CN111254083A - Antacoside A and preparation method and application thereof - Google Patents

Abstract

The invention relates to a new penicillium Z08 from soil and a metabolite antacid A thereof, wherein the new penicillium Z08 is separated from soil for planting corn, an ITS sequence is obtained by amplification of an ITS primer, and the new penicillium Z08 is identified by BLAST and is a penicillium Z08 deposited in the China general microbiological culture Collection center with the deposition number: CGMCC NO.12761, preservation date: 2016, 6 months and 29 days. The penicillium Z08 has strong phosphate-solubilizing effect. A new light yellow compound antavomimetic acid A is obtained by separating a water-soluble metabolite of the compound, and the metabolite antavomimetic acid A has the effects of resisting inflammation, treating diabetes and the like, and is expected to be widely applied in the field of medicines.

Description

Antacoside A and preparation method and application thereof

The application is a divisional application of a patent application (application number is 201710624795.7, the name of the invention is 'a new penicillium and a metabolite, namely antanemic acid A') which is submitted to the national intellectual property office in 2017, 7, 27.

Technical Field

The invention relates to a penicillium Z08 which is derived from soil and can produce a new natural product antacid and application thereof in medicine, forestry and agriculture.

Background

Soil microorganisms spend all or part of their life history in soil and play an important role in various processes inside soil, which affect human social and economic development in many ways. Many soil microorganisms can secrete secondary metabolites, such as rhizobia nodulation factor-lipo-chitooligosaccharide secreted by rhizobia, and play an important role in the symbiotic nodulation process of rhizobia and plants. The fungus natural product is also one of the important sources of natural medicine^1，2Such as ergot alkaloids, diketopiperazines, quinolines, quinazolines, diazepam, and polyketides, and the like. The completion of large-scale fungal genome sequencing has shown that fungi have the potential to produce abundant secondary metabolites, which have become a focus of research and a direction of development^3，4，5. People pay attention to the relationship between microorganisms and soil fertility at the beginning of the 20 th century, and find that some insoluble compounds applied to soil can be used as phosphorus sources, and people screen more than 50 strains of bacteria from the soil, wherein several strains of penicillium form macroscopic phosphorus dissolving rings on a flat plate⁶. With the increasing severity of industrial pollution and environmental destruction, the incidence of malignant tumors is increasing year by year, and conventional anticancer drugs have great side effects, so the research and development of antitumor drugs are important subjects for research in the field of pharmaceutical chemistry research. The natural product of fungus has wide biological activity including antitumor, antibacterial, antiviral, immunosuppression, etc.

It is reported that⁷The penicillium oxalicum P8 has effect in dissolving various insoluble phosphorus in soil, and is suitable for various soils such as southern red soil, northern black soil, brown soil, and moisture soilThe type of the fertilizer has multiple functions of improving crop yield, activating soil indissolvable phosphorus, preventing chemical fixation of phosphate fertilizer in soil and improving the utilization efficiency of the phosphate fertilizer. Mozzanine rock and the like⁸The patent of the invention discloses that the paecilomyces lilacinus fungicide is broadcast around the root of the tomato seedling for treatment, the growth of the tomato can be remarkably promoted, the effect is stable, and the application prospect is good. The method for preparing phoxim degrading microbial inoculum by using paecilomyces lilacinus strain FJAT-9041 can effectively degrade pesticide phoxim⁹. The field test shows that the inoculation of the phosphorus-solubilizing bacteria-penicillium can increase the corn yield¹⁰. The penicillium oxalicum NJDL-03 can restore soil lead pollution and improve the utilization rate of phosphorus in calcareous soil, and has obvious effect on promoting the growth of crops¹¹. The culture product of Paecilomyces tenuipes strain has effects in regulating immunity, resisting tumor and virus, protecting liver, improving nutrition, resisting aging, improving anoxia tolerance, tranquilizing mind, and relieving pain¹²。

Therefore, the penicillium has wide application prospect in the aspects of agriculture, medicine and the like. Therefore, there is a need for further research on penicillium and metabolites thereof.

Disclosure of Invention

The invention aims to provide a novel penicillium (Penicililium flavonim) Z08 from soil, which is registered and preserved in China general microbiological culture Collection center (CGMCC for short) at 29 months and 6 years in 2016, the preservation place is the microbiological research institute of China academy of sciences No. 3 of Xilu No.1 of Beijing sunward Yangzhou, the preservation number is CGMCC NO. 12761.

The fungus is separated from soil for planting corn, an ITS sequence is obtained by amplification of the fungus through an ITS primer, and the result of BLAST identification shows that the similarity of the sequence and Penicillium sp.1JJK-2011(GENE Bank ID: HM469397) is highest and reaches 98.9 percent, so that the fungus is identified to be Penicillium Z08 belonging to Penicillium (Penicillium flavonitum).

The microbiological characteristics of the strain are as follows: after culturing for 4 days at 28 ℃ on a PDA plate, the colony appears white and is mostly vegetative hyphae. Its nutrient body is colorless or light yellow mycelium, and between every two cells of mycelium there is diaphragm. After 7 days, simple long and upright conidiophores are generated on the aerial hyphae, the tops of the conidiophores are provided with special symmetrical broom-shaped branches, meanwhile, the bacterial colonies are light green, and the clustered hyphae can be seen through microscopic examination.

