CN111253490A - anti-MUM 1 protein monoclonal antibody and application thereof - Google Patents

Abstract

The invention relates to the technical field of biology, and discloses a hybridoma cell strain (with the preservation number of CGMCC No.15593) and a monoclonal antibody OTI6F6 produced by the hybridoma cell strain. The invention also relates to application of the monoclonal antibody OTI6F6 in preparing an immunodetection tool for detecting the MUM1 protein, an immunohistochemical kit containing the monoclonal antibody OTI6F6 and application of the monoclonal antibody OTI6F6 in preparing a kit for marking tumors. The monoclonal antibody can be specifically combined with MUM1 protein, has no cross reaction with other proteins in cells, and obviously improves the specificity, accuracy and reliability of MUM1 protein immunodetection.

Description

anti-MUM 1 protein monoclonal antibody and application thereof

Technical Field

The invention relates to the fields of oncology and medicine, in particular to a monoclonal antibody OTI6F6 capable of specifically binding to MUM1 protein, a cell strain for producing the monoclonal antibody, and a method and application for typing tumors by applying the antibody.

Background

Lymphoma has obvious heterogeneity in cell origin, gene expression, molecular genetics characteristics, immunophenotype and clinical manifestation, and has different treatment responses and different prognosis for different subtypes. Therefore, the method is particularly important in classifying the subtype of the lymphoma. MUM1 is a member of the transcription factor interferon regulatory factor family. It is expressed on normal plasma cells, late B cells and activated T cells, and is expressed in some B-cell and T-cell lymphomas. The antibody is a judgment target commonly used for clinical classification of lymphoma, and is clinically used for detecting the expression condition of protein in tumor cells by an Immunohistochemical (IHC) pathological experiment at present, however, the core of the IHC experiment is a monoclonal antibody specifically binding to protein, and the quality of the performance directly determines the sensitivity and specificity of the whole detection. Therefore, the development of a monoclonal antibody aiming at the MUM1 protein with higher binding specificity has important significance for IHC detection of the expression level of MUM 1.

Disclosure of Invention

In view of the above, the present invention aims to provide a monoclonal antibody that binds to the MUM1 protein with high specificity, and an application thereof in the preparation of an immunoassay tool for detecting the MUM1 protein.

The invention provides a hybridoma cell strain which is preserved in China general microbiological culture Collection center (CGMCC for short), the preservation date is 4 and 26 months in 2018, and the preservation number is CGMCC No. 15593.

The invention also provides a monoclonal antibody OTI6F6 specifically combined with the MUM1 protein, which is produced by the hybridoma cell strain.

The preparation method of the monoclonal antibody comprises the following steps:

(1) construction of recombinant expression vectors: according to the nucleotide sequence of MUM1ORF (the nucleotide sequence of MUM1ORF is shown as SEQ ID NO.1, 1353 bp; the amino acid sequence of MUM1 is shown as SEQ ID NO. 2)

Designing a primer PCR to amplify a sequence from the 1bp to the 1353bp of the MUM1ORF, respectively introducing restriction enzyme sites SgfI and MluI on two sides of a gene, inserting an expression vector pCMV6-entry, and constructing a recombinant expression plasmid pCMV6-rMUM1 from the 1 st to the 451 th of an amino acid sequence of MUM 1; upstream amplification primer sequence, SEQ ID NO.3 CACGCGATCGCGATGAACCTGGAGGGCGGC downstream amplification primer sequence SEQ ID NO.4: ACCGACGCGTCTA AGTAAGAACTTATCTC

(2) Expression and purification of the MUM1 recombinant protein: transfecting the MUM1 recombinant expression plasmid into 293T cells, cracking and centrifuging to obtain a supernatant, and purifying by a DDK affinity chromatography column to obtain a purified MUM1 recombinant protein;

(3) screening and preparing monoclonal antibodies: immunizing a Balb/c mouse by adopting the purified MUM1 recombinant protein, fusing spleen cells of the mouse with SP2/0 cells, obtaining monoclone by a limiting dilution method, screening positive hybridoma cells by an ELISA method, obtaining a hybridoma cell strain capable of secreting an anti-MUM 1 specific antibody, and naming the hybridoma cell strain as OTI6F6, wherein the subtype is identified as IgG 1; the antibody is prepared by serum-free culture medium, and is purified by an affinity chromatography column to obtain the MUM1 monoclonal antibody OTI6F 6. The sensitivity and specificity of the monoclonal antibody are verified by Western Blot and immunohistochemical experiments respectively.

