CN111254152A - Acetyl xylan esterase gene, its coding product and preparation method - Google Patents

Abstract

The invention discloses an acetyl xylan esterase gene, a coding product and a preparation method thereof, wherein the acetyl xylan esterase gene is named as Est1051, and the nucleotide sequence of the acetyl xylan esterase gene is shown as SEQ ID NO. 1; the amino acid sequence of the acetyl xylan esterase gene is shown as SEQ ID NO.2, the invention also discloses a recombinant plasmid pET28a-Est1051 containing the acetyl xylan esterase gene, and the invention also discloses a preparation method of the acetyl xylan esterase, wherein the acetyl xylan esterase gene Est1051 is overexpressed in an escherichia coli prokaryotic expression system, and the acetyl xylan esterase is efficiently and soluble expressed in an escherichia coli expression system. Meanwhile, the acetyl xylan esterase obtained by the method has high catalytic activity and thermal stability, and has great industrial production and application prospects.

Description

A kind of acetylxylan esterase gene, its encoded product and preparation method

technical field

The invention relates to the technical field of gene recombination, in particular to the technology of how to obtain an acetylxylan esterase gene and its encoded product.

Background technique

Hemicellulose is the most abundant renewable biological resource in nature other than cellulose. Xylan is an important component of hemicellulose in plant cell walls, accounting for about 15%-35% of the dry weight of plant cells. In these xylose polymers, groups such as acetyl, arabinosyl, ferulic acid and 4-O-methyl-D-glucuronic acid residues are widely connected to form different side chain groups, so xylan has variety of structures. The presence of acetyl groups on the side chain of xylan hinders the degradation of xylan by xylanase, which in turn affects the hydrolysis efficiency of the substrate, creates steric barriers, and limits the contact between the main chain degrading enzyme and the main chain. Reduced accessibility.

Acetyl xylan esterase (AXE) can eliminate the O-acetyl substituents at positions C-2 and C-3 of xylose residues in acetylated xylan, thereby improving the ability of xylanase to the main chain. accessibility, improving the hydrolysis efficiency of xylanases in the cell wall. Acetylxylan esterase is one of the least understood plant cell wall degrading enzymes. After the enzyme was first discovered in 1985, more and more different types of acetylxylan esterases were discovered and studied. Industrial degradation of xylan often adopts acid method or alkali method, but the acid and alkali hydrolysis process is often accompanied by side reactions, resulting in more toxic substances, which have an inhibitory effect on microbial fermentation in the later stage, and the acid and alkali waste liquids produced will be harmful. Therefore, the enzymatic degradation of xylan will become the main way of xylan degradation in the future because of its mild and environmental advantages.

As a member of the hemicellulase family, acetylxylan esterase has good application prospects. In the construction of engineering bacteria, the study of acetylxylan esterase is of great significance for the construction of hemicellulase engineering bacteria with high yield and excellent synergistic effect. In industrial applications, acetylxylan esterase can synergize with endo-xylanase and β-xylosidase to completely degrade hemicellulose into xylose, and then into xylitol. In addition, some acetylxylan esterases can act on the acetyl group of chitin, so chitosan can be prepared by enzymatic method, which has broad application prospects in medicine, textile, paper, cosmetics and so on.

At present, compared with other lignocellulose degrading enzymes, the research on acetylxylan esterase is far from enough. The synergistic effect of acetylxylan esterase and other lignocellulose degrading enzymes has been recognized, and its potential application The value has yet to be developed.

SUMMARY OF THE INVENTION

The first object of the present invention is to provide a gene of acetylxylan esterase and a preparation method thereof.

The second object of the present invention is to provide an acetyl xylan esterase and a preparation method thereof.

The third object of the present invention is to provide a recombinant plasmid pET28a-Est1051 of acetylxylan esterase.

The fourth object of the present invention is to provide recombinant engineering bacteria containing the above-mentioned acetylxylan esterase.

The first object, the third object, and the fourth object of the present invention are achieved through the following technical solutions: a gene of acetyl xylan esterase, named Est1051, whose nucleotide sequence is such as SEQ ID NO .1 shows:

The steps of gene preparation are as follows:

(1) Extract the total DNA from the sample, purify the total DNA, and digest the total DNA;

(2) recovering the DNA fragment obtained in step (1) after the restriction enzyme cut, and connecting the DNA fragment and the pUC118 vector to obtain a plasmid;

(3) transforming the plasmid obtained in step (2), screening the library and identifying the positive clones;

(4) Sequencing, the plasmid was named pUC118-Est1051, and PCR primers were designed;

(5) Using plasmid pUC118-Est1051 as a template, PCR amplification was performed for gene cloning;

(6) Purify the PCR product to obtain the acetylxylan esterase gene.

Further, the PCR primers are:

Est1051-F: CCG GAATTC CCCGTTGCGGTGTCATTATACTGAC

(The underlined part is the restriction site of EcoRI);

Est1051-R: CCG CTCGAG GCTCCCGAAGAACCTATGAAACCAATTG

(The underlined part is the restriction site of XhoI).

Further, the operation of described step (5) is: take plasmid pUC118-Est1051 as template, Est1051-F and Est1051-R as primers, adopt Prime STAR ^TM Max Premix to carry out PCR amplification of Est1051 gene fragment, the system is as follows:

The reaction conditions for PCR are:

The first stage: denaturation at 95°C for 2min;

The second stage: denaturation at 95°C for 10sec, annealing at 60°C for 5sec, extension at 72°C for 5sec, a total of 30 cycles;

The third stage: extension at 72°C for 10 min, and finally stored at 4°C.