Another objective of the invention is to provide a new compound A (antanic acid A) separated from the fungus, the chemical name of which is (E) -2- (2- (3- (2-aminobenzamide), the molecular formula of which is C₁₅H₁₇N₃O₆Molecular weight is 335.1117; the chemical structure is as follows:

the compound is light yellow amorphous powder, and is easily soluble in water, dimethyl sulfoxide, etc.

The invention has the advantages and positive effects that:

(1) the novel penicillium Z08 separated from the soil has good phosphorus dissolving effect, can dissolve various insoluble phosphorus in the soil, can activate the insoluble phosphorus in the soil, prevent the chemical fixation of the phosphate fertilizer in the soil and improve the crop yield when being used in the soil for planting crops.

(2) The invention extracts a new compound antavomimetic acid A from a new penicillium Z08 fermentation product, the compound can inhibit the reproduction of NIH3T3 cells, the higher the concentration of the antavomimetic acid A is, the more obvious the inhibition effect on the reproduction of the NIH3T3 cells is, meanwhile, the higher the inhibition effect of the antavomimetic acid A on the expression of TGF- β 1 genes of the NIH3T3 cells is, the compound is expected to be applied to the medicines for treating diabetes, and new products are provided for the treatment of diabetes patients.

(3) The antamimetic acid A extracted by the invention can inhibit macrophage from secreting inflammatory factors induced by lipopolysaccharide, and is expected to be applied to anti-inflammatory drugs.

Drawings

FIG. 1 is a 1H NMR spectrum of an antavomimetic A compound.

FIG. 2 is a 13C map of Anthranilic acid A compound.

FIG. 3 is an HMQC map of the Anthranilic acid A compound 1H-13C.

FIG. 4 is a chart of 1H-13C HMBC for antavomimetic A compounds.

FIG. 5 is a 1H-1H COSY spectrum of an antavonic acid A compound.

FIG. 6 is a high resolution mass spectrum of Anthranilic acid A compounds.

FIG. 7 is a diagram showing the dissolution dynamics of Penicillium Z08 on soil phosphorus.

FIG. 8 is a diagram of total RNA quality detection analysis of NIH3T3 cells.

FIG. 9 is a graph of the effect of three concentrations of Anthranilic acid A on the activity of RAW264.7 cells.

FIG. 10 is a graph of LPS-induced NO production in mouse cells by three doses of Anthranilic acid A.

Detailed Description

The invention is further described below with reference to examples in order to be more clearly understood by those skilled in the art, but not to be construed as being in any way limited thereto.

Example 1

Separation and identification of penicillium Z08 strain

21 fungi are obtained by applying PDA + penicillin and streptomycin plates to the soil of a tensor farm in nine cities in Jilin province, wherein one of the fungi is penicillium Z08, and penicillium Z08 can generate a light yellow compound on a PDA agarose plate. The strain is identified as penicillium (Penicillium flavonim) through taxonomic study and molecular biological study.

The microbiological characteristics of the strain are as follows: after culturing for 4 days at 28 ℃ on a PDA plate, the colony appears white and is mostly vegetative hyphae. Its nutrient body is colorless or light yellow mycelium, and between every two cells of mycelium there is diaphragm. After 7 days, simple long and upright conidiophores are generated on the aerial hyphae, the tops of the conidiophores are provided with special symmetrical broom-shaped branches, meanwhile, the bacterial colonies are light green, and the clustered hyphae can be seen through microscopic examination.

1. Preparation of Penicillium Z08 Strain

The penicillium is purified by adopting the following culture medium: adding potato culture medium 40 g into 1000 ml water, adding glucose 20 g and agar 20 g, sterilizing at 121 deg.C under 1kg/cm2 for 20 min, cooling, and adding sterile penicillin and streptomycin 30 microgram/ml respectively. Weighing about l g of soil sample under an aseptic state, adding 10ml of sterile water, vibrating and uniformly mixing, diluting by 10 times, 100 times and 100 times respectively to prepare 4 samples with concentration gradients, coating 0.25 ml of each sample on a solid culture medium, coating 20 flat plates on each gradient, picking spores of the separated strains when the separated strains enter a growth vigorous period on the culture medium, performing streak purification on a fungus purification culture medium, performing inverted culture at 28 ℃, keeping a relative humidity of 90% and under a constant temperature and humidity condition, continuously streaking by the method until single colonies with a single shape are on a single flat plate, picking the single colonies on the flat plate for pure culture, and storing pure strains after the colonies grow.

2. Extraction of genome DNA of penicillium Z08

Firstly, culturing the strain in a shaking table (150r/min) at 28 ℃ for 7 days, then taking 100mg of freeze-dried hyphae, adding a proper amount of liquid nitrogen into a mortar for full grinding, adding 2mL of buffer solution (50mM Tris-HCl pH 7.2, 50mM EDTA, 2.5% SDS, 1% β -mercaptoethanol), uniformly mixing, transferring into a 10mL test tube, adding 2mL of phenol, namely chloroform (1:1) extract, extracting, centrifuging the extract, then taking supernatant, adding 50 microliters of RNase, standing for 1 hour at 55 ℃, adding protease, then washing twice by 70% cold ethanol, drying for 30 minutes at room temperature, adding 500 microliters of water for dissolving, and preserving at-80 ℃ for later use.

