CN111228504A - Application of ribosome S6 kinase RSK in preparing medicine for treating or repairing peripheral nerve injury - Google Patents

Abstract

The invention discloses application of ribosome S6 kinase RSK in preparing a medicament for treating or repairing peripheral nerve injury. The ribosome S6 kinase RSK is used as a molecular intervention target, and DRG axon growth is inhibited by down-regulating or interfering the ribosome S6 kinase RSK. The invention also discloses a medicine for treating or repairing peripheral nerve injury, which is characterized by at least comprising one of interference viruses of in-vitro RSK specific inhibitors SL0101 or RSK1 and RSK 2. The invention also discloses a verification method of ribosome S6 kinase RSK in the action of a medicine for repairing peripheral nerve injury, and the application of the ribosome S6 kinase RSK in the preparation of the medicine for treating or repairing peripheral nerve injury, which takes the RSK as a molecular intervention target to down-regulate or interfere the RSK, inhibits the growth of DRG axons and provides a new possible treatment medicine for the treatment after the peripheral nerve injury.

Description

Application of ribosome S6 kinase RSK in preparing medicine for treating or repairing peripheral nerve injury

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to application of ribosome S6 kinase RSK in preparation of a medicine for treating or repairing peripheral nerve injury.

Background

Activation of the intrinsic ability of neurons to regenerate following peripheral nerve injury is influenced by a variety of factors, including the translational synthesis of proteins within neurons, seeking key molecules to regulate the translational synthesis of proteins within neurons involved in axon regeneration will contribute to the regenerative repair following peripheral nerve injury. The ribosomal S6 kinase RSK (p 90 ribosomal S6 kinase), which is one of the downstream MAPK signaling pathways, is involved in a variety of biological processes and regulates the initiation and extension of protein translation through a variety of pathways. However, RSK expression in DRG tissues and its role in axon regeneration after peripheral nerve injury are rarely studied.

Disclosure of Invention

The invention aims to overcome the defects and shortcomings of the prior art and provides application of ribosome S6 kinase RSK in preparing a medicine for treating or repairing peripheral nerve injury.

In order to solve the technical problem, the embodiment of the invention provides application of ribosome S6 kinase RSK in preparing a medicament for treating or repairing peripheral nerve injury.

Further, the ribosome S6 kinase RSK is used as a molecular interference target to inhibit DRG axon growth by down-regulating or interfering the ribosome S6 kinase RSK.

Further, the drug for repairing peripheral nerve injury comprises one of in vitro RSK specific inhibitors SL0101 or RSK1 and RSK2 interfering viruses.

Preferably, the medicament for repairing peripheral nerve injury comprises the in vitro RSK specific inhibitor SL 0101.

Preferably, the drug for repairing peripheral nerve injury comprises interfering viruses of RSK1 and RSK 2.

Further, the peripheral nerve injury is a sciatic nerve injury.

The embodiment of the invention also provides a medicament for treating or repairing peripheral nerve injury, which is characterized by comprising at least one of the interference viruses of in vitro RSK specific inhibitors SL0101 or RSK1 and RSK 2.

Further, the medicament may further comprise a pharmaceutically acceptable carrier, excipient, diluent or mixture thereof.

Further, the peripheral nerve injury is a sciatic nerve injury.

The embodiment of the invention also discloses a method for verifying the effect of ribosome S6 kinase RSK in a medicine for repairing peripheral nerve injury, which is characterized by comprising the following steps:

(1) in-situ hybridization and Western blot are utilized to find that the expression of RSK1 and RSK2 in DRG tissues is obviously increased after sciatic nerve injury of rats;

(2) the in vitro RSK specific inhibitors SL0101 or RSK1 and RSK2 interfering viruses are proved to be capable of remarkably inhibiting the growth of normal or pre-injured DRG neuron axons;

(3) the rat is proved to be injected with the interference virus aiming at RSK1 and RSK2 in the intrathecal way, and the growth of axons after sciatic nerve injury can be obviously inhibited.

The technical scheme of the invention has the following beneficial effects:

(1) the invention provides application of ribosome S6 kinase RSK in preparing a medicine for treating or repairing peripheral nerve injury, and RSK is used as a molecular intervention target point to reduce or interfere RSK and inhibit DRG axon growth; and provides a medicine for repairing or treating peripheral nerve injury, and provides a new possible treatment medicine for treatment after peripheral nerve injury.

(2) In the embodiment of the invention, in-situ hybridization and Western blot are utilized to find that the expressions of RSK1 and RSK2 in DRG tissues are obviously increased after sciatic nerve injury of rats; interfering viruses with the in vitro RSK-specific inhibitors SL0101, RSK1 and RSK2 can significantly inhibit the growth of normal or pre-injured DRG neuronal axons; the rat intrathecally injects the interference virus aiming at RSK1 and RSK2, which can both obviously inhibit the growth of axon after sciatic nerve injury; the RSK can regulate the growth of DRG neuron cell axons in the peripheral nerve injury and regeneration process, is helpful for better understanding the important role played by the RSK in the nerve injury repair process, and simultaneously verifies the effectiveness of the medicament for repairing or treating the peripheral nerve injury; provides a new target for the treatment after nerve injury.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to these drawings without creative efforts.

FIG. 1 is a graph showing the results of in situ hybridization of RSK1-4 in DRG tissues after injury of sciatic nerve in rats described in example 1 of the present invention;

FIG. 2 is a WesternBlot results of RSK1 and RSK2 in DRG tissues after sciatic nerve injury in rats described in example 1 of the present invention;

FIG. 3 is a graph of the inhibition of DRG neuronal axonal growth by an in vitro RSK inhibitor as described in example 2 of this invention;

wherein, FIG. 3A is a graph of growth of DRG neuronal axons after normal or pre-injury treatment with different concentrations of the RSK inhibitor SL0101 and the mTOR inhibitor Rapamycin, the anti-Tuj1 antibody (red light) labeling axons; FIG. 3B is a statistical plot of the effect of the RSK inhibitor SL0101 and the mTOR inhibitor Rapamycin on DRG neuronal axon growth under normal conditions; FIG. 3C is a statistical plot of the effect of the RSK inhibitor SL0101 and the mTOR inhibitor Rapamycin on DRG neuronal axon growth after pre-injury treatment;

FIG. 4 is a graph of in vitro shRNA virus interference RSK1 and RSK2 inhibiting DRG neuronal axon growth in example 3 of the present invention;

wherein, FIG. 4A is a graph of mRNA levels of RSK1 and RSK2 in DRG neuronal cells after shRNA virus treatment by qRT-PCR detection; FIG. 4B is a graph of immunofluorescence results showing DRG neuronal axon growth following in vitro interference of the shRNA virus with RSK1 or RSK2 in DRG neuronal cells; FIG. 4C is a statistical plot of total length of DRG neuron axons after RSK shRNA virus treatment; FIG. 4D is a statistical plot of the longest length of DRG neuronal axons after RSKshRNA virus treatment;

FIG. 5 is a graph of neurite outgrowth following intrathecal injection of shRNA AAV2/8 virus against RSK1 or RSK2 to inhibit sciatic nerve injury in rats as described in example 4 of the invention;

wherein, fig. 5A is a flow chart of animal experiments; FIG. 5B is a graph showing the efficacy of immunohistochemical assays for detecting intrathecal injection of AAV2/8-GFP virus; FIG. 5C is a graph of neurite outgrowth after injury of sciatic nerve of rat after immunohistochemical detection of RSK shRNA AAV2/8 virus treatment, with anti-SCG10 (red light) labeling regenerated axons; FIG. 5D is a graph of statistics of axon regeneration length after RSK shRNA AAV2/8 virus treatment; FIG. 5E is a graph of statistics of the longest length of axon regeneration after RSK shRNA AAV2/8 virus treatment.

Detailed Description

In order to make the technical problems, technical solutions and advantages of the present invention more apparent, the following detailed description is given with reference to the accompanying drawings and specific embodiments.

Example 1 examination of changes in RSK family expression in DRG tissue following injury to rat sciatic nerve

1-1, constructing sciatic nerve pinching injury model of adult SD rat

27 healthy adult male SD rats, 200 + -20 g, were ordered from the university of Nantong laboratory animal center and randomized into 3 groups of 9 animals each. Injecting compound anesthetic into abdominal cavity of rat for anesthesia (0.3 ml/100 g), shaving left hind limb with iodophor for disinfection, surgically exposing left femoral middle sciatic nerve, separating nerve from muscle and basement membrane, clamping the middle site of sciatic nerve with forceps for wound, clamping wound with width of 2 mm for 30 s, suturing wound, and injecting 1ml normal saline and 0.2ml penicillin sodium solution into abdominal cavity. At three time points of 0 d, 1 d and 4d respectively, timely and quickly taking L4-L5 Dorsal Root Ganglion (DRG) tissues at the side of a clamped wound, placing the DRG tissues of 6 rats in each group into a cryopreservation tube, storing at-80 ℃ for protein extraction, placing 3 rats into a precooled 4% formaldehyde solution (for tissue section), and storing at 4 ℃.

1-2, frozen section

Taking out the completely dehydrated tissue, placing the tissue in a balance liquid (30% of cane sugar: OCT 1: 1) for balancing for 5 min, then placing the tissue in a plastic mold, adding OCT, placing the mold flatly, surrounding the mold with dry ice, finely adjusting the tissue shape until the tissue is frozen in OCT, placing the mold in liquid nitrogen or a large amount of dry ice for quick freezing, and marking the mold for frozen sections (which can be stored for a long time at-80 ℃). When slicing, the OCT block is taken out of the die, trimmed and fixed on a freezing table by the OCT, and then the slice can be sliced. And (3) slicing by using a LeicaCM3050S freezing slicer according to the experimental requirements, putting the slices in an oven with 50 ℃ for drying for 2h, and storing at-80 ℃ after drying.

1-3, in situ hybridization

Specific probes against RSK1-4 were prepared, and after sciatic nerve injury of adult rats, DRG tissue sections at two time points, 0 d and 4d after sciatic nerve injury of adult SD rats, were taken for in situ hybridization, and sense strand probe (sense) was used as a negative control for hybridization.

The method comprises the following specific steps: tissue section, 50 ℃ and 2 h; washing with DEPC water for 10 min × 3 times; treating with 0.2M HCl at room temperature for 10 min; 0.3% PBST at room temperature for 15 min; 1 × PBS 5 min × 3 times; digesting the tissue at 37 ℃ for 20 min by using 3 mu g/ml protease K; 3 mg/ml glycine/PBS for 5 min; washing with PBS for 10 min × 3 times; 4% paraformaldehyde for 15 min; incubating for 10 min with 0.1M triethanolamine/0.05% acetic anhydride/DEPC water; the ethanol is dehydrated in a gradient way, and the dehydration time is 70 percent, 80 percent, 90 percent and 100 percent in sequence for 3 min/time. And (3) probe hybridization: adding salmon sperm DNA (denatured at 100 deg.C for 5 min) into hybridization solution preheated at 42 deg.C (ratio of 1: 1000, final concentration of salmon sperm 100 μ g/ml) to obtain prehybridization solution, adding into slice, and prehybridizing at 42 deg.C for 2 h; denaturing the positive-sense probe at 65 deg.c for 10 min, ice-cooling for 2-3 min, adding to the pre-hybridizing liquid in the ratio of 1 to 200, spreading to the slice, labeling, and hybridizing at 42 deg.c for 12-16 hr; sequentially washing with 2 XSSC, 1 XSSC, and 0.1 XSSC containing 0.1% SDS at 50 deg.C for 10 min × 2 times, 15 min × 2 times, and 30 min × 2 times; incubating at room temperature for 3min by 1 Xbuffer I; buffer II (1 XBuffer I with 1% blocking), blocked for 30 min at 37 ℃; applied with anti-DIG-AP (1: 1000, made of BufferII) overnight at 4 ℃. NBT/BCIP color development: buffer I, room temperature 15 min x 2 times; buffer III, 3min washing; adding color developing solution onto the slices, reacting at room temperature, observing color developing condition every 30 min, stopping color developing reaction with 0.01M PBS at proper time, performing gradient dehydration according to 50%, 70%, 80%, 95% and absolute ethyl alcohol, transparentizing xylene, sealing with resin, drying in a fume hood, observing with a microscope, and taking a picture.

Results as shown in figure 1, the expression levels of RSK1 and RSK2mRNA were significantly increased in DRG tissues at 4d after rat sciatic nerve injury, whereas the expression changes of RSK3 and RSK4 were not significant, compared to 0 d.

1-4、 Western blot

DRG Tissue proteins at 0 d, 1 d and 4d after sciatic nerve clamp injury of rats were extracted using T-PER Tissue Protein Extraction Reagent (Pierce) Kit, Protease inhibitors were added according to the instruction of half Protein Inhibitor Cocktail Kit (Pierce), and Protein quantification was performed using BCA Protein Assay Kit (Pierce). SDS-PAGE electrophoresis was performed: denatured protein loading (20 μ g), gel concentration (5%, 80V, 30 min); the gel (10%, 110V) was separated, and the electrophoresis stop time was determined according to the size of the target band. Film transfer: PVDF (0.2 μm) membrane, methanol activated for 30 s, and mixed with glue and put in precooled membrane-transferring liquid to balance for 5 min, and wet-transferring (100V, 2 h). And (3) sealing: blocking with 5% skimmed milk at room temperature for 2 h. Incubation of the antibody: respectively shaking the mixture with antibodies rabbitant-RSK 1 (Abcam, ab32114, 1: 500) and rabbitant-RSK 2 (Abcam, ab32133, 1: 500) specific for RSK overnight at 4 ℃; TBST, 10 min is multiplied by 3 times, TBS is used for washing the membrane for 10 min; incubating the secondary antibody, shaking the table, and keeping the temperature at room temperature for 2 hours; TBST, 15 min × 3 times, TBS membrane washing, 10 min. And (3) developing: developing, developing and fixing by using an ECL darkroom; and (5) drying and scanning the film, storing and analyzing the result.

The results are shown in fig. 2, and compared with 0 d, protein expression levels of RSK1 and RSK2 in DRG tissues were significantly increased after injury at both 1 d and 4d after injury in rats.

Example 2 in vitro RSK inhibitor treatment inhibits DRG neuronal axon growth

2-1 extraction of Primary DRG neuronal cells

Anaesthesia of adults with 10% chloral hydrateSeveral SD rats were prepared with hair and disinfected with 75% alcohol, dissected from the dorsal tail, detached to remove the intact spine, opened the upper vertebral plate, removed all DRGs, and placed in dishes with Hibernate A (HA +1% PS) added; after the DRG is completely taken out, the HA is removed, the PBS is washed once, the PBS is removed, a small amount of collagenase is added, the DRG is cut into pieces by ophthalmic scissors, the collagenase is added to a proper amount (1 ml is added to the DRG of each 3 rats), and the pieces are placed at 37 ℃ and 5% CO₂Keeping the temperature in the cell culture box for 90 min; transferring all the liquid in the vessel to a 5 ml EP tube, centrifuging at 1200 rpm multiplied by 5 min, discarding the supernatant, adding 0.25% Trypsin-EDTA (pancreatin) preheated at 37 ℃ in an amount equal to collagenase, blowing and beating 10-20 times by a 1ml pipette gun, and putting back the cell at 37 ℃ and 5% CO₂Standing the constant temperature cell culture box for 3min, taking out, continuously blowing and beating for 10-20 times, and completely digesting the DRG tissue block; adding pancreatin digestion stop solution (10% FBS in PBS) with volume 3 times of that of pancreatin, and blowing and uniformly mixing with a 1ml pipette; filtering all liquid through a 250-mesh screen, and collecting cell filtrate; centrifuging the collected cell filtrate at 1200 rpm multiplied by 5 min, discarding the supernatant, adding 10 ml of 15% BSA, uniformly blowing with a 1ml pipette gun, centrifuging at 900 rpm multiplied by 5 min, discarding the supernatant and floating and suspended substances, adding 7 ml of 15% BSA, uniformly blowing, centrifuging at 900 rpm multiplied by 5 min, discarding the supernatant and floating and suspended substances; adding a proper amount of the culture medium (NB +) for the dorsal root ganglion neuron (DRG) of the adult rat, uniformly blowing the uniformly purified cells, uniformly inoculating the uniformly blown cells into a PLL-coated pore plate, and finally putting the PLL-coated pore plate into a reactor with 37 ℃ and 5% CO₂Culturing in a constant-temperature cell culture box.

2-2, RSK inhibitor treatment

After 12 h in vitro culture of Normal (Normal) or Pre-injured (Pre-injured) DRG neuronal cells extracted as described above, their neurite outgrowth was measured by immunofluorescence of cells treated with different concentrations of SL0101 (10. mu.M, 100. mu.M) (RSK-specific inhibitor) and Rapamycin (50 nM, 100 nM) (mTOR protein-specific inhibitor) for 48 h.

2-3, cellular immunofluorescence

Discarding the cell culture medium, adding 0.5 ml1 × PBS gently to wash off the culture medium, and standing at room temperature for 5 min; discard 1 XPBS and add more than 4% of the pre-warmedFixing polyformaldehyde at room temperature for 15 min; discarding 4% paraformaldehyde, adding 0.5 ml of 1 × PBS to wash away paraformaldehyde, standing at room temperature for 5 min/time, and washing for 2 times; discarding 1 XPBS, adding 0.5 ml 0.3% PBST to rupture the membrane, and standing at room temperature for 10 min; discarding 0.3% PBST, adding immunohistochemical blocking solution, blocking at 200 μ l/well for 1 h at room temperature; discarding the blocking solution, diluting the immunohistochemical primary antibody diluent (Biyuntian) to obtain primary antibody, and adding primary antibody-TUJ 1 (R)&D, mab1195, 1: 500) incubating overnight at 4 ℃; taking out the pore plate from 4 ℃, and rewarming at room temperature for 0.5 h; removing primary antibody, adding 1 × PBS, standing at room temperature for 10 min/time, and washing for 3 times; abandoning 1 XPBS, avoiding light, diluting the secondary antibody with immunohistochemical secondary antibody diluent (Biyunyan day), adding secondary antibody Alexa Fluor^®594 donkey anti-mouseigG (Thermo fisher Scientific, A21203, 1: 1000), incubating for 2h at room temperature in the dark; discarding the secondary antibody, adding 1 XPBS, standing at room temperature for 10 min/time, and washing for 3 times; the round slides with cells were picked out in the dark, mounted on DAPI fluorescence-G (southern Biotech) and placed in a dry cassette, examined under a ZEISS positive fluorescence microscope and photographed. And observing the growth condition of the protrusions, photographing and counting the longest protrusion length of each group and the distribution of the protrusion length of each group.

The results are shown in figure 3 of the drawings,SL0101 can significantly inhibit the growth of normal or pre-injured DRG neuronal axons; after the Rapamycin treatment, the growth change of the DRG neuron axon is not obvious; it was shown that RSK can affect the growth of DRG neuronal axons in vitro.

Example 3 in vitro shRNA Virus interference RSK inhibits DRG neuronal axon growth

3-1, RSK shRNA Virus treatment of DRG primary cells

Extracting primary DRG neuron cell (same method as example 2), culturing in vitro for 12 h, discarding original culture medium, rinsing cell with preheated PBS, adding half volume of virus infection culture medium, and adding shRNA AAV2/8 virus (RSK 1-shRNA-1/2/3, RSK 2-shRNA-1/2/3) for RSK1 and RSK2 (synthesized by Wuhan Shu Mikoku, 2 × 10⁴v.g./cell). After 24h of virus treatment, the infection medium was discarded and replaced with fresh complete medium. After the virus is infected for 96 hours, subsequent experiments can be carried out when strong fluorescence of GFP expressed by cells is observed.

The viral shRNA sequences are as follows:

Rsk1-sh1: GCTGCTGGATAAGATCCTACG

Rsk1-sh2: GCAAGACTGTGGAATACTTGC

Rsk1-sh3: GGATCACCCAGAAAGACAAGC

Rsk2-sh1: GGCGGACCCGTGGCAGAAGAT

Rsk2-sh2: GCAGAAGATGGCTGTGGAGAG

Rsk2-sh3: GCTGTGGAGAGCCCTTCCGAC

3-2, DRG cell RNA extraction, reverse transcription and qRT-PCR

After the AAV virus is transfected by the DRG neurons cultured in vitro for 5d, abandoning the culture medium, washing the culture medium by PBS, adding 1ml of Trizol, extracting the DRG cell RNA according to TRIZOL Reagent (Invitrogen) instructions, carrying out reverse transcription by using a reverse transcription Kit (Takara RR 037A), carrying out qRT-PCR by using SYBR PrimeScript RT-PCR Kit (Takara), carrying out the operation according to the Kit instructions (taking GAPDH as an internal reference), and carrying out the reaction program of a PCR instrument: stage 1: 95 ℃ for 2min, Stage 2 (Cycle: 40): 95 ℃ for 15 s and 60 ℃ for 1 min; stage 3: 95 ℃ for 15 s, 60 ℃ for 1 min and 95 ℃ for 15 s.

The RSK qRT-PCR primer sequences are as follows:

RSK1-F：AAGCTGGACTTCAGCCATCC；

RSK1-R：GAACACGGTCACGCACTTTC；

RSK2-F：CTGCTCCTGCTTCGTCTC；

RSK2-R：CATAAACTGTCCATCCCTGTAA。

the results show that: RSK1-shRNA-2 (RSK 1-sh-2) and RSK1-shRNA-3 (RSK 1-sh-3) AAV viruses can significantly interfere with the mRNA level of RSK1 in DRG neuron cells, and RSK2-shRNA-1 (RSK 2-sh-1) and RSK2-shRNA-2 (RSK 2-sh-2) AAV viruses can significantly interfere with the mRNA level of RSK2 in DRG neuron cells (as shown in FIG. 4A).

3-3, cellular immunofluorescence

In vitro cultured DRG neurons were infected with AAV, cells were fixed 96h later, cell immunofluorescence was performed, cell bodies and axons were labeled with Tuj1 (same method as in example 2), growth of processes was observed, and longest process lengths and distribution of process lengths in each group were photographed and counted.

The results show that:shRNA virus interfered with RSK1 or RSK2 (shown in figure 4B) in DRG neuron cells in vitro, and the total axon length (shown in figure 4C) and the longest axon length (shown in figure 4D) of the DRG neuron cells were both reduced, and further verified the influence of RSK1 and RSK2 on the growth of the DRG neuron axons in vitro.

Example 4 in vivo interference with RSK inhibits DRG neuronal axon growth

A29G microinjection catheter was inserted into the rat at the L4 or L5 spinal position with the waist expanded parallel to the rat, passed through the conical plate, and reached the cauda equina inside the sheath, and 25. mu.l (with a virus concentration titer of 1X 10) was injected by UMP3-1 microinjection system (World Precision)¹²vg/ml) AAV2/8 type interfering virus against RSK and respective controls were injected slowly into the sheath, repeated every other day. Sciatic nerve clamp injury was performed 14 days after virus infection of rats (same procedure as in example 1), rats were sacrificed 17 days after virus infection (fig. 5A), DRG tissues and sciatic nerves on both left and right sides of L5 were removed L4, OCT embedded and cryomicrotome sections were taken, primary anti-SCG10 (Novus, NBP1-49461, 1: 400), secondary anti-Cy 3 sheath anti-rabbitigg (Sigma, AP510C, 1: 500), regenerated axons were labeled, and axon growth after sciatic nerve injury was examined.

As can be seen in FIG. 5B, the efficiency of intrathecal injection of AAV2/8-GFP virus was high for GFP-tagged DRG tissues. The results of axon SCG10 (red light) immunohistochemistry showed that in vivo interference with either RSK1 (RSK 1-sh-2 and RSK 1-sh-3) or RSK2 (RSK 2-sh-1 and RSK 2-sh-2) could significantly inhibit axon growth after sciatic nerve injury in rats (fig. 5C and 5D) and also decreased the longest axon length (fig. 5E). The white dotted line in fig. 5C is the sciatic nerve clamp injury, and white indicates the longest axon growth site.

While the foregoing is directed to the preferred embodiment of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Claims (10)

1. Application of ribosome S6 kinase RSK in preparing medicine for treating or repairing peripheral nerve injury.

2. The use of the ribosomal S6 kinase RSK in the preparation of a medicament for the treatment or repair of peripheral nerve injury according to claim 1, wherein the ribosomal S6 kinase RSK acts as a target for molecular intervention to inhibit DRG axonal growth by down-regulating or interfering with the ribosomal S6 kinase RSK.

3. The use of the ribosomal S6 kinase RSK in the preparation of a medicament for the treatment or repair of peripheral nerve injury according to claim 1, wherein the medicament for the repair of peripheral nerve injury comprises one of the interfering viruses of the in vitro RSK specific inhibitors SL0101 or RSK1 and RSK 2.

4. The use of the ribosomal S6 kinase RSK in the preparation of a medicament for the treatment or repair of peripheral nerve injury according to claim 3, wherein the medicament for the repair of peripheral nerve injury comprises the in vitro RSK specific inhibitor SL 0101.

5. The use of the ribosomal S6 kinase RSK in the preparation of a medicament for the treatment or repair of peripheral nerve injury according to claim 3, wherein the medicament for the repair of peripheral nerve injury comprises interfering viruses RSK1 and RSK 2.

6. Use of the ribosomal S6 kinase RSK in the preparation of a medicament for treating or repairing a peripheral nerve injury according to claim 1, wherein the peripheral nerve injury is a sciatic nerve injury.

7. A medicament for the treatment or repair of peripheral nerve damage comprising at least one of the interfering viruses of the in vitro RSK-specific inhibitors SL0101 or RSK1 and RSK 2.

8. The medicament for treating or repairing peripheral nerve injury according to claim 7, wherein the medicament further comprises a pharmaceutically acceptable carrier, excipient, diluent or mixture thereof.

9. The medicament for treating or repairing a peripheral nerve injury according to claim 7, wherein the peripheral nerve injury is a sciatic nerve injury.

10. The method for verifying the effect of the ribosome S6 kinase RSK on the repair of the peripheral nerve injury drug according to claim 1, which is characterized by comprising the following steps:

(1) in-situ hybridization and Western blot are utilized to find that the expression of RSK1 and RSK2 in DRG tissues is obviously increased after sciatic nerve injury of rats;

(2) the in vitro RSK specific inhibitors SL0101 or RSK1 and RSK2 interfering viruses are proved to be capable of remarkably inhibiting the growth of normal or pre-injured DRG neuron axons;

(3) the rat is proved to be injected with the interference virus aiming at RSK1 and RSK2 in the intrathecal way, and the growth of axons after sciatic nerve injury can be obviously inhibited.

Images