The second object of the present invention is achieved through the following technical solutions: a kind of acetyl xylan esterase, its amino acid sequence is as shown in SEQ ID NO.2:

Enzyme preparation method:

The acetylxylan esterase gene of claim 1 is connected with the pET-28a(+) expression vector, and the ligation product recombinant plasmid pET-28a(+)-Est1051 is obtained, and the recombinant plasmid is transformed into Escherichia coli BL21 competent cells to form The recombinant engineering bacteria are cultured and crushed to obtain crude enzyme liquid, which is purified to obtain acetylxylan esterase.

In more detail, the acetylxylan esterase gene of claim 1 is connected with the pET-28a(+) expression vector to obtain the ligation product recombinant plasmid pET-28a(+)-Est1051, and the recombinant plasmid is transformed into Escherichia coli BL21 to sense The recombinant engineering bacteria are formed in the state cells, and the recombinant engineering bacteria are inoculated in the LB liquid medium for activation, and then the recombinant engineering bacteria mother liquor with an OD _600nm =1.2 after the activation is inoculated in another LB liquid medium, and the final concentration is added. It was 0.8mM IPTG, cultured at 37°C for 10h, centrifuged to remove the supernatant, and crushed to obtain a crude enzyme solution, which was purified to obtain acetylxylan esterase.

Beneficial effects of the present invention:

①The present invention obtains a new acetylxylan esterase gene Est1051 from the preliminary screening in the laboratory. Est1051 is a complete acetylxylan esterase gene with a size of 1051bp, and uses BLAST to compare its nucleotide sequence for homology. Sexual search analysis showed that the acetylxylan esterase gene Est1051 was far related to known genes.

②The function of the acetylxylan esterase gene was studied by genetic engineering technology, and it was found that the sequence was highly soluble and expressed in Escherichia coli BL21. After protein purification and SDS-PAGE electrophoresis, a single protein band was obtained. The vector encoding thioredoxin and hexahistidine tags are fused and expressed with the target protein, so the relative molecular weight of the recombinant acetylxylan esterase in electrophoresis is about 50kDa.

3. The present invention clones the DNA sequence shown in SEQ ID NO.1 into a prokaryotic expression vector, transforms it into Escherichia coli BL21 competent cells, obtains a recombinant protein by inducing expression of the positive clone, and studies its enzymatic properties, and the results are as follows :

(1) In the Escherichia coli expression system, the recombinant protein has high-efficiency soluble expression.

(2) Using p-nitrophenol acetate as a substrate, the optimum reaction temperature of the acetyl xylan esterase is 40°C, and the remaining enzyme activity is above 50% when the temperature is between 4 and 45°C. , good stability, indicating that the recombinant acetylxylan esterase has the advantages of high temperature resistance and thermal stability; the optimal reaction pH of the recombinant protein is 7.0, and the remaining enzyme activity is more than 50% between pH 5-7.5 , good stability; when the metal ion concentration is 1mM, Zn2+ and Mn2+ can promote the enzyme activity, when the metal ion concentration is 10mM, Mg2+ and Fe2+ can promote the enzyme activity, indicating that the recombinant enzyme has a high degree of Resistance to metal ions. In addition, 1% DMSO and methanol can promote the enzyme activity, but with the increase of isopropanol and TritonX-100 concentration, the enzyme activity of recombinant acetylxylan esterase increases, indicating that the recombinant acetylxylan esterase Esterases have a high degree of tolerance to organic solvents.

Description of drawings

The accompanying drawings described here are used to provide a further understanding of the present invention and constitute a part of this application, and do not constitute an improper limitation of the present invention. In the accompanying drawings:

Fig. 1 is the agarose gel electrophoresis picture of the PCR product of acetylxylan esterase gene Est1051 in Example 1 of the present invention;

Fig. 2 is the embodiment of the present invention 1 recombinant plasmid digestion electrophoresis verification experiment diagram;

Fig. 3 is the electrophoretogram of the effect of different induction temperatures on the expression level of recombinant acetylxylan esterase;

Fig. 4 is the electrophoretogram of the influence of different induction time on the expression level of recombinant acetylxylan esterase;

Figure 5 is a statistical graph of the effect of different induction times on the enzyme activity of recombinant acetylxylan esterase;

Figure 6 is an electropherogram showing the effect of different IPTG inducing concentrations on the expression level of recombinant acetylxylan esterase;

Fig. 7 is a statistical graph of the effect of different IPTG inducing concentrations on the enzyme activity of recombinant acetylxylan esterase;

Figure 8 is an electropherogram showing the effect of different starting cell concentrations on the expression level of recombinant acetylxylan esterase;

Fig. 9 is a statistical graph of the effect of different starting cell concentrations on the enzyme activity of recombinant acetylxylan esterase;

Figure 10 is the SDS-PAGE electrophoresis image of crude recombinant protein and purified recombinant protein;

Figure 11 is a pNP standard curve graph;

Figure 12 is a graph showing the effect of temperature on the activity and stability of recombinant acetylxylan esterase;

Figure 13 is a graph showing the effect of pH on the activity and stability of recombinant acetylxylan esterase;

Figure 14 is a statistical graph of the effect of different metal ions on the substrate degradation activity of recombinant acetylxylan esterase;

Figure 15 is a statistical graph of the effect of different organic solvents on the activity of recombinant acetylxylan esterase to degrade substrates;

Figure 16 is a statistical graph of the salt tolerance of recombinant acetylxylan esterase Est1051 to degrade substrates.

Detailed ways

The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. The illustrative embodiments and descriptions of the present invention are used to explain the present invention, but are not intended to limit the present invention.

Example 1 Cloning of acetylxylan esterase gene Est1051 and construction of recombinant expression plasmid

1. Primer design and synthesis of acetylxylan esterase gene Est1051

Total DNA was extracted from soil samples in the wild asafoetida distribution area of Shihezi Nanshan in the southern margin of the Junggar Basin, Xinjiang. The extraction method was as follows:

(1) Take 12 autoclaved 5mL centrifuge tubes, weigh 1.25g of soil samples, add 1.5ml of DNA extraction buffer respectively, activate at 37°C for 30min on a shaker at 130rpm/min.

