoing description of the invention has been presented for purposes of illustration and description, and is not intended to be limiting. Several simple deductions, modifications or substitutions may also be made by a person skilled in the art to which the invention pertains, based on the idea of the invention. For example, typical but non-limiting examples of deductions, deformations or substitutions include: the hook probe may be designed not only as a DNA probe but also as an RNA probe. The intermolecular linked hybridization complex may be one or more of DNA/DNA, DNA/RNA, RNA/RNA hybridization complex. The elimination of potential intermolecular non-specific linear ligation products can be achieved by other possible means, such as gel cutting recovery or magnetic bead selection, in addition to single strand exonuclease treatment. In the single sided hook probe protocol, other alternatives to the method of linker ligation of the hybridized linker of the non-single sided hook probe are possible in addition to those described herein. In order to enhance the enrichment effect of the target nucleic acid, the target nucleic acid can be improved by changing the reaction conditions such as a hybridization system, hybridization components, hybridization reagents, hybridization temperature and the like, and can also be realized by a mode of performing nest enrichment for two or more times. As described herein, the invention is not limited to the development of high throughput library construction techniques and kits, but can be applied to the development of molecular cloning experiments such as RACE, synthetic biological experiments such as splice of synthetic sequences, and corresponding kits, and can also be applied to the development of biochemical experiments and kits relying on chemiluminescence to indicate detection results such as genotyping, fluorescent quantitative PCR, and the like, and any method which requires detection or extraction of known sequences or information of sequences flanking the known sequences by a segment of known nucleic acid sequences or the use of known sequences to mediate addition of other sequences into known sequence fragments or known sequence flanking fragments.

Claims

1. A method of constructing a nucleic acid sequencing library, the method comprising:

Annealing and hybridizing the hook probe to the denatured nucleic acid fragment to be ligated; the hook probe comprises a target specific region comprising a sequence complementary to at least part of a single strand of a nucleic acid fragment to be ligated and an attached hook region comprising a sequence unpaired with the nucleic acid fragment, the end of the hook region being an ligatable end capable of ligating to the single strand end of the nucleic acid fragment; the hook probe is a 3 'hook probe having the structure 5' - (hook region) - (target specific region) -3', the 5' end of the hook region of the 3 'hook probe having a functional 5' phosphate group capable of ligating to the 3 'end of the nucleic acid fragment, the hook region of the 3' hook probe comprising a universal primer binding site;

ligating a functional 5' phosphate group of the 3' hook probe to the 3' end of the nucleic acid fragment in the presence of a ligase;

In the presence of polymerase, taking the 3 '-end of the 3' -hook probe as a polymerase reaction starting point to carry out extension reaction;

Digesting the linear non-specific ligation product, excess nucleic acid fragments, and excess hook probes using a single strand exonuclease;

Connecting a 5 'joint to the 5' end of the extension reaction product; and

Performing PCR amplification using primer sequences that are fully or partially complementary to the hook region sequences of the 5 'adaptor and the 3' hook probe;

And (3) performing polyacrylamide gel electrophoresis on the PCR product, and confirming the PCR amplification product.

2. The method of claim 1, wherein the nucleic acid fragment to be ligated of the hook probe is a target nucleic acid comprising a target region, the target region being a nucleic acid region to be enriched.

3. The method of construction according to claim 2, wherein the target specific region of the hook probe comprises a sequence complementary to a sequence flanking a target site and/or within a target site of the target nucleic acid or a sequence flanking a site and/or within a site linked to a target site.

4. The method of claim 1, wherein the hook region of the hook probe further comprises a unique molecular tag sequence and/or a sample tag sequence.

5. The method of claim 1, wherein the 3' end of the 3' hook probe has a 3' blocking group that blocks ligation with other single strands or self single strands.

6. The method of construction according to claim 4 or 5, wherein the hook region of the 3 'hook probe comprises a universal primer binding site, a unique molecular tag and/or a sample tag, and the 3' hook probe has the structure 5'- (universal primer binding site) - (unique molecular tag and/or sample tag) - (target specific region) -3'.

7. The method of claim 1, wherein the hook region comprises an enzyme cleavage site.

8. The method of claim 7, wherein the cleavage site is a restriction enzyme recognition binding site and/or one or more modified nucleotides that can be cleaved.