CN111254186B - Method for carrying out molecular detection on clostridium or classifying and identifying strains of clostridium - Google Patents
Method for carrying out molecular detection on clostridium or classifying and identifying strains of clostridium Download PDFInfo
- Publication number
- CN111254186B CN111254186B CN202010246901.4A CN202010246901A CN111254186B CN 111254186 B CN111254186 B CN 111254186B CN 202010246901 A CN202010246901 A CN 202010246901A CN 111254186 B CN111254186 B CN 111254186B
- Authority
- CN
- China
- Prior art keywords
- clostridium
- sequence
- classification
- fusobacterium
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
- Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a method for carrying out molecular detection or classification identification on the strain level of clostridium, which takes rpoB gene as a detection and classification identification target of the clostridium and comprises the following steps: amplifying genes of the sample; carrying out high-throughput sequencing and comparison analysis on the sequence of the amplicon, and establishing OTU according to 100% consistency of obtained data; and comparing the OTU sequence with the sequences corresponding to the characteristic sequence fragments in the whole genome of the clostridium, eliminating non-specific OTU sequences without similarity, establishing an evolutionary tree together, and annotating strains corresponding to all OTUs according to an evolutionary relationship to realize classification and identification of the clostridium group in a sample and quantification of the abundance of different strains. The invention combines the high-throughput sequencing technology to determine the amplicon sequence obtained after the specific primer amplification, and identifies the clostridium strains and even subspecies in the sample by the method of constructing the evolutionary tree, which is helpful to reveal the horizontal structure composition of the clostridium strains in the micro-ecological sample.
Description
Technical Field
The invention relates to the field of biological medicine, in particular to a method for carrying out molecular detection on clostridium or classifying and identifying the level of a strain of the clostridium.
Background
The genus clostridium (Fusobacterium) is a strictly anaerobic gram-negative bacterium, a human commensal bacterium, that usually colonizes the oral cavity. Some clostridia species are opportunistic pathogens that can cause oral diseases such as periodontitis in some cases. Clostridia can also cause infections in other parts of the body. Recent studies have shown that clostridia are also associated with the development of colorectal cancer. 16SrRNA gene sequencing shows that the abundance of the clostridium in the excrement of the colorectal patient is obviously higher than that of normal people; cell and mouse experiments also show that the representative strain of the fusobacterium nucleatum can promote the occurrence and development of colorectal cancer and induce chemotherapy resistance. Therefore, the method has important clinical value for detecting the clostridium.
18 species of Fusobacterium are known, wherein Fusobacterium nucleatum is divided into 4 subspecies, and the currently common detection method for the Fusobacterium in a microecological specimen (such as feces) is difficult to accurately detect to the species level. The 16SrRNA gene sequencing can only achieve the resolution of the genus level; although the metagenome can measure more complete sequence information, the cost is high, the data analysis is complex, and the classification and identification of the strain level cannot be completely ensured. Taking colorectal cancer as an example, the composition structure of the clostridium species in intestinal flora of a colorectal cancer patient is not clear at present, and although researches prove that the representative species fusobacterium nucleatum can promote the occurrence and development of colorectal cancer, the current researches rely on standard strains from oral cavity rather than fusobacterium isolates separated from tumors in situ, and the representativeness of the fusobacterium isolates is still to be verified. Although the qPCR quantitative method of fusobacterium nucleatum is established by research and the fusobacterium nucleatum is proved to be closely related to the colorectal cancer based on the qPCR quantitative method, the primers are not specific to the fusobacterium nucleatum, and also have non-specific amplification to other fusobacterium species, so that the interference of other strains cannot be eliminated. Therefore, an effective molecular detection method for the clostridium in a microecological sample and a classification and identification method for the level of the clostridium strain are still lacked at present.
Disclosure of Invention
The invention provides a method for carrying out molecular detection on clostridium or classifying and identifying the strain level of the clostridium, which is mainly suitable for different types of microecological samples and is also suitable for single strain samples, and can carry out classification and identification on the strain level or even subspecies level on the composition of clostridium flora in the samples.
In order to realize the purpose, the invention adopts the following technical scheme:
the invention provides a method for carrying out molecular detection on clostridium or classifying and identifying the level of the clostridium strain, which takes rpoB gene as a target for detecting and classifying and identifying the clostridium and comprises the following steps:
step one, amplifying genes of a sample;
secondly, carrying out high-throughput sequencing and comparison analysis on the sequence of the amplicon, and establishing an operation classification unit (OTU) according to 100% consistency of the obtained data;
and step three, comparing the OTU sequence obtained in the step two with the sequence corresponding to the characteristic sequence fragment in the whole genome of the clostridium, eliminating non-specific OTU sequences without similarity, establishing an evolutionary tree together, annotating the strain corresponding to each OTU according to the evolutionary relationship, and realizing classification and identification of the clostridium group in the sample and quantification of the abundance of different strains.