(2) Take out the centrifuge tube and add 300 μL of 10% SDS respectively.

(3) In a water bath at 65°C for 2 hours, invert and mix gently every 15mim.

(4) Take out the sample, after cooling, centrifuge for 10 min at 4°C, 10000 rpm/min.

(5) Transfer the supernatant to a new 5mL centrifuge tube, centrifuge at 4°C, 10000rpm/min for 20min.

(6) After taking the supernatant, add 0.7 times the volume of isopropanol, mix gently, and let it stand at room temperature for 1 hour.

(7) 4°C, 10000rpm/min, centrifugation for 30min.

(8) Discard the supernatant and wash the pellet once with 75% ethanol pre-cooled at 4°C. 4°C, 10000rpm/min, centrifugation for 10min. Dry at room temperature.

(9) Add 20 μL of TE solution preheated at 65°C to each tube, and incubate at 65°C for 5 minutes to dissolve the genomic DNA to obtain total DNA.

Then use the Gel Extraction Kit (D2500-01) of OMEGA company in the United States to purify the DNA, and then use 1% agarose gel electrophoresis to perform metagenomic electrophoresis to detect the purity and quality of the total DNA to ensure the A ₂₆₀ /A ₂₈₀ of the purified DNA. If the ratio is higher than 1.8, the total DNA is partially digested with the restriction enzyme BamH I, and the digested fragments are detected by electrophoresis in the same way. The -8kb enzyme-cut fragment was ligated with the pUC118 vector overnight at 16°C using T4 DNA Ligase to obtain a plasmid, followed by plasmid transformation, library screening and positive clone identification; after the identification was correct, the plasmid was sent to a sequencing company for analysis Sequencing, the determined nucleotide sequence was analyzed and compared by the BLASTn software of NCBI, and the sequencing results showed that the nucleotide sequence was an acetylxylan esterase gene, consisting of 1051 bases, named Est1051, and its nucleic acid sequence is as follows: shown in SEQ ID NO.1.

The plasmid that was sequenced was named pUC118-Est1051;

According to the gene sequence of acetylxylan esterase gene Est1051, two PCR primers were designed: Est1051-F and Est1051-R, and two restriction sites EcoRI and XhoI were introduced. The specific primer sequences were designed as follows:

Est1051-F: CCG GAATTC CCCGTTGCGGTGTCATTATACTGAC

(The underlined part is the restriction site of EcoRI);

Est1051-R: CCG CTCGAG GCTCCCGAAGAACCTATGAAACCAATTG

(The underlined part is the restriction site of XhoI).

Entrusted Guangzhou Qingke Biotechnology Co., Ltd. to synthesize primers.

2. Cloning of acetylxylan esterase gene Est1051

Using the plasmid pUC118-Est1051 as the template and Est1051-F and Est1051-R as the primers, the PCR amplification of the Est1051 gene fragment was carried out using PrimeSTAR ^TM Max Premix. The system is as follows:

The PCR amplification cycle reaction conditions are as follows:

The first stage: denaturation at 95°C for 2min;

The second stage: denaturation at 95°C for 10sec, annealing at 60°C for 5sec, extension at 72°C for 5sec, a total of 30 cycles;

The third stage: extension at 72°C for 10 min, and finally stored at 4°C.

3. Purification of PCR products

Add 5 μL of PCR product to a certain amount of 6×Loading Buffer, identify by 1% agarose gel electrophoresis, purify the PCR product by agarose cutting gel recovery method and check the purity, and store at -20°C.

Specific steps are as follows:

(1) Electrophoresis: use a 1% agarose gel containing 1 μL of EB substitute, electrophoresis at 180V for 45 minutes and observe in a gel imager. As shown in Figure 1, M is 2000kb DNAmaker, and 1 is Est1051 PCR amplification product , 2 is the blank control;

(2) Cut the gel: cut the PCR product agarose gel band in the gel imager, rinse it with deionized water, and place it in a 2mL centrifuge tube;

Gel Extraction Kit试剂盒回收PCR产物DNA，具体步骤如下：(3) Purification: use

The PCR product DNA was recovered by the Gel Extraction Kit, and the specific steps were as follows:

①Weigh the mass of the agarose gel containing the PCR product agarose gel band;

② Add solution Bing Buffer to the centrifuge tube according to the ratio of 100 μL Bing Buffer per 0.1 g of agarose gel;

③Put the centrifuge tube containing the Bing Buffer gel in a 60°C water bath, and shake and mix every 2-3 minutes until the agarose gel is completely melted;

④Put the HiBind DNA column in a 2mL collection tube, and transfer the solution obtained in step ③ to the HiBind DNA column. After standing for 2min, centrifuge at 14,000rpm for 1min;

⑤ Discard the filtrate, put the column back into the collection tube, add 700 μL of Wash Buffer, centrifuge at 10,000 rpm for 1 min, and repeat this step;

⑥ Discard the filtrate, put the column back into the collection tube, and centrifuge at 14,000 rpm for 2 minutes to dry the column matrix;

⑦Put the HiBind DNA column in a new 1.5mL centrifuge tube, add ultrapure water dropwise to the center of the column, let it stand for 2 minutes, and then centrifuge at 14,000 rpm for 2 minutes. The liquid at the bottom of the tube is the purified PCR product, which can be stored at -20°C spare.

(4) Detection of purity: Using a nucleic acid detector, take 1 μL of the purified product for detection, and ensure that the A ₂₆₀ /A ₂₈₀ ratio of the purified DNA is higher than 1.8.