3. Identification of Penicillium Z08 Strain

By primers ITS58A1F: 5'-GCATCGATGAAGAACGC-3' and

ITSNLB3: 5'-GGATTCTCACCCTCTATGA-3' amplifies genome DNA of penicillium Z08, transforms the amplified fragment into DH5a by using T carrier clone and sequences positive clone, and obtains the ITS sequence of penicillium Z08 as follows:

BLAST analysis is carried out on the ITS sequence of the penicillium Z08, and the result shows that the similarity of the sequence and Penicilliumsp.1JJJK-2011 (GENE Bank ID: HM469397) is highest and reaches 98.9%. Therefore, the strain is identified to belong to the genus Penicillium (Penicillium flavonim) Penicillium Z08. The strain is registered and preserved in the common microorganism center of China Committee for culture Collection of microorganisms at 29 th 6 th 2016, the preservation place is the microorganism research institute of China academy of sciences No. 3, West Lu 1, North Cheng, the Korean area, Beijing, and the preservation number is CGMCC NO. 12761.

Separation and identification of antavomimetic acid A in penicillium Z08 fermentation product

1. Preparation and separation method of penicillium Z08 fermentation product

① preparation of fermented product

Spores of penicillium Z08 were streaked out on 8 liter PDA agar plates (g/l): yeast extract (purchased from Sigma) 0.5 g, glucose 10.0 g, calcium phosphate 5.0 g, ammonium sulfate 0.5 g, potassium chloride 0.2 g, magnesium sulfate 0.1 g, manganese sulfate 0.0001 g, ferrous sulfate 0.0001 g, agar 15.0 g, plate at room temperature (20-22 deg.C), temperature incubation for 14 days. When the agar plate was observed to turn yellow and the spores turned green, the spores were removed from the agar plate with water, and the agar was then extracted with water. The resulting agar slurry was stirred in 10 liters of water for 5 hours and filtered through metal (100 mesh) to obtain the penicillium Z08 fermentation product.

② reversed phase liquid chromatography for separation and purification

Evaporating the fermentation product solution under reduced pressure to 2L volume, extracting with ethyl acetate for 3 times, evaporating the extractive solution under reduced pressure, drying the extract, dissolving in water, sequentially extracting with cyclohexane and methanol, and collecting methanol fraction for HPLC preparation.

The instrument comprises the following steps: HPLC-ESI-MS (Agilent 1100HPLC System, ESI mode Bruker's amaZon point ion trap mass spectrometer, equipped with 160-600nm variable UV detector, Phenomenex Luna 5. mu. m C18(250 mm. times.15 mm, 4.6 μm), flow rate (10 ml/min);

chromatographic conditions are as follows: a solvent gradient of a (acetonitrile containing 0.1% formic acid) and B (water containing 0.1% formic acid), 0-5 min, 5% a; linear gradient to 60% a from 5-15.5 min; linear gradient to 100% A for 15.5-16 min; 16-17.5 minutes, 100% A isocratic; 17.5-18 min, linear to 5% A, 18-21 min, 5% A.

③ results

Penicillium Z08 fermented product (about 200 g) was extracted with ethyl acetate (2L) for 3 times to obtain 1.5 g of extract, which was dissolved in water, sequentially extracted with cyclohexane and methanol, the methanol fraction was subjected to HPLC preparation, 30 fractions were collected, and the peak of the sample was collected for 13.5 minutes to obtain a bright yellow powder, 5 mg. The samples were analyzed by Thermo Scientific LTQ, Orbitrap XL high resolution mass spectrometer and Bruker, Avance 600MHz NMR spectrometer.

2. Identification of antavomimetic acid A in penicillium Z08 fermentation product

Collecting 1 mg of the obtained bright yellow powder, and analyzing with Thermo Scientific LTQ, Orbitrap to obtain high resolution mass spectrum with molecular weight of 335.1117 (see FIG. 6); 3 mg of the bright yellow powder obtained above was dissolved in DMSO-d₆In (5), detection was performed by Bruker, Avance 600MHz NMR spectrometer (see Table 1 and FIG. 2).

¹HNMR(600MHz，DMSO-d₆)δ：7.34(d,1H,J＝8.5，H-2)，8.51(t，1H，J＝8.5,1.5,H-3)， 7.01(t，1H,J＝8.5,H-4)，8.01(d,1H,J＝8.5，H-5)，7.35(d,1H,J＝8.5，H-8)，5.21(d,J＝ 10.2，H-9)，3.06(m,1H,H-11)，2.13(m,1H,H-12a)，1.98(m,1H,H-12b)，2.51(m,1H,H-13)。

¹³C NMR(150MHz，DMSO-d₆)δ:140.7(s，C-1)，131.6(d，C-2)，119.3(d，C-3)，122.4(d,C-4)，131.6(d,C-5)，124.2(s,C-6)，170.7(s，C-7)，135.4(d,C-8)，101.2(d，C-9)，166.3(s, C-10),58.7(d,C-11)，28.2(t,C-12)，32.6(t，C-13)，176.1(s,C-14)，176.1(s,C-15)。

TABLE 1 NMR spectroscopic data

Deducing the molecular formula of C according to HRESIMS₁₅H₁₇N₃O₆：m/z＝336.1191[M+H]⁺(calculation 336.1196) based on¹³C NMR and other nuclear magnetic spectral data, which was deduced to require 9 unsaturations.¹H-¹Spectroscopic analysis of H COSY (fig. 5) and HMQC (fig. 3) indicated the presence of the following spin system: H2-H3-H4-H5, H8-H9, H11-H12-H13. The hydrocarbons observed from the HMBC spectra (fig. 4 and table 1) correlate as follows: from C-1 to H-2, H-5; from C-6 to H-4, H-2; from C-7 to H-8, H-5; from C-10 to H-8, H-7; from C-14 to H-12; from C-15 to H-12; from C-13 to H-11. HMBC association of antanic acid a:

after retrieval and all of the above data, the compound is finally determined to be a new compound, the chemical name of which is (E) -2- (2- (3- (2-aminobenzamide) and is named as Anthranilic acid A, and the chemical formula is as follows:

the compound is light yellow amorphous powder, and is easily soluble in water, dimethyl sulfoxide, etc.

EXAMPLE 2 phosphorus solubilizing efficacy test for Penicillium Z08

Quantitative determination and result of phosphorus-dissolving capacity of penicillium Z08

A phosphorus standard curve was prepared according to the method of the previous study (reference 13), a regression equation was obtained, and the amount of phosphorus dissolved in bacteria was calculated. After overnight culture (28 ℃,120r/min) of the stored endophyte, 100uL of the endophyte is inoculated into 50mL of PKO inorganic phosphorus culture solution for 3 times, and after culture for 12 days in a shaking table (120r/min) at 28 ℃ by taking the inoculated sterile water as a control, the supernatant is taken to measure the phosphorus decomposition amount according to the method of the reference document [13 ]. The calculation formula of the phosphate solubilizing quantity of the strain is as follows:

the phosphorus-dissolving amount (mg/mL) of the strain is multiplied by the utilization amount of colorimetric solution (mg/mL) × (100/5) ×

TABLE 2 quantitative determination of phosphate-solubilizing quantity of penicillium Z08 strain

Determination of soil phosphorus dissolving capacity of penicillium notatum Z08 and results thereof

Weighing 5g of sieved soil, placing the soil in a 150mL triangular flask, and carrying out 2 treatments of sterilization and non-sterilization, wherein each treatment comprises 3 groups:

(1) adding 1mL of Penicillium Z08 strain overnight culture solution (28 ℃,120r/min) and 9mL of sterile water into a triangular flask, and adding 1mL of sterilized Penicillium Z08 strain overnight culture solution and 9mL of sterile water to obtain CK;

(2) adding 5mL of Penicillium Z08 strain overnight culture solution and 5mL of sterile water, and adding 5mL of sterilized Penicillium Z08 strain overnight culture solution and 5mL of sterile water to obtain CK;

(3) adding 10mL of Penicillium Z08 strain overnight culture solution, and adding 10mL of sterilized Penicillium Z08 overnight culture solution to obtain CK; the cells were incubated at 28 ℃ and the phosphorus-solubilizing amounts were measured on days 3,5,10,15,20,25 and 30 of the incubation in accordance with the method for measuring fast-acting phosphorus in soil described in reference [13], and the results were shown in FIG. 7 for 3 repetitions.

As can be seen from the attached figure 7, the phosphorus-dissolving amount is increased along with the increase of the inoculated bacterial amount, the bacterial-dissolving amount of the three culture groups is obviously increased greatly on the 5 th day of culture, the phosphorus-dissolving trend is slowed down during the 5 th to 15 th days, and the phosphorus-dissolving amount is increased by inoculating 10mL of the penicillium Z08 on the 15 th to 30 th days. The result shows that the inoculation amount is large, the basic number of the penicillium Z08 is large, the phosphate solubilizing capability is strong, and the soluble phosphorus is accumulated more; the penicillium Z08 can be in mutual and reciprocal cooperation with indigenous microorganisms in soil, and the indigenous microorganisms can enhance the phosphate-solubilizing capability of the penicillium Z08.

Example 3 Effect of Anthranilic acid A on the expression of NIH3T3 cells and TGF- β 1 Gene

1. Experimental Material

1.1 cells

NIH3T3 cells were donated by the university of gilin agriculture bioreactor and the center for engineering research of the department of drug development education.

1.2 Experimental drugs

DEME high sugar medium, Hyclone; fetal Bovine Serum (FBS), Hyclone; antibiotics, Gibco Corp; dimethylthiazole (MTT), Amresco; recombinant basic fibroblast growth factor (rbFGF), Oryzogen; a high-purity total RNA rapid extraction kit, Beijing Baitaike biotechnology limited; BioTake super RT Kit, Bekkark Biotech, Inc.; 2 × Power Taq PCR Master Mix, Beijing Baitag Biotechnology Ltd; 2 × SYBP real-time PCR prediction, Beijing Biotechnology Ltd.