Further, the amplification primer sequences in step one are as follows:
fuso-rsub-F2：GCCTCATTTTYTDGARTTYCAATT(SEQ ID NO.4)；
fuso-rsub-R2：ACDACTCTTTCHGCHCCATTKAT(SEQ ID NO.5)。
furthermore, the characteristic sequence in the third step is a conserved sequence with the length of 300bp-500bp, both ends of 15bp-50bp and the middle of a variable region in the comparison result of the rpoB gene multiple sequences.
Furthermore, the characteristic sequence in the third step is shown as SEQ ID NO. 3.
Furthermore, the abundance quantification is calculated according to the quantification of the whole clostridium in a sample and the quantification of different clostridium species in the clostridium, namely, the percentage of the clostridium abundance in the flora is multiplied by the percentage of a certain clostridium species in the clostridium. The percentage of clostridium abundance in the population can be determined by other common means, such as quantitative PCR, 16SrRNA gene amplicon sequencing, or metagenomic sequencing.
Compared with the prior art, the invention has the following beneficial effects by adopting the technical scheme:
the amplification primer adopted by the invention has specificity to the clostridium, and the non-target specificity amplification is less; the amplified product has small fragments which are between 300bp and 500bp, and meets the sequencing requirement of an amplicon; the amplified fragment is a variable region of rpoB gene, has strain specificity in sequence, and can be used for strain classification and identification.
The method for carrying out molecular detection on the clostridium or classifying and identifying the level of the clostridium strain is combined with a high-throughput sequencing technology to determine an amplicon sequence obtained after amplification of a specific primer, and identifies the clostridium strain or even subspecies in a sample by a method for constructing an evolutionary tree, thereby being beneficial to disclosing the level structure composition of the clostridium strain in a microecological sample.
Drawings
Fig. 1 is a view illustrating an evolutionary tree established based on a rpoB full-length sequence and a sequence corresponding to rpoB _ summary _3 according to an embodiment of the present invention;
FIG. 2 is a graph showing the results of amplification of a single isolate of Clostridium bacteria and a clinical specimen based on the primers provided herein according to an embodiment of the present invention;
FIG. 3 is a bar graph of the structures of Clostridium species/subspecies in a Clostridium positive sample according to an embodiment of the present invention; wherein, "subsp" identifies a subspecies of F.nucleatum, and "sp" identifies an unnamed F.species.
Detailed Description
The invention provides a method for carrying out molecular detection or classification identification on the strain level of clostridium, which takes rpoB gene as a detection and classification identification target of the clostridium and comprises the following steps:
amplifying genes of a sample;
secondly, carrying out high-throughput sequencing and comparison analysis on the sequence of the amplicon, and establishing an operation classification unit (OTU) according to 100% consistency of the obtained data;
and step three, comparing the OTU sequence obtained in the step two with the sequence corresponding to the characteristic sequence fragment in the whole genome of the clostridium, eliminating non-specific OTU sequences without similarity, establishing an evolutionary tree together, annotating strains corresponding to all OTUs according to an evolutionary relationship, and realizing classification and identification of the clostridium group in the sample and quantification of the abundance of different strains.
In a preferred embodiment, the amplification primer sequences in step one are as follows:
fuso-rsub-F2：GCCTCATTTTYTDGARTTYCAATT(SEQ ID NO.4)；
fuso-rsub-R2：ACDACTCTTTCHGCHCCATTKAT(SEQ ID NO.5)。
furthermore, the characteristic sequence in the third step is a segment with a conserved sequence with the length of 300bp-500bp, 15bp-50bp at both ends and a variable region in the middle in the comparison result of the rpoB gene multiple sequences.
Furthermore, the characteristic sequence in the third step is shown as SEQ ID NO. 3.