4. Ligation of acetylxylan esterase gene Est1051 and pET-28a(+) expression vector

The PCR product was double-digested with the restriction enzymes EcoRI and XhoI at 37°C for 30 min, the pET-28a(+) expression vector was double-digested with EcoRI and XhoI, and the double-digested pET-28a(+) expression vector was double-digested with TaKaRa T4 DNALigase. 28a and the PCR product were ligated and ligated overnight at a constant temperature of 16°C to obtain pET-28a(+)-Est1051. The connection system is as follows:

5. Conversion of Ligation Products

(1) Take out a tube of E. coli (E.coli BL21(DE3)) competent cells from the -80°C ultra-low temperature freezer, and place it on ice to thaw slowly.

(2) Mix 5 μL of the ligation product with 100 μL of competent cells and place on ice for 30 min.

(3) The ligation product was transformed into competent cells by heat shock method: the mixture was heat-treated in a constant temperature water bath at 42° C. for 1.5 min, and then inserted into ice to cool for 2 min.

(4) Add 500 μL of pre-warmed SOC liquid medium, and shake for 45 min-1 h at 37°C and 180 rpm;

(5) The culture containing pET-28a(+)-Est1051 was spread on kanapenicillin-resistant LB solid plate (containing 50 μg/mL Kan and 40 μg/mL X-gal), and cultured in a constant temperature incubator at 37°C overnight.

6. Recombinant plasmid digestion verification

White monoclonal clones were randomly picked from the transformed plates, the plasmids were extracted, and double-enzyme digestion was performed, and agarose gel electrophoresis was used to verify the digestion products. The verification results are shown in Figure 2: M is 15000kb DNAMaker, 1 is the recombinant plasmid pET-28a(+)-Est1051 double digested by EcoRI and XhoⅠ, 2 is the recombinant plasmid pET-28a(+)- Est1051. It can be seen that EST1051 has been ligated into the expression vector pET-28a(+).

Example 2 Optimization and purification of inducible expression of acetylxylan esterase gene Est1051

The seed solution was prepared according to the following method: single colonies of the recombinant expression strains were selected and placed in 5 mL of LB liquid medium, and cultured overnight at 37° C. and 180 rpm with shaking for 12 h.

(1) Determination of the optimal induction temperature

Three different experimental groups were set up according to different induction temperatures. The operation of each test sample in each experimental group was as follows: aspirate 500 μL of culture solution from the spare seed solution into 50 mL of LB liquid medium, at 30 °C and 220 rpm under the conditions When the cell density OD _600nm is 1.0, IPTG with a final concentration of 0.1 mM was added, and the test samples of each experimental group were placed in a constant temperature shaker at 25°C, 37°C and 40°C, respectively, and the culture was induced by shaking at 220 rpm for 8 h. . The cells induced by different temperature conditions were collected by centrifugation at 14,000 rpm for 2 min, and subjected to SDS-PAGE protein gel electrophoresis to determine the optimal induction temperature. The results are shown in Figure 3, M is the protein marker, and 1, 2, and 3 are the protein expressions at 25°C, 37°C, and 40°C, respectively. Electrophoresis shows that the amount of protein at 37°C is the largest, indicating that the recombinant strain is at a temperature of 37°C. The lower expression works best.

(2) Determination of the optimal induction time

Set up 7 different experimental groups according to different induction times. The operation of each test sample in each experimental group is as follows: from the standby seed solution, draw 500 μL of culture solution into 50 mL of LB liquid medium, and at 30 ° C, 220 rpm conditions The cells were cultured under shaking until the cell density OD _600nm was 1.0, and IPTG was added at a final concentration of 0.1 mM. The test samples of each experimental group were shake-induced and cultured for 2h, 4h, 6h, 8h, 10h, 12h and 14h respectively at 37°C and 220rpm. The cells were collected by centrifugation at 14,000 rpm for 2 min after different induction time conditions. The bacteria were washed and broken under the same conditions, and their activity was detected (the highest enzyme activity was 100%), and SDS-PAGE protein gel electrophoresis was performed at the same time to determine the optimal induction time. The results are shown in Figure 4-5, where M is a protein marker. 6h, 8h, 10h, 12h and 14h enzyme activity test, electrophoresis and enzyme activity test results comprehensively show that the expression effect is the best at 10h. Therefore, the best time to induce expression of recombinant protein is 10h.

(3) Determination of optimal IPTG inducing concentration

According to different IPTG induction concentrations, 6 different experimental groups were set up. The operation of each test sample in each experimental group was as follows: from the standby seed solution, draw 500 μL of culture solution into 50 mL of LB liquid medium, and at 30°C, Under the condition of shaking at 220rpm, when the cell density OD _600nm was 1.0, different amounts of IPTG were added to the test samples of each experimental group to make the final concentrations respectively 0.0mM, 0.4mM, 0.6mM, 0.8mM, 1.0mM, 1.2 mM, at 37°C and 220rpm for 10h shaking induction. The induced cells were collected by centrifugation at 14,000 rpm for 2 min. The bacteria were washed and broken under the same conditions, and the activity was detected (the highest enzyme activity was 100%), and SDS-PAGE protein gel electrophoresis was performed at the same time to determine the optimal final concentration of IPTG. The results are shown in Figures 6-7, M is a protein marker, and 1,-6 in Figure 6 are the protein expression at induction concentrations of 0.0 mM, 0.4 mM, 0.6 mM, 0.8 mM, 1.0 mM, and 1.2 mM, respectively, in Figure 7 The enzyme activity tests were performed at induction concentrations of 0.0 mM, 0.4 mM, 0.6 mM, 0.8 mM, 1.0 mM, and 1.2 mM, respectively. The results of electrophoresis and enzyme activity testing showed that the induction concentration was 0.8 mM, and the expression effect was the best. Therefore, the optimal IPTG induction concentration is 0.8 mM.