1.3 Experimental instruments

TGL-20B high speed bench centrifuge (Shanghai' an Tingsu scientific instruments, Inc.), inverted microscope (Olympus corporation), SW-CJ-1F clean bench (Suzhou clean plant), electrophoresis apparatus (Hex instruments, Beijing), gel imager (BIORAD, USA), RCR apparatus (SBP, USA), and applied Biosystems real-time fluorescence quantitative RCR apparatus (ABI, USA).

2. Experimental methods

2.1 Pre-treatment of cells

And (3) recovering the cells: taking out the centrifuge tube containing NIH3T3 cells from liquid nitrogen, resuscitating in water bath at 37 deg.C within 1min, adding 5mL culture medium (DEME) into a clean bench, centrifuging for 5min, discarding supernatant, sucking cells into a cell culture bottle, adding 4mL culture medium, adding 10% serum (FBS) and 1 ‰ antibiotic, shaking, placing in CO at 37 deg.C and 5% concentration, and mixing²The culture is carried out in the incubator, the cover of the culture bottle is not screwed too tightly, and the cell breathing is convenient.

Passage of cells: observing the cells in the cell culture bottle under a microscope, washing the cells for 2 times by using PBS buffer solution when the cells grow to 80-90%, discarding the PBS, adding 5ml of DEME by using a pipette, simultaneously blowing the cells down for passage.

2.2 determination of cell viability by MTT method

NIH3T3 cells growing to logarithmic growth phase were transferred into a centrifuge tube, and the cell concentration was adjusted to 1X 10⁵one/mL. Then, the wells were spotted into a 96-well fine plate at 100. mu.l per well, and the wells around the 96-well plate were not spotted, preventing the occurrence of edge effects.Then it was placed at 37 ℃ in 5% CO²The cells were attached to the wall by incubation in an incubator for 24 h. The experiment was performed on 5 groups, each of which was a blank control group (with an equal amount of culture medium added), a rbFGF group (5ng/mL), and an antacid A group (0.4, 2, 10, 50, 250. mu.g/mL) in 3 replicates at each concentration, and after 12, 24, and 48 hours of incubation in a 37 ℃ and 5% carbon dioxide incubator, 20. mu.l of MTT was added to each well using a pipette gun, and the wells were incubated in the incubator for 4 hours to terminate the incubation. To each well, 150. mu.l DMSO was added, and the mixture was shaken on a shaker for 10min to dissolve the DMSO sufficiently. The absorbance of each well was measured at 570nm on an enzyme linked immunosorbent instrument.

2.3 fluorescent real-time quantitative PCR detection of TGF- β 1

NIH3T3 cells growing to logarithmic growth phase were transferred into a centrifuge tube, and the cell concentration was adjusted to 4X 10⁵NIH3T3 cells were seeded in 6-well plates per well, 2mL of the cell suspension was added to each well, cultured at 37 ℃ in a 5% carbon dioxide incubator for 24 hours, and the culture solution was aspirated. DMEM culture solution is added into a blank group, DEME containing 5ng/mL of rbFGF is added into a positive control group, DEME containing 0.4, 2, 10, 50 and 250 mu g/mL of antacid A is added into an experimental group, the temperature is 37 ℃, and 5% CO is added₂The culture was terminated after 24 hours of incubation. And (3) discarding culture solution, washing the cells for 2-3 times by PBS, quickly extracting RNA in the cells by using a high-purity total RNA (ribonucleic acid) rapid extraction Kit, and reversely transcribing cDNA by using a BioTake super RT Kit.

TABLE 3 primer sequences

3. Results

3.1 determination of cell viability by MTT method

The absorbance of NIH3T3 cells after the action of the analogic acid A and the rbFGF on the NIH3T3 cells is detected by an MTT colorimetric method, and the result shows that the OD value of the blank control group of cells without any pharmaceutical intervention is gradually increased after the cells are cultured for 12 hours, 24 hours and 48 hours, which indicates that the cells are gradually propagated in a culture medium. The proliferation of NIH3T3 cells is obviously increased under the action of rbFGF (P < 0.05). As shown in Table 4, the inhibition effect on the proliferation of NIH3T3 cells was more significant with the increase of the concentration of anabetalaic acid A. Compared with a blank group, the OD value of the 250 mu g/mL group after 12h culture has significant difference (P <0.05), the OD value of the 10 mu g/mL group at 24h culture has significant difference (P <0.05), the OD value of the 50 mu g/mL group and the OD value of the 250 mu g/mL group have significant difference (P <0.01), and the OD value of the 10 mu g/mL group, the OD value of the 50 mu g/mL group and the OD value of the 250 mu g/mL group after 48h culture have significant difference (P <0.01), and the inhibition effect at 24h can be seen to be the most significant.

TABLE 4 OD values of NIH3T3 cells after determination of the effect of Anthranilic acid A by the MTT method

Note: compared with the blank control group, the composition of the composition,^#P<0.05，^##P<0.01

3.2 Effect of AF on the expression of TGF- β 1 genes in NIH3T3 cells

The total RNA extracted from NIH3T3 cells is subjected to agarose gel electrophoresis to detect the extraction quality, and clear 18S and 28S electrophoresis bands can be observed on an ultraviolet instrument detector (in figure 8, A: a blank control group; B: rbFGF group; C: 0.4. mu.g/mL group; D: 2. mu.g/mL group; E: 10. mu.g/mL group; F: 50. mu.g/mL group; G: 250. mu.g/mL group). As shown in figures 8, 4 and 5, the extracted total RNA has better integrity, and the suppression effect of the analeptic acid A on the TGF- β 1 gene expression of the NIH3T3 cells is more remarkable along with the increase of the concentration.

TABLE 5 relative expression levels of TGF- β 1 gene in NIH3T3 cells

Note: compared with the blank control group, the composition of the composition,^#P<0.05，^##P<0.01

example 4 Effect of Anthranilic acid A on LPS-induced secretion of inflammatory factors by macrophages

1. Material

1.1 cell line origin

RAW264.7 mononuclear macrophages from mice were purchased from Shanghai Life sciences institute cell Bank, Chinese academy of sciences.

1.2 drugs and reagents

Antalopecanoic acid A, which is prepared by laboratories with purity of more than 90 percent, is prepared into high, medium and low dosage required concentration by purified water when in use, a Nitric Oxide (NO) determination kit is ordered from Nanjing institute of bioengineering, an interleukin-1 β (IL-1 β) enzyme linked immunoassay kit, an interleukin-6 (IL-6) enzyme linked immunoassay kit, a tumor necrosis factor- α (TNF- α) enzyme linked immunoassay kit and prostate E₂(PGE₂) Enzyme linked immunoassay kit, lot number: 201511, all available from US R&Company D; calf serum (FBS) was purchased from Hyclone; lipopolysaccharide (LPS) was purchased from Sigma company; dimethylthiazole (MTT) from Amresco; dimethyl sulfoxide (DMSO) was purchased from Sigma; dexamethasone (DMX) was purchased from Sigma; cyan chain double antibody was purchased from Gibco; distilled water, self-made in laboratories.

1.3 Main instruments

TGL-20B high speed bench centrifuge (shanghai anting scientific instruments factory); a micro-oscillator (Honghua instrument factory in Jintan city, Jiangsu province); -70 ℃ warm fridge (Haier); CO 2₂Incubators (Forma Scientific, usa); inverted microscope (Olympus, japan); electronic balances (mettler-toledo instruments ltd, shanghai); SW-CJ-1F clean bench (Suzhou clean-up facility); MK3 microplate reader (Thermo Electron company, usa); an electric heating constant temperature water bath kettle (Jintanshi medical instrument factory); pipette guns (Thermo); 48-well cell plates (COSTER); LC-20AT Shimadzus HPLC (Detector SPD-20A, Shimadzus, Japan); FD-1D-50 vacuum freeze drier (Beijing Bo Yi kang laboratory instruments Co., Ltd.).

2. Method of producing a composite material

2.1 cell culture

Mouse macrophage cell line RAW264.7 was cultured in 50mL of RPMI1640 medium in 5% CO₂Culturing at 37 deg.C in incubator.

2.2 administration groups

Blank control group: no medicine intervention or lipopolysaccharide stimulation is added; LPS model group: only 10 mug.L is added without medicine intervention^-1The LPS is processed to establish an inflammation model; positive control group: 0.5 mu g/L of DMX of the clotrimazone^-1The dry prognosis is 2h plus 10 mu g.L^-1LPS stimulation of (a); administration group: adding different concentrations (5 mg. L)^-1、10mg·L^-1、20mg·L^-1) The anabetamimetic acid A is used for dry prognosis for 2h plus 10 mu g.L^-1Is stimulated by LPS.

2.3 detection method

2.3.1 Effect on RAW264.7 cell viability

Cells from logarithmic growth phase were digested with 0.25% trypsin to make 1X 10⁵each.mL^-1Single cell suspensions were spotted at 100. mu.L per well in 48 well plates, placed at 37 ℃ in 5% CO₂After 24h of culture in an incubator, different concentrations (5 mg. L) are added^-1、10 mg·L^-1、20mg·L^-1) After 2h of pretreatment with Antacoside A, 10. mu.g.L of Antacoside A was added^-1The cells stimulated with LPS (Dexperienced Biotechnology) were cultured for 24 hours, and 20. mu.L, 5 mg. multidot.L, was added to each well of the above-mentioned treatment groups 4 hours before the termination of cell culture^-1At 37 ℃ for further incubation. After the cell culture was terminated, 150. mu.L of DMSO was added to each well, and the mixture was shaken until the intracellular crystals were completely dissolved, and the absorbance (OD value) of each well was measured at 530 nm using a microplate reader.

2.3.2 detection of LPS-induced RAW264.7 cell NO

Adjusted to 1 × 10⁵each.mL^-1Single cell suspensions, 100. mu.L per well in 48 well plates, grouped according to the procedure described in 4.2.2, 37 ℃ with 5% CO₂And (3) continuously culturing for 24h in the incubator, sucking the supernatant, and measuring the content of NO in the cell culture solution according to the instruction of an NO measuring kit (Griess method).