The determination process of the "detection and classification of fusobacterium with rpoB gene" is as follows: whole genome sequencing data for clostridium strains were downloaded from the NCBI genome database and the values of ANIb (i.e., average nucleotide identity using BLAST based on BLAST's average nucleotide sequence identity) between each genome were calculated using Jspecies software. The ANIb value is an index for evaluating the affinity of the strain, and is generally considered to be equal to or more than 95, namely one of the same genus (species). And then identifying the strains with errors according to the seed names in the ANIb value correction database, unifying the seed level classification standard, and finally determining the classification of each genome at the seed level. Wherein, the fusobacterium nucleatum is classified horizontally by subspecies; the relativity of Fusobacterium naviforme and other fusobacterium is far away, and the invention is not considered; genomes that do not meet the RefSeq criteria are not included in the present invention. And further, extracting the complete sequence of the rpoB gene from each genome, carrying out multi-sequence comparison through MUSCLE software, and establishing a phylogenetic tree by MEGA software to determine that the rpoB gene is suitable for the classification of clostridium strains/subspecies.
The determination process of the amplification primers and the characteristic sequences is as follows:
(1) Searching conserved sequences with the length of 300bp-500bp, both ends of 15bp-50bp and fragments with variable regions in the middle in the rpoB gene multi-sequence comparison result, and finding out 3 fragments which meet the requirements in total, wherein the corresponding sequences in the Fusobactrium tuberculosis ATCC 23726 strain are (the sequences have polymorphism and cannot be exhausted, and only representative reference sequences are listed here):
>rpoB_subregion_1
GATTCTCACTATGGAAGAATCTGTCCAATAGAAACACCAGAAGGACCAAACATTGGGCTTATTGGGTCGCTTGCTACTTATGCTAAGATTAATAAATATGGATTTATTGAAACTCCTTATGTAAAAGTAGAAAATGGAGTAGCATTAGTAGATGATGTTCGTTATCTTGCTGCTGATGAAGAAGATGGATTGTTTATAGCCCAAGCAGATACTAAACTTGATAAAAATAATAAGTTACAAGGTTTAGTAGTTTGTAGATATGGTCATGAAATTGTTGAAATAGAACCTGAAAGAGTAAACTATATGGATGTTTCTCCTAAACAAGTTGTATCTGTATCAGCAGGACTTATCCCATTCTTAGAACATGATGATGCCAACAGAGCATTAATGGGATCAAACATGCAAAGACAAGC(SEQ ID NO.1)；
>rpoB_subregion_2
ATGGGATCAAACATGCAAAGACAAGCTGTACCTTTATTAAAGTCAGAAGCTCCTTTCATAGGAACAGGGCTTGAAAGAAAAGTTGCAGTAGACTCAGGTGCAGTAGTAACTACAAAAGTATCAGGAAAAGTTACTTATGTAGATGGTAAAAAAATAATAATTGAAGATAAAGATAAAAAAGAACATATATACAGACTTTTAAACTATGAAAGATCTAACCAATCAATGTGTTTACATCAAACACCTTTGGTAGATTTAGGAGATAAAGTAAAAACTGGAGATATAATTGCAGATGGACCTGCTACAAAGCTAGGAGATTTATCATTAGGAAGAAATATTCTTATGGGATTTATGCCTTGGGAAGGATATAACTATGA(SEQ ID NO.2)；
>rpoB_subregion_3
ATGCCTCATTTTCTTGAATTCCAATTAAATTCTTATGAAGATTTTTTACAAACTAATATGTCACCTAACAAAAGGGAAGAAAAGGGATTTGAATTAGCATTCAAAGAGATATTCCCAATAGAATCTTCAAATGGAGATGTAAGGCTAGAATATATAGGATATGAATTACATGAAGCAGAAGCACCATTGAATGATGAGCTTGAATGTAAAAAAAGAGGAAAAACGTATTCTAATTCATTGAAAGTTAGATTAAGACTTATAAACAAAAAAATGGGAAATGAAATCCAAGAATCTTTGGTATATTTTGGAGAAGTCCCTAAAATGACTGATAGAGCAACATTTATAATAAATGGAGCTGAAAGAGTTGT(SEQ ID NO.3)。
(2) Through MEGA tree building analysis, the regions corresponding to the 3 segments in the clostridium strain can reflect interspecies evolutionary differences, and are similar to the evolutionary tree of full-length rpoB. Then, the 3 fragments are compared in an NCBI database to find that the region corresponding to the rpoB _ subection _3 is more specific to the clostridium and is suitable for detecting the clostridium. The sequences corresponding to rpoB _ separation _1 and rpoB _ separation _2 are not used for fusobacterium detection, but can be used for fusobacterium classification and identification.