The invention also provides application of the monoclonal antibody OTI6F6 in preparing an immunodetection tool for detecting the MUM1 protein.

Specifically, the immunodetection tool is a kit, a chip or test paper.

In a specific embodiment, the invention provides an immunohistochemical detection kit, which comprises the monoclonal antibody OTI6F6 and can detect the expression condition of MUM1 in tissue cells.

The invention also provides application of the monoclonal antibody in preparation of a kit for marking tumors. The tumor specifically refers to a tumor in which the proliferation of tumor cells is closely related to the expression of MUM1, and includes but is not limited to lymphoma tissues.

Compared with the prior art, the invention provides a hybridoma cell strain (with the preservation number of CGMCC No.15593) and a monoclonal antibody OTI6F6 produced by the hybridoma cell strain. The invention also provides application of the monoclonal antibody OTI6F6 in preparing an immunodetection tool for detecting the MUM1 protein, an immunohistochemical kit containing the monoclonal antibody OTI6F6 and application of the monoclonal antibody OTI6F6 in preparing a kit for marking tumors. The monoclonal antibody can be specifically combined with MUM1 protein, truly reflects the expression level of the MUM1 protein in tumor cells, and can be applied to the detection of the expression level of the MUM1 protein in lymphoma tissues.

Preservation information

The classification of hybridoma cell line OTI6F6 for preservation was designated: hybridoma cell lines of the MUM1 mouse monoclonal antibody;

the preservation unit is called as follows: china general microbiological culture Collection center;

the preservation unit is abbreviated as: CGMCC;

the address of the depository: the institute of microbiology, national academy of sciences No.3, Xilu No.1, Beijing, Chaoyang, Beijing;

the preservation date is as follows: 26 months 4 in 2018;

the preservation number is: CGMCC No. 15593.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below.

FIG. 1 shows the cloning site design of example 1 as shown in the figure, wherein the shading portion is the ORF region;

FIGS. 2 and 3 are graphs showing the identification of the plasmid expression and the purified protein in example 2.

FIGS. 4-7 are graphs showing immunohistochemical results for formalin-fixed, paraffin-embedded colon, lung, lymphoma and appendiceal tissues of example 4 (primary antibody is the MUM1 monoclonal antibody OTI6F 6);

FIG. 8 shows the results of analyzing the specificity of the monoclonal antibody OTI6F6 on the protein chip of example 5.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1 construction of MUM1 recombinant expression plasmid

Plasmid RC204876 (containing MUM1ORF1353bp) obtained from Aorutongyuan biotech GmbH in USA is used as a template, two primers are designed and respectively introduced into enzyme cutting sites SgfI and MluI, and the primers are cloned into an expression vector pCMV6-Entry to establish MUM1 recombinant expression plasmid. Cloning site design is shown in FIG. 1.

Example 2 expression and purification of MUM1 recombinant protein

1. Transfection of HEK293T cells: HEK293T cells were transferred to a petri dish at a ratio of 1:3 for further culture; adding 7.5mL of MEM (serum-free and antibiotic) into a 50mL tube, adding 300 mu of LPEI MegaTrans 1.0, and mixing uniformly; adding 75 mu g of MUM1 recombinant expression plasmid DNA into the mixed solution, mixing uniformly and standing for 30 minutes; mu.L of each solution was added to each plate at 37 ℃ with 5% CO₂Culturing in an incubator. 24 hours after transfection, 25. mu.L of sodium butyrate 2M was added to a final concentration of 5mM per dish of cells.

2. Cell lysis: 48 hours after transfection, cell lysis was performed. The medium was aspirated, 1mL PBS was added for rinsing, and PBS was aspirated. 1mL lysis buffer was added and the protease inhibitors PI and PMSF were added before use. Placing in ice box, shaking on shaking table, collecting all the culture dishes to obtain lysate, centrifuging at 4 deg.C, and collecting supernatant. A small amount of supernatant was taken and WB was used to identify the expression of recombinant MUM1, the results are shown in FIG. 2.

3. And (3) purifying the DDK affinity chromatography column: filtering the centrifuged lysate supernatant by a 0.45 mu M and 33mm PVDF membrane filter, transferring the lysate supernatant into a 15mL tube, adding 1mL of mixed Beads, sealing, putting into a 360-degree mixer, and combining for 2 hours at 4 ℃; taking out a 15mL tube, pouring the lysate into a BIO-RAD chromatographic column, and then taking out the penetrating fluid, and sampling the penetrating fluid after dripping off for WB detection; washing the column material with lysis buffer solution for 1-2 times, washing the Beads with TBST for 3 times after dripping off, eluting with 0.1M Glycine pH3.5 after dripping off, 200 μ L for the first time, dripping off without collecting, 500 μ L for the second and third times, 250 μ L for the third time, collecting into a 1.5mL centrifuge tube, and rapidly adding NaH₂PO₄(pH 11.0) to pH7.0, each tube was added to 10% glycerol and 0.1% Tween-80. The purified recombinant MUM1 protein was identified by SDS-PAGE, see FIG. 3.

As can be seen from the results in FIG. 2, after WB detection in HEK293T cell lysate transfected with pCMV6-rMUM1 plasmid, a distinct specific band at 48kD was observed, which substantially coincided with the theoretical molecular weight of 51 kD. Indicating that the recombinant MUM1 protein is specifically expressed in the cells.

As can be seen from the results in FIG. 3, the purified protein has an obvious specific band in the middle of 45-60 kD of PAGE gel, and the molecular weight of the purified protein is basically consistent with the theoretical molecular weight of 51kD of polypeptide. The result shows that the MUM1 recombinant protein with better purity is obtained.

Example 3 preparation and screening of MUM1 monoclonal antibody

The recombinantly produced purified MUM1 protein fragment was used to immunize Balb/c mice (Experimental animals technologies, Inc., Viton, Beijing) according to standard methods. The specific method comprises the following steps:

1. animal immunization: emulsifying the purified MUM1 antigen with complete Freund's adjuvant, immunizing Balb/c mice of 6-8 weeks old by subcutaneous or intraperitoneal injection, wherein the immunization dose is 50 mu g/mouse, carrying out the second immunization after two weeks, emulsifying with incomplete Freund's adjuvant, and the immunization dose is 50 mu g/mouse. After twice immunization, tail blood is taken and subjected to gradient dilution by an ELISA method to determine the serum titer; and determining whether to strengthen the immunity according to the result, and selecting the mouse with the highest antibody titer for cell fusion.

2. Cell fusion: the myeloma cells adopt sp2/0 from Balb/c, and are in logarithmic growth phase during fusion; taking the spleen of an immunized mouse, and preparing a lymphocyte single cell suspension; mixing mouse spleen lymphocyte and myeloma cell at 1:5-1:10, adding 1mL of 50% PEG (PH 8.0) at 37 deg.C, adding incomplete culture medium and rest stop solution, centrifuging, removing supernatant, adding HAT culture medium, suspending, mixing, metering MC to 50mL, subpackaging in 3.5cm culture dish, placing in wet box, placing at 37 deg.C and 5% CO₂Culturing in a constant temperature incubator.

3. Screening and cloning: cell clones were picked within 7-10 days of fusion and tested by ELISA using MUM1 purified recombinant protein. The cell line number was labeled. And (3) performing limited dilution on the positive well cells, measuring the ELISA value 5-6 days after each limited dilution, and selecting the monoclonal well with the higher OD280 positive value for performing limited dilution until the whole plate result of the 96-well plate is positive in ELISA measurement. And (4) selecting a monoclonal fixed strain with a high positive value. The corresponding fused plate cell line was OTI6F 6.

4. Preparing and purifying ascites monoclonal antibody: intraperitoneal injection of 0.5mL of pristanone into 10-12-week-old male Balb/c mice, intraperitoneal injection of 1mL of PBS-washed and resuspended monoclonal cell suspension into each mouse after one week, wherein the cell usage amount is 5 x 10⁶Per, 2 mice were raised for each antibody. And after ascites of the mouse accumulates, collecting ascites, centrifuging to obtain a supernatant, purifying the ascites by an affinity chromatography, selecting a corresponding column material according to an antibody subtype, purifying by adopting protein G, wherein the monoclonal antibody generated by the cell strain OTI6F6 is IgG 1. And (3) measuring the concentration of the purified monoclonal antibody, detecting WB, subpackaging and freezing at-20 ℃.

Example 4 immunohistochemical detection of monoclonal antibody OTI6F6 as Primary antibody

(1) And the experimental method comprises the following steps:

1. formalin-fixed human lymph node tissue and human tonsil tissue blocks were paraffin-embedded and sectioned using a Finesse microtome, tissue thickness 6 μm.

2. Dewaxing and hydrating: analytically pure xylene 3 × 10min, anhydrous ethanol 3 × 10min, 95% ethanol 5min, 85% ethanol 5min, 75% ethanol 5min, and deionized water soaking for 3min × 3 times

3. Adding antigen repairing solution (0.01M, pH6.0 sodium citrate buffer solution), autoclave heating for 3min, cooling to about 90 deg.C, opening the autoclave, taking out the specimen, and naturally cooling to room temperature. Soaking in deionized water for 3min × 3 times.

4. Tissue endogenous peroxidase was inactivated with 3% hydrogen peroxide and allowed to stand at room temperature for 10 min. Soaking in deionized water for 5min × 3 times.

5. Adding blocking solution (PBS + 5% skimmed milk powder + 5% normal goat serum), and incubating at 37 deg.C for 60 min.

6. Blocking solution was removed, no rinse was performed, and MUM1 mab (OTI6F6) was added at a dilution ratio: and (1) 150, diluting by using a confining liquid. The cells were incubated in a wet box at 37 ℃ for 60 min. PBST (0.1% Tween-20) washing 2 times, each washing for 5 min. PBST (0.02% Tween-20) washing 1 time, each washing for 5 min.

7. Polink-kit 2 (Catlogo No. D37-15) reagent 1 was added dropwise and incubated at 37 ℃ for 10-20 minutes. Wash 3 times with PBS for 5min each. Polink-2 kit (Catlog No. D37-15) reagent 2 was added dropwise, incubated at 37 ℃ for 10-20 min, and washed 3 times with PBS for 5min each.

8. And (3) developing by using DAB solution (China fir Jinqiao ZLI-9019) for 3-10 min. Washing with distilled water.

9. Hematoxylin counterstain cell nucleus for 2min, rinse with distilled water, and differentiate with 1% hydrochloric acid. Rinsing with distilled water for 3 times, and standing at room temperature for 1 min.

10. Dehydration and transparency: 75% ethanol for 5min, 100% ethanol for 5min x 3 times, 85% ethanol for 5min, 95% ethanol for 5min, and 100% ethanol for 3 x 5 min; xylene 3X 5min, neutral gum mounting.

11. Microscopic examination is shown in FIGS. 4-7.

(2) And the experimental result is as follows:

as can be seen from the results of FIGS. 4-7, specific nuclear staining was seen in infiltrating lymphocytes of colon cancer, lung cancer, lymphoma and appendix. The result is consistent with the intracellular localization and tissue expression specificity of the MUM1, and shows that the monoclonal antibody OTI6F6 can be used for immunohistochemical detection of the level of the MUM1 protein.

Example 5 specific detection of monoclonal antibody OTI6F6

OriGene high density protein chips contained 10,000 HEK293T cell protein overexpression lysates, each protein lysate had two copies of the repeat on the chip. Protein lysates were blotted on nitrocellulose membranes. The location of each tick of protein lysate can be accurately located by Excel file. The protein on the protein chip is divided into 40 sub-matrixes, each sub-matrix is provided with a plurality of references, and the content of the protein on each chip point can be quantified, the repeatability of each immunoreaction data can be monitored, and the direction of a positive signal can be positioned. The following is an experimental procedure for performing an OTI6F6 antibody identification experiment using an OriGene protein (OriGene Cat PA100001) chip:

1. one protein chip was placed in a 50mL centrifuge tube, soaked with 40mL deionized water, placed on a shaker, and mixed for 30 minutes at room temperature. The deionized water was discarded and the chip was equilibrated using 10ml of pbs. The reaction mixture was treated at room temperature for 10 minutes.

2. 40mL of 5% skim milk (diluted with PBST) was added to a 50mL centrifuge tube and placed on a shaker and blocked for 30 minutes at room temperature.

3. Primary anti-OTI 6F6 was diluted with blocking solution (5% skim milk) at a dilution ratio of 1: 100.

4. The clean sealing film is pasted on an experiment table, and 250-300 mu L primary antibody is dripped on the sealing film.

5. And (3) extracting the protein chip from the confining liquid, enabling one surface of the NC membrane of the protein chip to face downwards, contacting the antibody from one side of the chip, slowly sliding down, and slowly infiltrating the NC membrane of the chip by the antibody by virtue of the surface tension of the liquid until the whole NC membrane is infiltrated in the primary antibody solution. The whole operation process avoids generating bubbles. The chip was moved to a 4 ℃ environment, allowed to stand and incubated overnight for the first antibody. The cover of the culture dish is covered on the chip, and a piece of wet paper towel is adhered on the cover of the culture dish, so that the evaporation of the antibody caused by long-time incubation is prevented.

6. The next day the chip was transferred to a 50mL centrifuge tube and the chip was rinsed twice with PBST to remove excess antibody. The chip was washed with 40mL of PBST (0.1% Tween-20), placed on a shaker, mixed well and washed three times for 5min each time.

7. The secondary antibody, DyLight649-conjugated AffiniPurceFragment Goat-anti-Mouse IgG, was diluted with blocking solution (5% skim milk) at a dilution ratio of 1: 400.

8. The secondary antibody incubation was performed according to the above step 4 and step 5. Incubate at room temperature for 1 hour. The chip was covered with aluminum foil paper to prevent signal bleaching.

9. The chip was washed using PBST as described above in step 6.

10. The chip was rinsed with deionized water to remove residual salts and denaturants.

11. The chip was dried at room temperature to ensure complete drying of the chip.

12. The fluorescent signal is read using a chip scanner.

13. The chip orientation and the sites of positive signals were determined from BSA-Cy3 and BSA-Cy 5.

14. And finding out the ID of the corresponding protein lysate according to the positive signal sites, and finding out the information such as the name of the corresponding protein, the NCBI entry number (access number), the protein ID, the protein size and the like according to the lysate database information.

The result shows that the monoclonal antibody OTI6F6 has no non-specific recognition of other proteins on the OriGene protein chip, and shows that the monoclonal antibody OTI6F6 has better specificity.

Claims (6)

1. A monoclonal antibody that specifically binds to multiple myeloma oncogene 1(MUM1) protein;

the monoclonal antibody is generated by a hybridoma cell strain OTI6F6, and the preservation number is CGMCC No. 15593.

2. Use of the monoclonal antibody of claim 1 in the preparation of an immunoassay tool for detecting multiple myeloma oncogene 1 protein.

3. The use according to claim 2, wherein the immunoassay means is a reagent, kit, chip or strip.

4. An immunohistochemical detection kit comprising the monoclonal antibody according to claim 1.

5. Use of a monoclonal antibody according to claim 1 for the preparation of a kit for labelling tissue cells.

6. The use of claim 5, wherein the tissue cell is a lymphoma tissue.

Images