(4) Determination of the optimal starting cell concentration

Set up 5 different experimental groups according to different starting cell concentrations. The operation of each test sample in each experimental group is as follows: from the standby seed solution, draw 500 μL of culture solution into 50 mL of LB liquid medium, and at 30 ℃ , 220 rpm shaking culture, until the cell density OD _600nm of each experimental group was 0.9, 1.0, 1.1, 1.2, 1.3, respectively, adding a final concentration of 0.8 mM IPTG, shaking at 37 ° C, 220 rpm under the conditions of induction culture for 10 h. The induced cells were collected by centrifugation at 14,000 rpm for 2 min. The bacterial cells were washed and broken under the same conditions, and the activity was detected (the highest enzyme activity was 100%), and SDS-PAGE protein gel electrophoresis was carried out at the same time to determine the optimal initial bacterial cell density. The results are shown in Figures 8-9, M is a protein marker, and 1-5 in Figure 8 are the protein expression when the cell density OD _600nm is 0.9, 1.0, 1.1, 1.2, and 1.3, respectively. In Figure 9, the cell density OD The enzyme activity test when _600nm was 0.9, 1.0, 1.1, 1.2, and 1.3, respectively. The results of electrophoresis and enzyme activity test showed that the best initial bacterial concentration was OD _600nm = 1.2, and the expression effect was the best. Therefore, the optimal starting cell concentration is OD _600nm =1.2.

(5) Inducible expression and purification of target protein Est1051

From the standby seed solution, pipette 500 μL of the culture solution into 50 mL of LB liquid medium, and shake at 37 °C and 220 rpm until the cell density OD _600nm is 1.2, and add a final concentration of 0.8 mM IPTG. The cells were incubated at 37°C and 220rpm for 10h with shaking. Centrifuge at 6,000 rpm for 20 min, discard the supernatant, wash the pellet twice with ice-cold sterile dd H ₂ O, resuspend the cell pellet with 1 mL of dd H ₂ O, and ultrasonically disrupt the bacterial solution until it becomes clear, which is the crude enzyme solution .

Purification Kit(Novagen)试剂盒的纯化方法，具体操作步骤按Novagen公司产品说明书进行。将获得的粗重组蛋白和纯化后的重组蛋白进行SDS-PAGE凝胶电泳，用考马斯亮蓝R-250染色，蛋白Maker估计酶蛋白的大小。如图10所示，M是protein marker，1是纯化后的酶，2是未经纯化的粗酶，SDS-PAGE电泳结果表明，通过蛋白纯化试剂盒纯化的酶蛋白，SDS-PAGE电泳得到一条单一的蛋白条带。SEQ IDNO.1所述核苷酸序列所编码的多肽在大肠杆菌BL21(DE3)中得到高效表达，初步估计重组蛋白Est1051的分子量约为50kDa(其中含15kDa左右融合标签)A part of the crude recombinant protein was used

The purification method of the Purification Kit (Novagen) kit, the specific operation steps are carried out according to the product manual of Novagen Company. The obtained crude recombinant protein and purified recombinant protein were subjected to SDS-PAGE gel electrophoresis, stained with Coomassie brilliant blue R-250, and the protein Maker estimated the size of the enzyme protein. As shown in Figure 10, M is the protein marker, 1 is the purified enzyme, and 2 is the unpurified crude enzyme. The results of SDS-PAGE electrophoresis show that the enzyme protein purified by the protein purification kit is obtained by SDS-PAGE electrophoresis. single protein band. The polypeptide encoded by the nucleotide sequence of SEQ ID NO.1 is highly expressed in Escherichia coli BL21 (DE3). It is preliminarily estimated that the molecular weight of the recombinant protein Est1051 is about 50kDa (including a fusion tag of about 15kDa)

The polypeptide encoded by the DNA contains 312 amino acids, and its amino acid sequence is shown in SEQ ID NO.2.

Example 3 Enzymatic activity assay of acetylxylan esterase

(1) Determination of enzyme activity

The present invention uses p-nitrophenol esters as substrates to detect the enzymatic activity of acetyl xylan esterase. The reaction system was 200 μL, which consisted of 10 μL of 10 mM p-nitrophenol ester stock solution, 180 μL of PBS (pH=6.8) buffer and 10 μL of enzyme solution. The reaction system was reacted at 40° C. for 20 min, and then the absorbance of p-nitrophenol released during the process was measured at a wavelength of 405 nm, and a blank control without the enzyme solution was used at the same time. Determine its concentration from a standard curve for p-nitrophenol. The enzyme activity unit is defined as: under the reaction conditions, the amount of enzyme required to catalyze 1 μmol of p-nitrophenol acetate per minute is defined as 1 enzyme activity unit.

(2) Preparation of pNP standard curve

The stock solution of 10 mM p-nitrophenol (ρ-nitrophenyl, ρNP) was prepared with PBS buffer at pH 6.8, and then the standard solutions of p-nitrophenol with different concentrations were prepared as shown in Table 1. Take a total of 200 μL of different concentrations of p-nitrophenol standard solution and pH 6.8 PBS buffer to the ELISA plate, measure the absorbance value, record the OD ₄₀₅ nm, as shown in Table 1, and draw a standard curve, as shown in Figure 11 , the higher the concentration of the standard solution, the greater the OD value.