(3) Finally, a universal primer is designed based on the rpoB _ separation _3 fragment, specifically, the primer is designed based on the conserved regions at the two ends of the sequence corresponding to the rpoB _ separation _3 fragment.
In addition, if the sample is a single cell, in addition to the above sequencing method, the amplicon sequence can be obtained by a first generation sequencing method, and the species can be identified according to the above method.
The present invention will now be described in detail and specifically by the following examples to provide a better understanding of the present invention, but the following examples are not intended to limit the scope of the present invention.
Example one
This example provides the use of the above described methods for molecular detection of clostridia or for classification and identification of the species level thereof in sequenced genomes.
Whole genome sequencing data for clostridium strains were downloaded from the NCBI genome database and the database was corrected for the wrong strain by its seed name based on the ANIb values between whole genomes. Wherein, the fusobacterium nucleatum is classified horizontally for subspecies; fusobacterium naviforme and genomes that do not meet the RefSeq criteria were not included in the analysis. And further, extracting the complete sequence of the rpoB gene and the fragment corresponding to the rpoB _ deletion _3 from each genome, respectively performing multi-sequence comparison through MUSCLE software, and then establishing the evolutionary tree by using MEGA software.
As shown in FIG. 1, it is demonstrated that the fragment corresponding to rpoB _ replication _3 can distinguish Clostridium at the species level, and the classification effect is similar to that of the full-length sequence of rpoB.
Example two
This example examined the amplification specificity of primers shown in SEQ ID No. 4-5 in a single isolate of Clostridium and clinical specimens.
The primer sequences provided by the invention have degenerate basic groups, so that different fusobacterium strains in the same genus need to be effectively amplified, and the universality of the primer sequences is detected by adopting different fusobacterium strains. And simultaneously, whether the DNA extracted from the stool specimen of the colorectal cancer patient has positive amplification is detected.
As shown in FIG. 2, the primers provided by the invention obtain specific bright bands with uniform fragment length in different single isolates of clostridium, and the good universality of the primers is fully verified. In the fecal specimen, a specific strip with uniform fragment length can be obtained by amplification, and the negative amplification is performed in the negative control with human blood DNA as a template, which indicates that the primer specificity is better.
EXAMPLE III
This example provides the use of the above method in the feces of 20 colorectal cancer patients to verify the reliability of the method.
Preoperative feces from 20 patients with primary colorectal cancer were collected, amplicon sequencing was performed according to the method of the invention, and the data was analyzed.
As shown in FIG. 3, the presence of Clostridium was detected in 12 samples in total, and in these samples, 96% of reads (sequencing fragments) obtained by amplification sequencing were the target sequence specific to Clostridium, and only 4% of reads were the non-specific sequence. The resulting sequences can be combined into 18 OTU's, and classified into 16 Clostridium species/subspecies, 8 of which are known and 8 of which are unknown. Analysis of the composition of Clostridium bacteria in each sample revealed that the feces of these patients were generally dominated by a particular species of Clostridium bacteria. Therefore, the method provided by the invention can be used for more finely observing the structural composition of the clostridium population in the microecological sample.
The embodiments of the present invention have been described in detail, but the embodiments are merely examples, and the present invention is not limited to the embodiments described above. Any equivalent modifications and substitutions to those skilled in the art are also within the scope of the present invention. Accordingly, equivalent alterations and modifications are intended to be included within the scope of the present invention, without departing from the spirit and scope of the invention.