2.3.3 LPS-induced IL-1 β, IL-6, TNF- α and PGE in RAW264.7 cells₂Detection of (2)

Taking cells in logarithmic growth phase to make cell suspension concentration be 1X 10⁵each.mL^-1100 μ L per well were spotted into 48 well plates, as in the case of the procedure, according to the procedure described in 4.2.2After group treatment, 5% CO at 37 ℃₂After continuing cell culture for 24h, the supernatant was collected and IL-1 β, IL-6, TNF- α and PGE were detected by the method described in the ELISA kit₂The amount of secretion of (c).

2.4 statistical analysis

SPSS17.0 software is adopted for statistical analysis, the detection results of each group are expressed according to x +/-s, the differences among the groups are compared by adopting one-factor variance analysis, and the difference with P <0.05 has statistical significance.

3. Results

3.1 Effect on RAW264.7 cell viability

The MTT results are shown in FIG. 9, after three concentrations of the antacid A intervene in the cells for 24h, the three doses of the antacid A have no statistical significance (P >0.05) compared with the blank control group, which indicates that the antacid A has no significant effect on the activity of the cells.

3.2 detection of NO

As shown in fig. 10, the NO production was significantly increased in the model group compared to the blank control group, and the difference was statistically significant (P < 0.01). Compared with the model group, the treatment group of the antacid A with different dosages has obviously reduced NO production amount, the difference has statistical significance (P is less than 0.01), and the low, medium and high doses of the antacid A have gradually reduced NO content compared with the model group, and the inhibition rates of the low, medium and high doses are respectively 22.2%, 30.3% and 50.6%.

In FIG. 10, compared to blank set^##P<0.01; compared with model group^**P<0.01。

3.3 detection of IL-1 β, IL-6

Compared with a blank control group, IL-1 β and IL-6 are both increased remarkably (P <0.01), and the secretion amounts of IL-1 β and IL-6 treated by the antavomimetic A are both reduced remarkably (P <0.01) compared with the model group, wherein the secretion amounts of IL-1 β treated by the low dose and the medium dose of the antavomimetic A are not statistically significant (P >0.05) compared with a positive control group, and the secretion amount of IL-1 β treated by the high dose of the antavomimetic A is statistically significant (P <0.01) compared with the positive control group, and the results are shown in Table 6.

TABLE 6 Generation of IL-1 β and IL-6 in mouse cells induced by LPS with three doses of Amtakomimetic A

Compared to blank group^##P<0.01; compared with model group^**P<0.01; compared with the positive group^ΔP<0.05，^ΔΔP<0.01

3.4 detection of TNF- α, PGE2

TNF- α and PGE₂The generation of (D) is shown in Table 7, comparing the model control group with the blank group, TNF- α and PGE₂All produced are remarkably increased (P)<0.01), three doses of Anthranilic acid A administration groups compared with the model group, TNF- α and PGE₂All the production of (A) is significantly reduced (P)<0.01) wherein, in the production amount of TNF- α, the three low, medium and high doses of antavomimetic A gradually decrease, and the 20mg/L dose of antavomimetic A is most effective₂The secretion amount is lower than that of the low-dose group of the antacid A, and has no obvious difference with that of the positive control group (P)>0.05)。

TABLE 7 formation of TNF- α and PGE2 in mouse cells induced by LPS using three doses of Anthranilic acid A

Compared to blank group^##P<0.01; compared with model group^**P<0.01; compared with the positive group^ΔΔP<0.01。

Reference documents:

1)Nishikori S,Takemoto K,Kamisuki S,Nakajima S,Kuramochi K,Tsukuda S,Iwamoto M, Katayama Y,Suzuki T,Kobayashi S,Watashi K,Sugawara F.Anti-hepatitis C Virus Natural Product from aFungus,Penicilillium herquei.JournalofNatural Product,2016,79,442-446.

2)Olesya I.Zhuravleva,Maria P.Sobolevskaya,Elena V.Leshchenko,NatalyaN.Kirichuk, Vladimir A.Denisenko,Pavel S.Dmitrenok,Sergey A.Dyshlovoy,Alexander M.Zakharenko, Natalya Yu.Kim,and ShamilSh.Afiyatullov.Meroterpenoids from the Alga-Derived Fungi Penicililliumthomii Maire and Penicilillium lividum Westling.Journal of Natural Product,2014,77,1390–1395.

3) yunchun, Dingwei, Shaoshenglong, Shernig and Lingyun. Research on an active metabolite of a fungus (No 12556) belonging to the Penicillium mangrovei genus. Chinese medicinal materials 2008, 31, 960 and 962.

4) Penicillium furiosaefolia FJ-1 chemical component research [ J ] is performed on Penicillium ceratospora.

The pharmaceutical bulletin, 2013,48(11):1688-1691.

5) Raw Xuena; aging; a white piece of dough; (iii) Huahuiming; xuwenfeng; in a Peltier lake. The separation and identification of the secondary metabolite of the penicillium oxalicum HSY-P-17. Shenyang pharmaceutical university journal 2014, 31; 34-36.

6)Steven A.Wakelin,Rosemary A.Warren,Paul R.Harvey,MaartenH.Ryder.Phosphate solubilization by Penicilillium spp.closely associated withwheat roots.Biology and Fertility of Soils.2004,40(1):36-43

7) Gongming wave, a Penicillium praeparatum P8, Chinese patent No. 200810118076.9

8) A Paecilomyces lilacinus strain and its application are disclosed, Chinese patent No. 201310644028.4

9) Liubo, flavin aromatic, Shihua, Li aromatic, Zhu cyanine and Tangjianyang. Paecilomyces lilacinus strain for degrading phoxim and application thereof, Chinese patent No. 201210276405.9

10)M.LEGGETT,N.K.NEWLANDS,D.GREENSHIELDS,L.WEST,S.INMAN,and M.E.KOIVUNEN，Maize yield response to a phosphorus-solubilizing microbialinoculant in field trials，JAgric Sci.2015；153(8)：464–1478

11) Xuyangchun Shenqirong in Wangshi plum Zhenliang, a penicillium oxalicum NJDL-03 strain and its application, Chinese patent No. 201510713680.6

12) Chenzhu' an Tanshijiu plum Chenxiang Weining Sun Shengsheng, a Paecilomyces tenuipes bacterial strain and its application, Chinese patent No. 201210062125.8

13) Soil agro-chemical analysis [ M ]. beijing: agricultural Press, 1980.

<110> Zhengyi male

<120> antacid A, preparation method and application thereof

<160>1

<210>1

<211>520bp

<212>DNA

<213>Penicillium sp.

<400>1

GCATCGATGA AGAACGCAGC GAAATGCGAT AACTAATGTG AATTGCAGAA TTCAGTGAAT 60

CATCGAGTCT TTGAACGCAC ATTGCGCCCC CTGGTATTCC GGGGGGCATGCCTGTCCGAG 120

CGTCATTGCT GCCCTCAAGC ACGGCTTGTG TGTTGGGCCT CCGTCCCCCC GCCCCGGGGG 180

GACGGGCCCG AAAGGCAGCG GCGGCACCGT GTCCGGTCCT CGAGCGTATG GGGCTTTGTC 240

ACCCGCTCTG TAGGCCCGGC CGGCGCCTGC CGACCCCCAA TCATCCTTTT TTTTCAGGTT 300

GACCTCGGAT CAGGTAGGGA TACCCGCTGA ACTTAAGCAT ATCAATAAGC GGAGGAAAAG 360

AAACCAACAG GGATTGCCCC AGTAACGGCG AGTGAAGCGG CAAGAGCTCA AATTTGAAAG 420

CTGGCTCCTT CGGGGTCCGC ATTGTAATTT GCAGAGGATG CTTCGGGAGC GGTCCCCATC 480

TAAGTGCCCT GGAACGGGCT GTCATAGAGG GTGAGAATCC 520

Claims (6)

1. Antacoside A, characterized by the chemical structure:

2. according to claim1, the chemical name of the antaloid A is (E) -2- (2- (3- (2-aminobenzamide), and the molecular formula is C₁₅H₁₇N₃O₆Molecular weight is 335.1117; the compound is light yellow amorphous powder, and is easily soluble in water and dimethyl sulfoxide.

3. A method of producing antamimetic acid a, comprising: fermenting and culturing penicillium Z08 to obtain penicillium Z08 fermented product containing the antacid A, and separating the antacid A from the fermented product; the Penicillium Z08 has the preservation number as follows: CGMCC NO. 12761.

4. A process for the production of antamimetic acid a according to claim 3, wherein: the specific production method comprises the following steps:

① preparation of fermented product

Spores of penicillium Z08 were streaked out on 8 liter PDA agar plates: taking 0.5 g of yeast extract, 10.0 g of glucose, 5.0 g of calcium phosphate, 0.5 g of ammonium sulfate, 0.2 g of potassium chloride, 0.1 g of magnesium sulfate, 0.0001 g of manganese sulfate, 0.0001 g of ferrous sulfate and 15.0 g of agar, and incubating the plate at room temperature for 14 days; when the agar plate was observed to turn yellow and the spores turned green, the spores were removed from the agar plate with water, and the agar was then extracted with water; adding the obtained agar slurry into 10 liters of water, stirring for 5 hours, and filtering by metal to obtain a penicillium Z08 fermentation product;

② reversed phase liquid chromatography for separation and purification

Evaporating the fermentation product solution under reduced pressure to 2L volume, extracting with ethyl acetate for 3 times, evaporating the extractive solution under reduced pressure, drying the extract, dissolving in water, sequentially extracting with cyclohexane and methanol, and collecting methanol part for HPLC preparation;

chromatographic conditions are as follows: solvent gradients of A and B, 0-5 min, 5% A; linear gradient to 60% a from 5-15.5 min; linear gradient to 100% A for 15.5-16 min; 16-17.5 minutes, 100% A isocratic; 17.5-18 min, linear to 5% A, 18-21 min, 5% A; a is acetonitrile containing 0.1% formic acid, and B is water containing 0.1% formic acid.

5. Use of the anabolic acid a of claim 1 for the preparation of an anti-inflammatory agent.

6. Use of the anabolic acid a of claim 1 for the preparation of an anti-fibrotic medicament.

Images