Table 1

Example 4 Study on the enzymatic properties of acetylxylan esterase gene Est1051

(1) Optimum temperature and temperature stability test

Set up 9 experimental groups, each experimental group is set up with an unheated control group and three parallel experimental groups, each test sample is: take 10 μL of enzyme solution and 190 μL of p-nitrophenol acetate The buffer solution was mixed into the reaction solution, and three parallel groups of 9 experimental groups were placed in a constant temperature water bath at 4°C, 15°C, 30°C, 35°C, 40°C, 50°C, 60°C, 70°C and 80°C, respectively. After 20 min of reaction, the reaction solution of each experimental group was diluted moderately and the light absorption value at 405 nm was measured. The highest enzyme activity was counted as 100%, and the relative enzyme activity was plotted against temperature to determine the optimum reaction temperature.

Set up another 9 experimental groups, each experimental group is set up with an unheated control group and three parallel experimental groups, each test sample is 10 μL of enzyme solution; three parallel groups of the 9 experimental groups The enzyme solution was placed in a constant temperature water bath at 4°C, 15°C, 30°C, 35°C, 40°C, 50°C, 60°C, 70°C, and 80°C, respectively, and the remaining enzyme activity was measured after 2 h of incubation. The enzyme activity without heat treatment was taken as 100%, and the relative enzyme activity was plotted against temperature to observe its temperature stability.

The results are shown in Figure 12. The optimum reaction temperature of acetyl xylan esterase is 40 °C. After 2 h treatment at different temperatures, the enzyme activity gradually decreases with the increase of temperature, but the temperature is between 4 and 45 °C. , the remaining enzyme activities were all above 50%, and the stability was good, indicating that the acetyl xylan esterase had good tolerance at room temperature.

(2) Optimum pH and pH stability test

To determine the enzyme activity under different pH conditions, 12 experimental groups were set up. Each test sample in each experimental group was mixed with 10 μL of enzyme solution and 190 μL of p-nitrophenol acetate solution to form a reaction solution. The pH of p-nitrophenol acetate solution was different, which were 1.97, 2.97, 4.10, 5.02, 6.09, 6.59, 7.00, 7.54, 7.96, 8.53, 8.96, 9.91, respectively. After the reaction solution of each experimental group was placed in a constant temperature water bath at 40°C for 20 min, the light absorption value at 405 nm was measured after moderate dilution of the reaction solution. The highest enzymatic activity was counted as 100%, and relative enzymatic activity was plotted against pH to determine the optimum reaction pH.

Another 12 experimental groups were set up, each test sample in each experimental group was 10 μL of enzyme solution, and the pH of the enzyme solution in the 12 experimental groups was adjusted to 1.97, 2.97, 4.10, 5.02, 6.09, 6.59, 7.00, 7.54 respectively. , 7.96, 8.53, 8.96, 9.91, under different pH conditions, and after incubating at 40 °C for 2 h, using p-nitrophenol acetate as the substrate, the residual enzyme activity was determined. The enzyme activity before standing was taken as 100%, and the relative enzyme activity was plotted against pH. The results are shown in Figure 13, the optimum reaction pH of acetylxylan esterase Est1051 is 7.0, and between pH 5-7.5, the remaining enzyme activity is above 50%, and the stability is good.

(3) Effects of different metal ions on enzyme activity

According to different metal ion solutions and metal ion solutions of different concentrations, 23 experimental groups were set up. Each test sample in each experimental group contained 10 μL of enzyme solution and 190 μL of p-nitrophenol acetate solution. One experiment The blank buffer was added to the other 22 experimental groups, and the other 22 experimental groups were respectively added with equal final concentrations of 1 mM Ni ²⁺ buffer, 10 mM Ni ²⁺ buffer, 1 mM Na ⁺ buffer, 10 mM Na ⁺ buffer, 1 mM K ⁺ buffer , 10 mM K ⁺ buffer, 1 mM Mg ²⁺ buffer, 10 mM Mg ²⁺ buffer, 1 mM Zn ²⁺ buffer, 10 mM Zn ²⁺ buffer, 1 mM Fe ²⁺ buffer, 10 mM Fe ²⁺ buffer, 1 mM Mn ²⁺ Buffer, 10 mM Mn ²⁺ Buffer, 1 mM Li ⁺ Buffer, 10 mM Li ⁺ Buffer, 1 mM Ag ⁺ Buffer, 10 mM Ag ⁺ Buffer, 1 mM Co ²⁺ Buffer, 10 mM Co ²⁺ Buffer, 1 mM Cu ²⁺ buffer, 10 mM Cu ²⁺ buffer, and the above mixtures were tested for enzyme activity under the most suitable conditions determined in the above examples. The residual enzyme activity was determined using p-nitrophenol acetate as the substrate. The enzyme activity with the addition of blank buffer and the same dilution ratio was regarded as 100%, and the relative enzyme activity was plotted. The results are shown in Figure 14. When the metal ion concentration is 1mM, Zn ²⁺ and Mn ²⁺ have a promoting effect on the enzyme activity, among which Mn ²⁺ has the greatest promoting effect, and the relative enzyme activity reaches 123.85%. Its activity is inhibited to varying degrees. When the concentration of metal ions is 10mM, Mg ²⁺ and Fe ²⁺ have a promoting effect on the enzyme activity, among which Mg ²⁺ has the greatest promoting effect, and the relative enzyme activity reaches 150.46%, while other metal ions make their activities affected to different degrees. Inhibition, indicating that the recombinant acetylxylan esterase Est1051 has better tolerance to metal ions.

(4) Effects of different organic solvents on enzyme activity

Set up 16 experimental groups, each experimental sample in each experimental group has 10 μL of enzyme solution, and blank buffer solution, 1% DMSO, 15% DMSO, 30% DMSO, 1% methanol were added to the enzyme solution of each experimental group. , 15% methanol, 30% methanol, 1% ethanol, 15% ethanol, 30% ethanol, 1% isopropanol, 15% isopropanol, 30% isopropanol, 1% Triton X-100 organic solvent, 15% Triton X-100 organic solvent, 30% Triton X-100 organic solvent, and the above mixture was tested for enzyme activity under the most suitable conditions determined in the above examples. The residual enzyme activity was determined using p-nitrophenol acetate as the substrate. The enzyme activity with the blank buffer added and the same dilution ratio was regarded as 100%, and the relative enzyme activity was plotted. The results are shown in Figure 15, 1% DMSO and 1% methanol can promote the enzyme activity, of which 1% methanol has the greatest promotion effect, the relative enzyme activity reaches 141.89%, and the enzyme activity of 1% ethanol reaches 91.01%, while other concentrations Organic solvents all have different degrees of inhibition. But what is special is that with the increase of isopropanol and Triton X-100 concentration, the enzymatic activity of acetyl xylan esterase increases instead. In 30% isopropanol, the enzymatic activity can reach 87.80%.

(5) Study on the tolerance of salt solution to enzymes

Set up 8 experimental groups, each test sample in each experimental group contains 10 μL of enzyme solution and 190 μL of p-nitrophenol acetate solution, of which 1 experimental group is added with blank buffer, and the other 7 experimental groups are added to enzyme solution. NaCl with final concentrations of 0M, 0.5M, 1M, 1.5M, 2.0M, 2.5M, and 3.0M was added to the solution respectively, and the above mixed solution was incubated for 2h under the most suitable conditions obtained in the above examples. The residual enzyme activity was determined using p-nitrophenol acetate as the substrate. The enzyme activity of the enzyme solution without saline solution treatment was defined as 100. The effect of salt concentration on the enzyme activity was determined. The results are shown in Figure 16. The enzyme activity gradually decreased with the increase of the NaCl solution concentration, but when the NaCl solution concentration increased to 1M, the enzyme activity remained above 50%. When the solution concentration further increased, the enzyme activity decreased sharply, and when the NaCl solution concentration increased to 2M, the enzyme activity remained above 42%, indicating that acetylxylan esterase has a certain tolerance to salt solution.

It can be seen that the present invention provides a novel acetylxylan esterase gene Est1051, which is constructed into plasmid pET28a, and then the recombinant plasmid is transferred into E. coli prokaryotic expression system for expression and purification. The product expressed by the gene has high catalytic activity, good thermal stability and metal ion tolerance, and has great potential for industrial production and application.

The technical solutions provided by the embodiments of the present invention have been described in detail above. The principles and implementations of the embodiments of the present invention are described in this paper by using specific examples. The descriptions of the above embodiments are only applicable to help understand the embodiments of the present invention. At the same time, for those of ordinary skill in the art, according to the embodiments of the present invention, there will be changes in the specific implementation and application scope. To sum up, the contents of this specification should not be construed as limitations of the present invention.

sequence listing

<110> Guangdong Pharmaceutical University

<120> A kind of acetyl xylan esterase gene, its encoded product and preparation method

<130> 2020

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1051

<212> DNA

<213> Unknown

<400> 1

cccgttgcgg tgtcattata ctgacgggga cgatcaaaag cgttggcgtt cgttaaatat 60

ttacgagtgc tgcctcatgt caaagtcaga aaaaatagta taggaggtaa catatgggat 120

ccgaacatca tcatcatcat catgaaatga aaacaatact acattgcctt ctttttcttt 180

ttattactac gcaatcgatt gctcaatttt cccagcataa aagggatagt attgacaaat 240

taagcaggat tgatcatgag ctgatgatgg agaagctggg gatttctgaa ttgagaccgg 300

gaccctcggg aaatcccgaa gctccaaatg ctgctaacag tgacgaatct aaagccaaaa 360

cctacaacag cttgcctgaa ctactggtat ttgacaatgg aaagcttgtt aaaagtgtcg 420

aagactgggc gaatcgcagg aaagagatca aaaagcattt tgacagggag atctatggaa 480

aaatgcctga agacgttccc gatgttacct gggagatggt tagtgaaagg gataccctta 540

taggagaata tccggtggtt tataaagatc ttttagggca tgtagacaat tcggaatatc 600

cagaaatcga agtagcaatc gaaatgacgc tcgtaacacc tgccgaaaag gatgaaccgg 660

tgcctgtaat gctggagtttt ggctggaact ggccgccggg tatggaaatc ccgaagacgg 720

aaggtcctgc ctggcaggag cagctgcttg gaaagggatg gggctatgcc attatgatcc 780

ctacaagctt ccaggcagat aacggggcag ggctgcgcca gggaatcatc ggactggtga 840

acaagggtga accgagagat cccgaagact ggggaacatt acgtgcctgg gcctggggtg 900

caagccgtgc aattgattat ttcgaagcaa acccagatgt ggatgaaaca aaagtaggta 960

tagaaggatt atccagatat gggaaagcag caatggttgc catggcttat gaacctcgat 1020

tagcaattgg tttcataggt tcttcgggag c 1051

<210> 2

<211> 312

<212> PRT

<213> Unknown

<400> 2

Met Gly Ser Glu His His His His His Glu Met Lys Thr Ile Leu

1 5 10 15

His Cys Leu Leu Phe Leu Phe Ile Thr Thr Gln Ser Ile Ala Gln Phe

20 25 30

Ser Gln His Lys Arg Asp Ser Ile Asp Lys Leu Ser Arg Ile Asp His

35 40 45

Glu Leu Met Met Glu Lys Leu Gly Ile Ser Glu Leu Arg Pro Gly Pro

50 55 60

Ser Gly Asn Pro Glu Ala Pro Asn Ala Ala Asn Ser Asp Glu Ser Lys

65 70 75 80

Ala Lys Thr Tyr Asn Ser Leu Pro Glu Leu Leu Val Phe Asp Asn Gly

85 90 95

Lys Leu Val Lys Ser Val Glu Asp Trp Ala Asn Arg Arg Lys Glu Ile

100 105 110

Lys Lys His Phe Asp Arg Glu Ile Tyr Gly Lys Met Pro Glu Asp Val

115 120 125

Pro Asp Val Thr Trp Glu Met Val Ser Glu Arg Asp Thr Leu Ile Gly

130 135 140

Glu Tyr Pro Val Val Tyr Lys Asp Leu Leu Gly His Val Asp Asn Ser

145 150 155 160

Glu Tyr Pro Glu Ile Glu Val Ala Ile Glu Met Thr Leu Val Thr Pro

165 170 175

Ala Glu Lys Asp Glu Pro Val Pro Val Met Leu Glu Phe Gly Trp Asn

180 185 190

Trp Pro Pro Gly Met Glu Ile Pro Lys Thr Glu Gly Pro Ala Trp Gln

195 200 205

Glu Gln Leu Leu Gly Lys Gly Trp Gly Tyr Ala Ile Met Ile Pro Thr

210 215 220

Ser Phe Gln Ala Asp Asn Gly Ala Gly Leu Arg Gln Gly Ile Ile Gly

225 230 235 240

Leu Val Asn Lys Gly Glu Pro Arg Asp Pro Glu Asp Trp Gly Thr Leu

245 250 255

Arg Ala Trp Ala Trp Gly Ala Ser Arg Ala Ile Asp Tyr Phe Glu Ala

260 265 270

Asn Pro Asp Val Asp Glu Thr Lys Val Gly Ile Glu Gly Leu Ser Arg

275 280 285

Tyr Gly Lys Ala Ala Met Val Ala Met Ala Tyr Glu Pro Arg Leu Ala

290 295 300

Ile Gly Phe Ile Gly Ser Ser Gly

305 310

<210> 3

<211> 34

<212> DNA

<213> Artificial sequence

<400> 3

ccggaattcc ccgttgcggt gtcattatac tgac 34

<210> 4

<211> 37

<212> DNA

<213> Artificial sequence

<400> 4

ccgctcgagg ctcccgaaga acctatgaaa ccaattg 37

Claims (10)

1. An acetylxylan esterase gene characterized by:

named as Est1051, and the nucleotide sequence is shown as SEQ ID NO. 1.

2. An acetylxylan esterase encoded by the acetylxylan esterase gene of claim 1 wherein:

the amino acid sequence is shown in SEQ ID NO. 2.

3. A recombinant plasmid comprising the acetylxylan esterase gene of claim 1.

4. A recombinant plasmid pET-28a (+) -Est1051 comprising the acetylxylan esterase gene of claim 1.

5. A recombinant engineered bacterium comprising the acetylxylan esterase gene of claim 1.

6. A method for preparing an acetylxylan esterase gene according to claim 1, characterized in that:

the method comprises the following steps:

(1) extracting total DNA from a sample, purifying the total DNA, and carrying out enzyme digestion on the total DNA;

(2) recovering the DNA fragment obtained in the step (1) after enzyme digestion, and connecting the DNA fragment with a pUC118 vector to obtain a plasmid;

(3) transforming the plasmid obtained in the step (2), screening a library and identifying a positive clone;

(4) sequencing, namely, naming the plasmid as pUC118-Est1051, and designing a PCR primer;

(5) carrying out PCR amplification by taking plasmid pUC118-Est1051 as a template to clone genes;

(6) and purifying the PCR product to obtain the acetyl xylan esterase gene.

7. The method for producing an acetylxylan esterase gene according to claim 6, wherein:

the PCR primers are:

Est1051-F：CCGGAATTCCCCGTTGCGGTGTCATTATACTGAC

(the restriction sites for EcoRI are underlined);

Est1051-R：CCGCTCGAGGCTCCCGAAGAACCTATGAAACCAATTG

(Xho I cleavage site is underlined).

8. The method for producing an acetylxylan esterase gene according to claim 6, wherein:

the operation of the step (5) is as follows: plasmid pUC118-Est1051 is used as a template, Est1051-F and Est1051-R are used as primers, Prime STAR is adopted^TMMax Premix is used for carrying out PCR amplification on the Est1051 gene segment, and the system is as follows:

the reaction conditions for PCR were:

the first stage is as follows: denaturation at 95 deg.C for 2 min;

and a second stage: denaturation at 95 ℃ for 10sec, annealing at 60 ℃ for 5sec, and extension at 72 ℃ for 5sec for 30 cycles;

and a third stage: extension at 72 ℃ for 10min and final storage at 4 ℃.

9. A process for the preparation of an acetylxylan esterase as claimed in claim 2, characterized in that:

connecting the acetylxylan esterase gene of claim 1 with a pET-28a (+) expression vector to obtain a connection product recombinant plasmid pET-28a (+) -Est1051, transforming the recombinant plasmid into escherichia coli BL21 competent cells to form recombinant engineering bacteria, culturing the recombinant engineering bacteria, crushing to obtain a crude enzyme solution, and purifying to obtain the acetylxylan esterase.

10. The method of producing an acetylxylan esterase as set forth in claim 9, wherein:

the detailed operation is as follows: connecting acetyl xylan esterase gene of claim 1 with pET-28a (+) expression vector to obtain recombinant plasmid pET-28a (+) -Est1051, transforming the recombinant plasmid into competent cell of colibacillus BL21 to form recombinant engineering bacteria, inoculating the recombinant engineering bacteria in LB liquid culture medium for activation, and then activating the activated bacteria to obtain OD_600nmInoculating the recombinant engineering bacteria mother liquor of 1.2 into another LB liquid culture medium, adding IPTG with the final concentration of 0.8mM, culturing at 37 ℃ for 10h, centrifuging to remove the supernatant, crushing to obtain a crude enzyme solution, and purifying to obtain the acetylxylan esterase.

Images