Sequence listing
<110> tenth national hospital in Shanghai City
<120> a method for molecular detection of fusobacterium or classification and identification of the strain level thereof
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 413
<212> DNA
<213> Artificial Sequence
<400> 1
gattctcact atggaagaat ctgtccaata gaaacaccag aaggaccaaa cattgggctt 60
attgggtcgc ttgctactta tgctaagatt aataaatatg gatttattga aactccttat 120
gtaaaagtag aaaatggagt agcattagta gatgatgttc gttatcttgc tgctgatgaa 180
gaagatggat tgtttatagc ccaagcagat actaaacttg ataaaaataa taagttacaa 240
ggtttagtag tttgtagata tggtcatgaa attgttgaaa tagaacctga aagagtaaac 300
tatatggatg tttctcctaa acaagttgta tctgtatcag caggacttat cccattctta 360
gaacatgatg atgccaacag agcattaatg ggatcaaaca tgcaaagaca agc 413
<210> 2
<211> 377
<212> DNA
<213> Artificial Sequence
<400> 2
atgggatcaa acatgcaaag acaagctgta cctttattaa agtcagaagc tcctttcata 60
ggaacagggc ttgaaagaaa agttgcagta gactcaggtg cagtagtaac tacaaaagta 120
tcaggaaaag ttacttatgt agatggtaaa aaaataataa ttgaagataa agataaaaaa 180
gaacatatat acagactttt aaactatgaa agatctaacc aatcaatgtg tttacatcaa 240
acacctttgg tagatttagg agataaagta aaaactggag atataattgc agatggacct 300
gctacaaagc taggagattt atcattagga agaaatattc ttatgggatt tatgccttgg 360
gaaggatata actatga 377
<210> 3
<211> 368
<212> DNA
<213> Artificial Sequence
<400> 3
atgcctcatt ttcttgaatt ccaattaaat tcttatgaag attttttaca aactaatatg 60
tcacctaaca aaagggaaga aaagggattt gaattagcat tcaaagagat attcccaata 120
gaatcttcaa atggagatgt aaggctagaa tatataggat atgaattaca tgaagcagaa 180
gcaccattga atgatgagct tgaatgtaaa aaaagaggaa aaacgtattc taattcattg 240
aaagttagat taagacttat aaacaaaaaa atgggaaatg aaatccaaga atctttggta 300
tattttggag aagtccctaa aatgactgat agagcaacat ttataataaa tggagctgaa 360
agagttgt 368
<210> 4
<211> 24
<212> DNA
<213> Artificial Sequence
<400> 4
gcctcatttt ytdgarttyc aatt 24
<210> 5
<211> 23
<212> DNA
<213> Artificial Sequence
<400> 5
acdactcttt chgchccatt kat 23
Claims (4)
1. A method for molecular detection or classification and identification of the strain level of Fusobacterium is characterized in thatrpoBThe gene is used as a target for detecting and classifying and identifying the fusobacterium, and comprises the following steps:
step one, amplifying genes of a sample;
secondly, carrying out high-throughput sequencing and comparison analysis on the sequence of the amplicon, and establishing OTU according to 100% consistency of the obtained data;
comparing the OTU sequence in the step two with the sequence corresponding to the characteristic sequence fragment in the whole genome of the clostridium, eliminating non-specific OTU sequences without similarity, establishing an evolutionary tree together, annotating strains corresponding to each OTU according to an evolutionary relationship, and realizing classification and identification of the clostridium group in the sample and quantification of the abundance of different strains;
the sequence of the primer used for amplification in the first step is shown as SEQ ID NO. 4-SEQ ID NO. 5.
2. The method for molecular detection of Clostridium bacteria or for classification and identification of the species level thereof according to claim 1, wherein the characteristic sequence in step three isrpoBThe length of the gene multi-sequence comparison result is between 300bp and 500bp, the two ends are conserved sequences of 15bp to 50bp, and the middle is a segment of a variable region.
3. The method for molecular detection of Clostridium bacteria or for classification of the species level thereof according to claim 2, wherein the signature sequence of step three is represented by SEQ ID NO. 3.
4. The method for molecular detection or classification of the species level of fusobacterium according to claim 1, wherein said quantitative abundance is calculated from the quantification of the fusobacterium as a whole in a sample and the quantification of different fusobacterium species in the fusobacterium.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010246901.4A CN111254186B (en) | 2020-03-31 | 2020-03-31 | Method for carrying out molecular detection on clostridium or classifying and identifying strains of clostridium |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010246901.4A CN111254186B (en) | 2020-03-31 | 2020-03-31 | Method for carrying out molecular detection on clostridium or classifying and identifying strains of clostridium |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111254186A CN111254186A (en) | 2020-06-09 |
| CN111254186B true CN111254186B (en) | 2023-04-07 |
Family
ID=70948083
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010246901.4A Active CN111254186B (en) | 2020-03-31 | 2020-03-31 | Method for carrying out molecular detection on clostridium or classifying and identifying strains of clostridium |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111254186B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112980975A (en) * | 2021-03-08 | 2021-06-18 | 上海市第十人民医院 | Subspecies detection and identification method of fusobacterium nucleatum |
