CN111253470B

CN111253470B - Immunomodulatory factor IDR-1018 derived peptides and uses thereof

Info

Publication number: CN111253470B
Application number: CN201911152717.7A
Authority: CN
Inventors: 王潇; 谭欣怡; 周家乐; 谢皓吉
Original assignee: Ningbo University
Current assignee: Ningbo University
Priority date: 2019-11-22
Filing date: 2019-11-22
Publication date: 2023-01-10
Anticipated expiration: 2039-11-22
Also published as: CN111253470A

Abstract

The invention discloses an immunomodulatory factor IDR-1018 derived peptide and application thereof, which is characterized in that a novel derived peptide 1018M is obtained by optimizing and designing the molecular structure of the antibacterial peptide IDR-1018, the amino acid sequence of the novel derived peptide is shown as SEQ ID NO. 1, and the nucleotide sequence is shown as SEQ ID NO. 3; the novel derivative peptide D1018 is obtained by replacing D-type amino acid of the antibacterial peptide IDR-1018, the amino acid sequence of the novel derivative peptide D1018 is shown as SEQ ID NO. 2, and the nucleotide sequence is shown as SEQ ID NO. 4; the antibacterial peptide 1018M and D1018 have good bactericidal effects on gram-positive bacteria and gram-negative bacteria, the hemolytic activity of the mouse erythrocyte is obviously reduced by 1018M compared with that of parent peptide, the stability of protease is obviously improved by D1018 compared with that of the parent peptide, and the resistance of the biomembrane of the antibacterial peptide 1018M and D1018 is obviously improved by 1018M and D1018 compared with that of the parent peptide.

Description

Immunomodulatory factor IDR-1018 derived peptides and uses thereof

Technical Field

The invention relates to an antibacterial peptide, in particular to an immunomodulatory factor IDR-1018 derived peptide and application thereof.

Background

The antibacterial peptide is a small molecular polypeptide with biological activity formed by degrading precursors produced by biological organisms through protease, and mainly forms a first defense line of body defense. The action mechanism of the antibacterial peptide on bacteria is mainly to take a membrane as a target site, and the antibacterial peptide is inserted into a cell membrane to form a transmembrane hole through electrostatic force and receptor-mediated cell membrane acting force to cause the change of membrane permeability and reduce the stability of the cell membrane, so that the bacterial content is finally leaked out and dead. Due to the special action mechanism of the antibacterial peptide, the antibacterial peptide is not easy to generate drug resistance and has the bactericidal effect on a plurality of clinical drug-resistant bacteria. Therefore, the antibacterial peptide can replace the traditional antibiotics and is applied to the fields of medicine and health, feed additives, food preservation and the like.

Although natural antibacterial peptides have general advantages, some obvious disadvantages exist, for example, part of antibacterial peptides have relatively low activity, have strong toxicity and poor selectivity to eukaryotic cells in clinical application, play a certain role in killing normal flora in eukaryotic organisms and cause metabolic disorder, and the disadvantages are bottlenecks for limiting the development of the antibacterial peptides. Therefore, based on the research on the relationship between the structure and the function of the antibacterial peptide, the novel design and the structural modification are carried out on the existing antibacterial peptide by a bioinformatics method so as to obtain the antibacterial peptide derivative with high antibacterial activity and low toxicity.

Inherent immune regulator (IDR) IDR-1018 (VRLIVAVRIWRR-NH) ₂ ) Is antibacterial peptide bactenecin linear mutant Bac2A (RLARIVVIRVAR-NH) ₂ ) The small peptide is used as a template, and has simple structure, antibacterial property, anti-biofilm property, immunoregulatory activity and low hemolysis, and is obtained by amino acid replacement and reordering modification. But are limited in their further clinical use by in vivo instability and limited activity. Therefore, there is a need to improve antibacterial and anti-biofilm activities and stability and reduce hemolytic activity by engineering antibacterial peptides.

Disclosure of Invention

The technical problem to be solved by the invention is to provide an immunomodulatory factor IDR-1018 derived peptide with high antibacterial property, anti-biofilm activity, high stability and low hemolytic activity and application thereof.

The technical scheme adopted by the invention for solving the technical problems is as follows:

1. an immunomodulatory factor IDR-1018 derived peptide is 1018M peptide or/and D1018 peptide, wherein the amino acid sequence of 1018M peptide is VRLRWWRRRWRR-NH ₂ The amino acid sequence of the D1018 peptide is shown as VRLIVAVRIWRR-NH ₂ As shown.

2. The preparation method of the peptide derived from the immunoregulatory factor IDR-1018 comprises replacing amino acid residues I, V, A, V, and I at positions 4-7 and 9 with R, W, R, and R based on IDR-1018 parent peptide sequence to obtain a mutant antibacterial peptide 1018M with amino acid sequence such as VRLRWWRRRWRR-NH ₂ As shown.

3. The preparation method of IDR-1018 derived peptide of the immunoregulatory factor is based on IDR-1018 parent peptide sequence as antibacterialD-amino acid substitution of peptide IDR-1018 to obtain a novel derivative peptide D1018, the amino acid sequence of which is VRLIVAVRIWRR-NH ₂ As shown.

4. The gene of 1018M peptide with the nucleotide sequence as shown in gtgcgccctgcgcctggtggccgcgccgcctggcgcgcgcgcgcgcgcgcgcgcgcgc encodes the peptide derived from IDR-1018 immunoregulator.

5. The gene of the D1018 peptide is shown as the nucleotide sequence of gtgcgccctgatttgtggcggtgcgcgcgcgcatttggcgccgccgc. Considering the degeneracy of codons and the preference of codons of different species, the skilled person can use codons suitable for the expression of a particular species as required.

6. An expression cassette comprising the gene defined by IDR-1018 derived peptide 1018M or IDR-1018 derived peptide D1018.

7. A vector comprising the gene described for IDR-1018-derived peptide 1018M or IDR-1018-derived peptide D1018 or the expression cassette described above.

8. A transgenic cell line or an engineered bacterium containing the gene described by IDR-1018 derived peptide 1018M or IDR-1018 derived peptide D1018, the above expression cassette or the above vector.

9. Use of the IDR-1018 derived peptide for the manufacture of an antibacterial medicament or composition for the treatment of bacterial infections.

10. The use of an IDR-1018-derived peptide as described above for the preparation of an antibacterial biofilm drug or composition.

Compared with the prior art, the invention has the advantages that: the invention relates to an immunoregulatory factor IDR-1018 derived peptide and application thereof, wherein the molecular structure of the antibacterial peptide IDR-1018 is optimally designed, and amino acid residues I, V, A, V and I at 4-7 and 9 are replaced by R, W, R and R to obtain a mutant antibacterial peptide 1018M. Mutant 1018M consists of 12 amino acids, has a molecular weight of 1882.26Da and an isoelectric point of 12.78. In addition, the inventor obtains a novel derivative peptide D1018 by replacing an amino acid of IDR-1018D type of antibacterial peptide. The antibacterial peptides 1018M and D1018 of the invention not only have good antibacterial activity. And the results of crystal violet staining method and scanning electron microscope test show that the anti-biofilm activity of the two derived peptides is obviously improved compared with that of the parent peptide. In addition, 1018M significantly reduced hemolytic activity on mouse erythrocytes and D1018 significantly increased stability to trypsin.

In conclusion, compared with the parent peptide, the immunoregulatory factor IDR-1018 derived peptide has the advantages that the bactericidal activity and the anti-biofilm activity are improved, the hemolysis is obviously reduced by 1018M, the enzymolysis resistance is obviously improved by D1018, and meanwhile, the molecular weights of the antibacterial peptide 1018M and the D1018 are small, so that the immunoregulatory factor IDR-1018 derived peptide is easy to artificially synthesize, is a small-molecular polypeptide with high application value, can be used for preparing novel antibacterial anti-infective medicaments and the like, and has a good application prospect.

Drawings

FIG. 1 shows the results of a sterilization curve experiment for IDR-1018 derived peptides 1018M, D1018 in example 2 of the present invention;

FIG. 2 is a graph of the results of a temperature stability test for IDR-1018 derived peptides 1018M, D1018 of example 3 of the present invention, wherein the abscissa is the treatment temperature and the ordinate is the MIC of the peptide for Staphylococcus aureus ATCC43300 under the treatment;

FIG. 3 is a graph showing the results of an enzyme stability test for IDR-1018 derived peptides 1018M, D1018 of example 3 of the present invention, wherein the abscissa is the different enzyme species and the ordinate is the MIC of the peptide for Staphylococcus aureus ATCC43300 under the treatment;

FIG. 4 is a graph showing the results of acid-base stability experiments on IDR-1018 derived peptides 1018M, D1018 of example 3 of the present invention, wherein the abscissa is the different pH values and the ordinate is the MIC of the peptides for Staphylococcus aureus ATCC43300 under the treatment;

FIG. 5 shows the hemolytic test results for IDR-1018 derived peptides 1018M, D1018 of example 4 of the present invention;

FIG. 6 shows the result of the experiment for measuring the resistance of IDR-1018 derived peptides 1018M and D1018 to the biological membrane by the crystal violet staining method in example 5 of the present invention;

FIG. 7 shows the result of the experiment for measuring the resistance of IDR-1018 derived peptides 1018M and D1018 to the biofilm by scanning electron microscopy in example 5 of the present invention: wherein, A: blank control; b:1018 64ug/ml; c:1018M 64ug/ml; (ii) a D: d101864ug/ml.

Detailed Description

The invention is described in further detail below with reference to the accompanying examples.

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are commercially available products.

Example 1

Design and Synthesis of IDR-1018-derived peptides 1018M, D1018

1. Based on the IDR-1018 parent peptide sequence, the polypeptide is modified by replacing amino acid residues and properly increasing the positive charge and the small molecule binding property of the antibacterial peptide, and finally the mutant antibacterial peptides 1018M and D1018 are determined. Wherein, the molecular structure of the antibacterial peptide IDR-1018 is optimally designed, and amino acid residues I, V, A, V and I at the 4 th to the 7 th and the 9 th positions are replaced by R, W, R and R to obtain a mutant antibacterial peptide 1018M. Mutant 1018M consists of 12 amino acids, has a molecular weight of 1882.26Da and an isoelectric point of 12.78. In addition, a novel derivative peptide D1018 was obtained by substituting an amino acid of the D-form of antimicrobial peptide IDR-1018.

2. The amino acid sequences of the genes of the antibacterial peptide 1018M and the D1018 are correspondingly as VRLRWWRRRWRR-NH ₂ And VRLIVAVRIWRR-NH ₂ The nucleotide sequence is shown as gtgcgcgcctgcgcctggtggcgccgccgctggccgcgcgcgcgcgcgc and gtgcgccctgattggcggcgggtgcgcatttggcgccgccgc.

3. The antibacterial peptide is synthesized by a solid-phase synthesis method through a twelve-channel semi-automatic polypeptide synthesizer. Purity (> 90%) of the synthesized peptide was determined by reverse phase high performance liquid chromatography on C18 column, ESI-MS mass spectrometry confirmed the molecular weight of the derived peptides 1018M, D1018.

Example 2

Bacteriostasis experiment of IDR-1018 derived peptides 1018M and D1018

The pathogenic bacteria in this example were obtained from the American Type Culture Collection (ATCC), and the specific strains are shown in Table 1.

Determination of Minimum Inhibitory Concentration (MIC) of the derived peptide is carried out according to the methods established by the Clinical and Laboratory Standards Institute (CLSI) (WIEGAND et al, adhesive and cloth dilution methods to determine the Minimum Inhibitory Concentration (MIC) of antimicrobial sub-sites Nature protocols,2008,3 (2): 163-175), with minor modifications as the case may be:

picking single colony of tested strain into MH liquid culture medium, oscillating at 37 deg.C and 250rpm overnight for culture and activation, transferring into MH liquid culture medium, and culturing to logarithmic growth phase (OD) _{600 nm} = 0.4-0.6), and then prepared into 10 ⁵ CFU/mL of the culture solution was added to a 96-well sterile cell culture plate at 90. Mu.L/well.

IDR-1018 derived peptides 1018M, D1018 were diluted with PBS buffer by 2-fold dilution, 10. Mu.L of antimicrobial peptide per well, to final concentrations of 128, 64, 32, 16, 8, 4, 2, 1, 0.5, 0.25, 0.125 and 0.0625. Mu.g/mL, respectively, with the negative control being PBS buffer instead of the antimicrobial peptide of the test bacterial solution and the blank control being sterile MH medium. Three replicates were made for each treatment.

And placing the culture plate in a constant-temperature incubator at 37 ℃ for incubation for 16-18h until visible obvious turbid bacterial liquid appears in the negative control hole, wherein the minimum concentration capable of completely inhibiting the bacterial growth is the MIC value of the antibacterial peptide to the tested strain. And if the hole jumping or the inconsistent results among the parallel samples occur, retesting. The results are shown in table 1, and the antimicrobial peptide shows good bacteriostatic effects to various strains.

TABLE 1 MIC value determination of IDR-1018-derived peptides 1018M, D1018

As shown in fig. 1, it is seen from fig. 1 that s.aureus ATCC43300 showed a sharp decline trend within 2 hours after 1 ×,2 × and 4 × IDR-1018 and its derived peptides 1018M, D1018 treatment, and had time and concentration dependency, and the derived peptides 1018M, D1018 had a similar bactericidal trend and were superior to the parent peptide and vancomycin.

Example 3

Stability of IDR-1018 derived peptides 1018M, D1018

1. Thermal stability test: IDR-1018 derived peptide 1018M and D1018 sample peptide are respectively placed in the environment of 20 deg.C, 40 deg.C, 60 deg.C, 80 deg.C and 100 deg.C to incubate for 1h, after cooling, 10 μ l sample peptide are respectively added into 90 μ l log phase (1 × 10) ⁵ cfu/ml) of staphylococcus aureus ATCC43300 to final peptide concentrations of 64, 32, 16, 8, 4, 2, 1, 0.5 and 0.25 μ g/ml, the negative control group was a test bacterial solution of normal saline instead of antimicrobial peptide, the blank control group was a sterile MH medium, and three replicates each were treated. And (3) placing the culture plate in a constant-temperature incubator at 37 ℃ for incubation for 16-18h until visible obvious turbid bacterial liquid appears in the negative control hole, and observing the MIC change condition of the peptide after treatment at different temperatures. As shown in fig. 2, it can be seen from fig. 2 that activity of IDR-1018 and derivative peptide D1018 is reduced by 2-4 times when incubated at 60 ℃ or higher for 1 hour, whereas tolerance of derivative peptide 1018M to high temperature is significantly higher than that of the parent peptide, activity is unchanged after incubation at 100 ℃ for 1 hour, and this property facilitates storage of the drug to some extent.

2. Enzyme stability test: dissolving pepsin (3000U/mg, pH 2.0), trypsin (250U/mg, pH 8.0) and antibacterial peptide lyophilized powder in an optimal buffer solution corresponding to the enzymes according to a ratio of 1 to 10 (w/w), standing and incubating at 37 ℃ for 3 hours, taking 10 mu l, adding into 90 mu l log phase (1X 10) ⁵ cfu/ml) staphylococcus aureus ATCC43300 bacterial liquid, the final concentrations of the antibacterial peptides are 64, 32, 16, 8, 4, 2, 1, 0.5 and 0.25 mu g/ml, corresponding buffer solutions are used as controls, the antibacterial peptides are incubated in a constant-temperature incubator at 37 ℃ for 16-18 hours until obvious turbid bacterial liquid visible to the naked eye appears in negative control holes, and the change condition of the MIC of the peptides after different protease treatments is observed. As shown in fig. 3, it can be seen from fig. 3 that the antibacterial activity of the derivative peptide D1018 treated with pepsin or trypsin is not changed, and the resistance to pepsin and trypsin is significantly higher than that of the parent peptide. The derived peptide 1018M had significantly improved pepsin resistance compared to the parent peptide, but trypsin was identical to the parent peptide. The stability of the derived peptidase is improved to a certain extent, so that the medicine is convenient to use in vivo, especially orally.

Ph stability test: the sample peptides were dissolved in glycine-HCl (pH 2.0), citric acid buffer (pH 4.0), sodium phosphate buffer (pH 6.0), tris-HCl (pH 8.0) and glycine-NaOH (pH 10), respectively0), incubating for 3h at 37 ℃. After the incubation, 10. Mu.l of each of the solutions was added to 90. Mu.l of each of log phase (1X 10) ⁵ cfu/ml) to final peptide concentrations of 64, 32, 16, 8, 4, 2, 1, 0.5 and 0.25. Mu.g/ml in Staphylococcus aureus ATCC43300 strain, while the buffer without peptide was treated under the same conditions as a negative control. Incubating in a constant-temperature incubator at 37 ℃ for 16-18h until obvious turbid bacteria liquid visible to naked eyes appears in the negative control hole, and observing the MIC change condition of the peptides after treatment at different pH values. As shown in fig. 4, it can be seen from fig. 4 that derived peptides D1018 and 1018M differ by only 1-2 fold at each pH, and that the pH stability is significantly better than that of the parent peptide IDR-1018 (the MIC varies up to 4-fold in acidic or alkaline environments). This property facilitates the use of the drug in particular in vivo and in vitro environments.

Example 4

Hemolytic study of IDR-1018-derived peptides 1018M, D1018

The hemolytic property is an important index for measuring whether the antibacterial peptide is suitable for intravenous injection treatment, and the specific operation is as follows:

taking a 6-week-old SPF-grade ICR female mouse, taking blood from eyeballs, and collecting by using a heparin sodium anticoagulation tube. The collected blood was centrifuged at 1500rpm at 4 ℃ for 10min, and erythrocytes were washed repeatedly three times with 10mM PBS (pH 7.3) until the supernatant was colorless and transparent, to prepare an 8% erythrocyte suspension.

The sample peptide was dissolved in sterile 0.9% physiological saline to prepare a mother liquor at a concentration of 128. Mu.g/mL, and diluted 2-fold to a final concentration of 1. Mu.g/mL. Each 100. Mu.L of the erythrocyte suspension and the antimicrobial peptide solution were added to a 96-well plate to give a final erythrocyte concentration of 4% (volume concentration).

Placing the mixed solution in a constant temperature incubator at 37 ℃ for standing incubation, centrifuging at 1500rpm for 5min at 4 ℃ after 1h, absorbing the supernatant into a 96-well plate, and detecting the ultraviolet light absorption value by using a microplate reader at 540 nm. Physiological saline and 0.1% Triton X-100 were assayed under the same conditions as 0% and 100% hemolysis control experiments, respectively. The degree of hemolysis is calculated as follows:

degree of hemolysis (%) = [ (Abs) _{540 nm} Antimicrobial peptide-Abs _{540 nm} saline)/(Abs _{540 nm} 0.1％Triton X-100－Abs _{540 nm} Physiological saline solution]×100％

The results of the experiment are shown in FIG. 5. The hemolytic rates of the antibacterial peptides 1018M and D1018 are 0% and 2.2% under the concentration of 128 mu g/mL, and the antibacterial peptides are extremely low in hemolytic property and not easy to cause damage caused by rupture and dissolution of erythrocytes of mammals, so that the antibacterial peptides are very favorable for further development and application in the field of medicine.

Example 5

IDR-1018 derived peptides 1018M, D1018 anti-biofilm effects

1. Crystal violet dyeing method

To investigate the effect of fDLPs on biofilm formation, s.aureus atcc43300 was diluted in TSB medium at a concentration of 1 × 10 ⁸ cfu/ml, and cultured in 96-well plates at 200. Mu.l per well. 1018M and D1018 were added to 96-well plates in serial 2-fold dilution, wells without added antibacterial substance were negative control blank, wells with fresh TSB medium were blank control wells, and the plates were incubated in an incubator at 37 ℃ for 24 hours. The culture medium supernatant in each well was carefully aspirated off with a pipette, followed by 3 times washing with PBS and air-drying. Adding 100uL of 2.5% glutaraldehyde into each well, discarding the stationary liquid after 90min, and washing twice with PBS buffer; dyeing with 0.1% crystal violet 100ul for 15min, washing off the dye solution with distilled water, and drying at room temperature; dissolving in 200ul95% ethanol for 30min, and measuring OD at wavelength 570. As shown in FIG. 6, 1018M and D1018 showed that the formation of a biofilm of methicillin-resistant Staphylococcus aureus was inhibited in a concentration-dependent manner as shown in FIG. 6. The percentage of biofilm mass in S.aureus ATCC43300 decreased 78.9% and 91.4% after 1018M treatment at 32 and 64. Mu.g/ml for 24h. Percentage of biofilm reduction of s.aureus ATCC43300 was 16.7%, 30.8%, 76.2%, 86.9% and 82.8% after treatment for 24h with 4, 8, 16, 32 and 64 μ g/ml D1018. The results show that 1018M and D1018M can effectively inhibit the formation of a staphylococcus aureus biomembrane, and the effect is obviously higher than that of a parent peptide.

2. Scanning electron microscopy

S.aureus ATCC43300 cultured to the middle logarithmic phase was prepared to 1X 10 with TSB medium ⁸ cfu/ml of bacterial suspension; the bacterial suspension was added to 48-well plates, and a sterile guide strip was placed in each plate to attach the biofilm. Adding 64 μ g/ml1018M and D1018, culturing in 37 deg.C constant temperature incubatorTaking out the guide plate after 24h of cultivation, washing the guide plate with sterile normal saline for three times, and removing planktonic bacteria; fixing with 2.5% glutaraldehyde at 4 deg.C for 15min, and rinsing with sterile normal saline for three times; dehydrating with ethanol (50% -70% -85% -95% x 2-100% x 2) gradient, drying at room temperature for 5min each time, forming a metal film on the sample surface with ion sputtering instrument, and observing with scanning electron microscope. As shown in FIG. 7, it is clear from FIG. 7 that the negative control group exhibited cells agglomerated together and appeared in a sheet form; by adding 64 mu g/ml of parent peptide IDR-1018 and derivative peptides 1018M and D1018, bacterial colonies are obviously reduced, only sporadic bacterial colonies exist in groups of the derivative peptides 1018M and D1018, and the bacterial morphology is seriously damaged, which shows that the derivative peptides 1018M and D1018 have effective inhibition effect on S.aureu biomembrane generation, and the inhibition effect is obviously higher than that of the parent peptide.

The above description is not intended to limit the present invention, and the present invention is not limited to the above examples. Those skilled in the art should also appreciate that they may make various changes, modifications, additions and substitutions within the spirit and scope of the invention.

Sequence listing

<110> Ningbo university

<120> immunomodulatory factor IDR-1018 derived peptide and application thereof

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 12

<212> RNA

<213> 1018M amino acid sequence of peptide

<400> 1

VRLIVAVRIWRR-NH2 12

<210> 2

<211> 12

<212> RNA

<213> amino acid sequence of D1018 peptide

<400> 2

VRLRWWRRRWRR-NH2 12

<210> 3

<211> 21

<212> DNA

<213> 1018M nucleotide sequence of peptide

<400> 3

gtgcgcctgattgtggcggtgcgcatttggcgccgc 36

<210> 4

<211> 22

<212> DNA

<213> nucleotide sequence of D1018 peptide

<400> 4

gtgcgcctgcgctggtggcgccgccgctggcgccgc 36

Claims

1. An immunomodulatory factor IDR-1018-derived peptide, characterized by: the derivative peptide is 1018M peptide, wherein 1018M peptide is based on IDR-1018 parent peptide sequence, and amino acid residues I, V, A, V and I at positions 4-7 and 9 are replaced by R, W, R and R to obtain mutant antibacterial peptide 1018M with amino acid sequence VRLRWWRRRWRWRRR-NH ₂ 。

2. A gene encoding a peptide derived from the immunomodulatory factor IDR-1018 according to claim 1, wherein: the nucleotide sequence of the 1018M peptide is gtgcgccctgcctggtggccgccgctggccgcgctggcgccgccgc.

3. An expression cassette comprising the gene of claim 2.

4. A vector comprising the gene of claim 2 or the expression cassette of claim 3.

5. A transgenic cell line or engineered bacterium comprising the gene of claim 2, the expression cassette of claim 3, or the vector of claim 4.

6. Use of an IDR-1018-derived peptide of claim 1 for the preparation of an antibacterial medicament or composition for the treatment of a bacterial infection.

7. Use of an IDR-1018 derived peptide of claim 1 for the preparation of an antibacterial biofilm drug or composition.