| CN113403409A (en) * | 2021-06-13 | 2021-09-17 | 中国疾病预防控制中心传染病预防控制所 | Bacterial species level detection and analysis method based on bacterial 16S rRNA gene sequence |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120112001A (en) * | 2011-03-29 | 2012-10-11 | 조선대학교산학협력단 | Primers for detecting bacteria related to oral infectious diseases and use thereof |
| CN108103149A (en) * | 2018-03-02 | 2018-06-01 | 四川知几未来健康管理有限公司 | Detection Nucleic acid combinations, kit, chip and its application of a kind of Fusobacterium nucleatum |
| CN109797202A (en) * | 2019-03-13 | 2019-05-24 | 上海市第十人民医院 | It is a kind of for detecting the kit and its method of Fusobacterium nucleatum |
-
2020
- 2020-03-31 CN CN202010246901.4A patent/CN111254186B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20120112001A (en) * | 2011-03-29 | 2012-10-11 | 조선대학교산학협력단 | Primers for detecting bacteria related to oral infectious diseases and use thereof |
| CN108103149A (en) * | 2018-03-02 | 2018-06-01 | 四川知几未来健康管理有限公司 | Detection Nucleic acid combinations, kit, chip and its application of a kind of Fusobacterium nucleatum |
| CN109797202A (en) * | 2019-03-13 | 2019-05-24 | 上海市第十人民医院 | It is a kind of for detecting the kit and its method of Fusobacterium nucleatum |
Non-Patent Citations (4)
| Title |
|---|
| "Application of rpoB and Zinc Protease Gene for Use in Molecular Discrimination of Fusobacterium nucleatum Subspecies";Hwa-Sook Kim等;《JOURNAL OF CLINICAL MICROBIOLOGY》;第48卷(第2期);第545-553页 * |
| "Fusobacterium nucleatum subsp. nucleatum ATCC 23726 chromosome, complete genome，GenBank: CP028109.1";Slade,D.J.等;《GenBank》;第1-417页 * |
| "Profiling Fusobacterium infection at high taxonomic resolution reveals lineage-specific correlations in colorectal cancer";Dexi Bi等;《NATURE COMMUNICATIONS》;第13卷;第1-12页 * |
| "坏死梭杆菌检测方法研究进展";姚志利等;《动物医学进展》;第31卷(第5期);第99-103页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111254186A (en) | 2020-06-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Castellarin et al. | Fusobacterium nucleatum infection is prevalent in human colorectal carcinoma | |
| Agriculture et al. | Molecular methods to measure intestinal bacteria: a review | |
| CN111254186B (en) | Method for carrying out molecular detection on clostridium or classifying and identifying strains of clostridium | |
| CN113481311B (en) | SNP molecular marker for identifying Brucella vaccine strain M5 and application thereof | |
| Zhang et al. | Development of hydrolysis probe-based real-time PCR for identification of virulent gene targets of Burkholderia pseudomallei and B. mallei—a retrospective study on archival cases of service members with melioidosis and glanders | |
| CN104946769B (en) | The kit of mycoplasma pneumoniae quick detection and Genotyping | |
| Eshraghi | Molecular typing of Nocardia species | |
| CN114507738A (en) | Methylation site, application of product for detecting methylation level and kit | |
| CN109652493B (en) | Use of genus oscillatoria for identifying and/or differentiating individuals of different ethnic groups | |
| US11359251B2 (en) | Methods for the detection of enterovirus D68 in complex samples | |
| Fibi et al. | Suppression subtractive hybridisation and real-time PCR for strain-specific quantification of the probiotic Bifidobacterium animalis BAN in broiler feed | |
| EP3857554A1 (en) | Method and apparatus for analysing a sample | |
| US20210355526A1 (en) | Molecular typing of microbes | |
| KR102597909B1 (en) | Primer set for detecting phascolarctobacterium and use thereof | |
| CN112538540B (en) | Kit and system for detecting mycobacterium kansasii | |
| KR102611219B1 (en) | Primer set for detecting roseburia and use thereof | |
| CN116814822B (en) | Identification method and application of bifidobacterium longum subspecies infancy CICC 6069 strain | |
| CN112538541B (en) | Kit and system for detecting M.intracellulare | |
| CN112538542B (en) | Kit and system for detecting mycobacterium cheloni | |
| US11781191B2 (en) | Compositions and method for detecting Mycobacterium riyadhense | |
| CN109609668B (en) | Detection primer group and kit for MLVA typing of salmonella typhimurium and application of detection primer group and kit | |
| CN115678896A (en) | Isolated nucleic acid and application thereof, primer group, reagent, kit and detection method | |
| CN112048552B (en) | Intestinal flora for diagnosing myasthenia gravis and application thereof | |
| CN112538539B (en) | Kit and system for detecting mycobacterium avium | |
| JP5097785B2 (en) | Identification method of Mycoplasma and Ureaplasma species |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |