CN111206108A - PCR detection kit and detection method for listeria monocytogenes - Google Patents
PCR detection kit and detection method for listeria monocytogenes Download PDFInfo
- Publication number
- CN111206108A CN111206108A CN201911138231.8A CN201911138231A CN111206108A CN 111206108 A CN111206108 A CN 111206108A CN 201911138231 A CN201911138231 A CN 201911138231A CN 111206108 A CN111206108 A CN 111206108A
- Authority
- CN
- China
- Prior art keywords
- gene
- pcr
- listeria monocytogenes
- sample
- detection kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a PCR detection kit and a detection method for Listeria monocytogenes, wherein the detection kit comprises forward primers, reverse primers and probes of five genes, namely a gene ORF2819, a gene ORF2110, a gene 1mo0737, a gene 1mo1118 and a gene plcA. The invention uses the listeria monocytogenes fluorescence quantitative PCR typing detection kit to detect the serotype of the listeria monocytogenes, has the advantages of convenience, rapidness, accuracy, sensitivity, safety and the like compared with the traditional immune serum method, and can be applied to the rapid typing detection of the listeria monocytogenes, the early rapid diagnosis of the infection of the listeria monocytogenes and the timely guidance of clinical treatment.
Description
Technical Field
The invention relates to the technical field of biological detection, and more particularly relates to a PCR detection kit and a detection method for Listeria monocytogenes.
Background
Listeria Monocytogenes (LM), abbreviated as Listeria monocytogenes, is a human and animal comorbidity pathogenic bacterium of facultative intracellular parasitism, widely exists in nature, and meat products, marine products, milk products and the like can cause outbreak of Listeria diseases. The bacteria can cause gastroenteritis, septicemia, meningitis, abortion, etc. by penetrating intestinal barrier, blood brain barrier and placenta barrier. The main susceptible population of listeria monocytogenes comprises pregnant women, newborns, people with low immunity, the elderly and the like. Listeria monocytogenes was listed as food-borne pathogenic bacteria in the beginning of the 20 th century and the World Health Organization (WHO) in 2002, and Listeria monocytogenes was listed as the fourth most important food-borne pathogenic microorganism after Escherichia coli O157, Salmonella and Shigella. There are almost annual reports of listeria monocytogenes infections or outbreaks worldwide. Listeria monocytogenes are classified into 16 serotypes (1/2a, 1/2b, 1/2c, 3a, 3b, 3c, 4a, 4ab, 4b, 4c, 4d, 4e, 5, 6a, 6b, 7) depending on the specificity of the bacterial (O) antigen and the flagellum (H) antigen. 1/2a, 1/2b, 1/2c and 4b can infect human, wherein serotypes 4b and 1/2a are the main. The identification of different serotypes of listeria monocytogenes has important significance for establishing the correlation between strains and clinical manifestations, monitoring and tracing bacteria and effectively preventing the spread of listeriosis.
Currently, methods for identifying the serotype of listeria monocytogenes include a serum agglutination method, a pulse field electrophoresis, a flight mass spectrometry, a multiplex PCR method, and the like. These methods have some common disadvantages including time consuming, cumbersome operation, need for skilled professionals, etc., where pulsed field electrophoresis and flight mass spectrometry are also very demanding instruments. The real-time fluorescence quantitative PCR has wide application in the fields of basic scientific research, clinical diagnosis, disease research, drug research and the like, and has the characteristics of strong specificity, high sensitivity, good repeatability, high detection speed, high automation degree and the like. Therefore, the establishment of the fluorescent quantitative PCR-based typing detection method has important significance for the identification and monitoring of the Listeria monocytogenes serum.
Disclosure of Invention
In view of the above, the present invention provides a PCR detection kit for listeria monocytogenes, comprising:
forward primer for gene ORF 2819: ATGACCATAGCGTCCAATTGAG, respectively;
reverse primer for gene ORF 2819: GCATGAATTGCATGCTATAATC, respectively;
probe for gene ORF 2819: CTAGATCGATATCAGTACTTCGCAGTATCC, fluorescent label 5' 6-FAM;
forward primer for gene ORF 2110: CACGCACTAATCTGACTATAAACTC, respectively;
reverse primer for gene ORF 2110: TGCACACAGAGAGCAGATAG, respectively;
probe for gene ORF 2110: TTCATTTGTTCCCAACACCTCCGCGTTTC, fluorescent label 5' HEX;
forward primer for gene lmo 0737: GCATCCATCTTAGATCTCAGGAAGATC, respectively;
reverse primer for gene lmo 0737: GAGTAGTGTAGGTTGCACGC, respectively;
probe for gene lmo 0737: ACTTTCTCACCAACTCAACC, fluorescent label 5' 6-FAM;
forward primer for gene lmo 1118: CTTATACCTCGCCAGGATTTAATATTGACC, respectively;
reverse primer for gene lmo 1118: CAGATATCACCACGAAATTCAAAG, respectively;
probe for gene lmo 1118: CCTTATTGTGCCTCTTATCCTGAGACTCTC, fluorescent label 5' HEX;
forward primer for gene plcA: TCAAGTCCATATCAAGTCTTGGATTA, respectively;
reverse primer for gene plcA: TCGAAGCTAAGATTTCTCTTGACT, respectively;
probe for the gene plcA: TCCCTTTCACGGCAATATCAAGGTTC, fluorescent label 5' Cy 5.
The invention also provides the application of the PCR detection kit for listeria monocytogenes in detecting listeria monocytogenes,
the invention also provides a PCR detection method of Listeria monocytogenes, which uses the detection kit and comprises the following steps:
processing the sample to obtain genome DNA of the sample to be detected;
real-time fluorescence PCR detection, namely adding the genomic DNA of a sample to be detected, a positive control and/or a recessive control into a fluorescence quantitative PCR instrument provided with the detection kit respectively to carry out PCR reaction;
and (4) judging the result after the PCR reaction is finished.
Optionally, the sample is processed to obtain the genomic DNA of the sample to be detected, further,
taking a DNA extracting solution of a sample to be detected, and centrifuging at 2000rpm for 10s for later use;
adding 1mL of supernatant obtained after natural sedimentation of a sample into a 1.5mL sterile centrifuge tube, centrifuging at 12000rpm for 5min, then removing the supernatant, and keeping a precipitate;
adding 50 μ L of DNA extractive solution into each tube of precipitate, suspending the precipitate, and heating at 100 deg.C for 5 min;
centrifuging at 12000rpm for 2min, and taking the supernatant to obtain the genomic DNA of the sample with the thorns.
Optionally, the PCR reaction conditions include:
the first stage, 50-55 deg.C, 2-10 min;
the second stage, at 94-95 deg.C for 2-3 min;
the third stage, at 94-95 deg.C for 5-10S;
the fourth stage, at 55-60 deg.C, 40-80S;
set to 45 cycles.
Optionally, after the PCR reaction is finished, the result is judged, and further,
judging the result according to the amplification map, wherein the positive result is as follows: ct value of an amplification curve graph is less than or equal to 40, obvious exponential increase is realized, and negative result: the Ct value of the amplification curve is more than 40 or no Ct value, wherein the Ct value refers to the number of cycles that the fluorescence signal in each PCR reaction tube passes when reaching a set threshold value.
1/2a, 1/2b, 1/2c and 4b serotypes can infect human beings, wherein 1/2a and 4b serotypes are the main serotypes. The inventor researches and discovers that the 4 serotypes comprise specific marker genes, and different serotypes can be distinguished through the expression conditions of the genes. The invention relates to a gene multiplex PCR typing technology, which selects lmo0737, lmo1118, ORF2819 and ORF2110 as a plurality of marker genes and a Listeria specific gene plcA, and then designs specific primers and probes respectively. Through marking different fluorophores on specific probes of different genes, then carrying out system combination and optimization, finally completing fluorescent quantitative PCR detection in two PCR reaction tubes, and finally comprehensively judging the serotype of the listeria monocytogenes through the detected positive gene combination. System 1 contains the plcA, ORF2819 and ORF2110 genes, and system 2 contains the lmo0737 and lmo118 genes.
Compared with the prior art, the PCR detection kit and the detection method for listeria monocytogenes provided by the invention at least realize the following beneficial effects:
the method for detecting the serotype of the listeria monocytogenes by using the listeria monocytogenes fluorescence quantitative PCR typing detection kit has the advantages of convenience, rapidness, accuracy, sensitivity, safety and the like compared with the traditional culture method, and can be applied to the rapid typing detection of the listeria monocytogenes, the early rapid diagnosis of the infection of the listeria monocytogenes and the timely guidance of clinical treatment. In addition, the kit adopts a split charging technology, saves the step of preparing reaction solution compared with the common PCR kit, is more convenient to detect by using a large number of clinical samples, and is time-saving and convenient.
Of course, it is not necessary for any product in which the present invention is practiced to achieve all of the above-described technical effects simultaneously.
Other features of the present invention and advantages thereof will become apparent from the following detailed description of exemplary embodiments thereof, which proceeds with reference to the accompanying drawings.
Drawings
The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description, serve to explain the principles of the invention.
FIGS. 1 and 2 are the results of amplification positive profiles of System 1 and System 2, respectively;
FIGS. 3 and 4 are the amplification profile negative amplification results of System 1 and System 2, respectively;
FIGS. 5 to 12 are PCR amplification maps according to examples of the present invention.
Detailed Description
Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that: the relative arrangement of the components and steps, the numerical expressions and numerical values set forth in these embodiments do not limit the scope of the present invention unless specifically stated otherwise.
The following description of at least one exemplary embodiment is merely illustrative in nature and is in no way intended to limit the invention, its application, or uses.
Techniques, methods, and apparatus known to those of ordinary skill in the relevant art may not be discussed in detail but are intended to be part of the specification where appropriate.
In all examples shown and discussed herein, any particular value should be construed as merely illustrative, and not limiting. Thus, other examples of the exemplary embodiments may have different values.
It should be noted that: like reference numbers and letters refer to like items in the following figures, and thus, once an item is defined in one figure, further discussion thereof is not required in subsequent figures.
The PCR detection kit for listeria monocytogenes provided by the invention comprises:
forward primer for gene ORF 2819: ATGACCATAGCGTCCAATTGAG, respectively;
reverse primer for gene ORF 2819: GCATGAATTGCATGCTATAATC, respectively;
probe for gene ORF 2819: CTAGATCGATATCAGTACTTCGCAGTATCC, fluorescent label 5' 6-FAM;
forward primer for gene ORF 2110: CACGCACTAATCTGACTATAAACTC, respectively;
reverse primer for gene ORF 2110: TGCACACAGAGAGCAGATAG, respectively;
probe for gene ORF 2110: TTCATTTGTTCCCAACACCTCCGCGTTTC, fluorescent label 5' HEX;
forward primer for gene lmo 0737: GCATCCATCTTAGATCTCAGGAAGATC, respectively;
reverse primer for gene lmo 0737: GAGTAGTGTAGGTTGCACGC, respectively;
probe for gene lmo 0737: ACTTTCTCACCAACTCAACC, fluorescent label 5' 6-FAM;
forward primer for gene lmo 1118: CTTATACCTCGCCAGGATTTAATATTGACC, respectively;
reverse primer for gene lmo 1118: CAGATATCACCACGAAATTCAAAG, respectively;
probe for gene lmo 1118: CCTTATTGTGCCTCTTATCCTGAGACTCTC, fluorescent label 5' HEX;
forward primer for gene plcA: TCAAGTCCATATCAAGTCTTGGATTA, respectively;
reverse primer for gene plcA: TCGAAGCTAAGATTTCTCTTGACT, respectively;
probe for the gene plcA: TCCCTTTCACGGCAATATCAAGGTTC, fluorescent label 5' Cy 5.
When the detection kit is used for PCR detection, the method comprises the following steps:
(1) specimen processing
a. The DNA extract from the reagent preparation area was centrifuged at 2000rpm for 10 seconds.
b. And adding 1mL of supernatant obtained after the sample naturally settles into a 1.5mL sterile centrifuge tube, centrifuging at 12000rpm for 5min, then removing the supernatant, and keeping the precipitate.
c. Adding 50 μ L of DNA extractive solution into each tube of precipitate, suspending the precipitate, and heating at 100 deg.C for 5 min.
d.12000rpm centrifugation for 2min, and taking the supernatant for PCR detection.
(2) Real-time fluorescent PCR detection
Fluorescent quantitative PCR instrument: ABI series, Bio-Rad series (ICycler/MJ Opticon 2), Stratagene MX series, Cepheid SmartCycler, Corbett rotator-Gene, Hangzhou Bori series.
And (3) PCR reaction conditions: 50-55 ℃: 2-10 min;
94-95℃:2-3min;
94-95℃:5-10S;
55-60℃:40-80S;
(45 cycles)
(3) Result judgment
FIG. 1, FIG. 2, FIG. 3 and FIG. 4 show the results of the amplification map determination. Positive results: the Ct value of the amplification curve graph is less than or equal to 40, and the amplification curve graph has obvious exponential growth. Negative results: the Ct value of the amplification curve graph is more than 40 or no Ct value. The Ct value refers to the number of cycles that the fluorescence signal in each PCR reaction tube has undergone to reach a set threshold value.
TABLE 1 channel judgment
(4) Control of experiments
Negative control and positive control must be set for each test, and the result is satisfactory, otherwise the test is regarded as invalid.
The invention provides a single-proliferation Listeria fluorescent quantitative PCR typing detection method and a detection kit, wherein the key reagent kit components are sequences and dosage of primer probes in PCR reaction liquid shown in a table 2, and a multiple fluorescent PCR method is used for realizing the rapid detection and typing of the single-proliferation Listeria.
TABLE 2 primer Probe sequence Listing in PCR reaction solution
4 samples to be detected are taken and respectively subjected to a contrast detection test by a culture method and the single-gained rices fluorescence quantitative PCR typing detection method and the detection kit disclosed by the invention
The culture method comprises the following steps: simultaneously provides one strain of each of the listeria monocytogenes which are determined to be 1/2a, 1/2b, 1/2c and 4b subtypes after being cultured.
And (3) detection results:
sample (serotype) | Culture method | Reagent kit |
I(1/2a,3a) | √ | √ |
II(1/2c,3c) | √ | √ |
III(1/2b,3b) | √ | √ |
IV(4b,4d,4e) | √ | √ |
IV(atypical 4b) | √ | √ |
From the above results, the detection results of the single-increment plum fluorescent quantitative PCR typing detection method and the detection kit are consistent with the results of the culture method, the detection of the kit only needs about 2 hours, and the culture method needs more than 15 days.
The PCR amplification maps are shown in FIGS. 5 to 12:
(1)1/2 subtype a: the plcA gene and the lmo0737 gene were positive, and referring to fig. 5 and 6, fig. 5 is a PCR amplification map of system 1, and fig. 6 is a PCR amplification map of system 2.
(2)1/2b subtype: the plcA gene and 2819 gene are positive, and referring to FIGS. 7 and 8, FIG. 7 is a PCR amplification map of System 1, and FIG. 8 is a PCR amplification map of System 2.
(3)1/2c subtype: the plcA gene, lmo0737 and lmo1118 genes were positive, and reference is made to fig. 9 and 10, where fig. 9 is a PCR amplification map of system 1 and fig. 10 is a PCR amplification map of system 2.
(4) Subtype 4 b: the plcA gene, 2119 and 2110 gene are positive, and referring to FIGS. 11 and 12, FIG. 11 is a PCR amplification map of System 1, and FIG. 12 is a PCR amplification map of System 2.
The embodiment shows that the PCR detection kit and the detection method for listeria monocytogenes provided by the invention at least realize the following beneficial effects:
the method for detecting the serotype of the listeria monocytogenes by using the listeria monocytogenes fluorescence quantitative PCR typing detection kit has the advantages of convenience, rapidness, accuracy, sensitivity, safety and the like compared with the traditional culture method, and can be applied to the rapid typing detection of the listeria monocytogenes, the early rapid diagnosis of the infection of the listeria monocytogenes and the timely guidance of clinical treatment. In addition, the kit adopts a split charging technology, saves the step of preparing reaction solution compared with the common PCR kit, is more convenient to detect by using a large number of clinical samples, and is time-saving and convenient.
Although some specific embodiments of the present invention have been described in detail by way of examples, it should be understood by those skilled in the art that the above examples are for illustrative purposes only and are not intended to limit the scope of the present invention. It will be appreciated by those skilled in the art that modifications may be made to the above embodiments without departing from the scope and spirit of the invention. The scope of the invention is defined by the appended claims.
Claims (6)
1. A PCR detection kit for Listeria monocytogenes, which is characterized in that the detection kit comprises:
forward primer for gene ORF 2819: ATGACCATAGCGTCCAATTGAG, respectively;
reverse primer for gene ORF 2819: GCATGAATTGCATGCTATAATC, respectively;
probe for gene ORF 2819: CTAGATCGATATCAGTACTTCGCAGTATCC, fluorescent label 5' 6-FAM;
forward primer for gene ORF 2110: CACGCACTAATCTGACTATAAACTC, respectively;
reverse primer for gene ORF 2110: TGCACACAGAGAGCAGATAG, respectively;
probe for gene ORF 2110: TTCATTTGTTCCCAACACCTCCGCGTTTC, fluorescent label 5' HEX;
forward primer for gene lmo 0737: GCATCCATCTTAGATCTCAGGAAGATC, respectively;
reverse primer for gene lmo 0737: GAGTAGTGTAGGTTGCACGC, respectively;
probe for gene lmo 0737: ACTTTCTCACCAACTCAACC, fluorescent label 5' 6-FAM;
forward primer for gene lmo 1118:
CTTATACCTCGCCAGGATTTAATATTGACC;
reverse primer for gene lmo 1118: CAGATATCACCACGAAATTCAAAG, respectively;
probe for gene lmo 1118: CCTTATTGTGCCTCTTATCCTGAGACTCTC, fluorescent label 5' HEX;
forward primer for gene plcA: TCAAGTCCATATCAAGTCTTGGATTA, respectively;
reverse primer for gene plcA: TCGAAGCTAAGATTTCTCTTGACT, respectively;
probe for the gene plcA: TCCCTTTCACGGCAATATCAAGGTTC, fluorescent label 5' Cy 5.
2. The use of the listeria monocytogenes PCR detection kit of claim 1 for detecting listeria monocytogenes.
3. A method for detecting Listeria monocytogenes by PCR, which comprises the steps of using the detection kit of claim 1:
processing the sample to obtain genome DNA of the sample to be detected;
real-time fluorescence PCR detection, namely adding the genomic DNA of a sample to be detected, a positive control and/or a recessive control into a fluorescence quantitative PCR instrument provided with the detection kit respectively to carry out PCR reaction;
and (4) judging the result after the PCR reaction is finished.
4. The method of claim 3, wherein said sample is processed to obtain genomic DNA of a sample to be tested, and further,
taking a DNA extracting solution of a sample to be detected, and centrifuging at 2000rpm for 10s for later use;
adding 1mL of supernatant obtained after natural sedimentation of a sample into a 1.5mL sterile centrifuge tube, centrifuging at 12000rpm for 5min, then removing the supernatant, and keeping a precipitate;
adding 50 μ L of DNA extractive solution into each tube of precipitate, suspending the precipitate, and heating at 100 deg.C for 5 min;
centrifuging at 12000rpm for 2min, and taking the supernatant to obtain the genomic DNA of the sample with the thorns.
5. The method of claim 3, wherein said PCR conditions comprise:
the first stage, 50-55 deg.C, 2-10 min;
the second stage, at 94-95 deg.C for 2-3 min;
the third stage, at 94-95 deg.C for 5-10S;
the fourth stage, at 55-60 deg.C, 40-80S;
set to 45 cycles.
6. The method of claim 3, wherein the determination of the result is performed after the PCR reaction is completed, and further,
judging the result according to the amplification map, wherein the positive result is as follows: ct value of an amplification curve graph is less than or equal to 40, obvious exponential increase is realized, and negative result: the Ct value of the amplification curve is more than 40 or no Ct value, wherein the Ct value refers to the number of cycles that the fluorescence signal in each PCR reaction tube passes when reaching a set threshold value.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911138231.8A CN111206108A (en) | 2019-11-20 | 2019-11-20 | PCR detection kit and detection method for listeria monocytogenes |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN201911138231.8A CN111206108A (en) | 2019-11-20 | 2019-11-20 | PCR detection kit and detection method for listeria monocytogenes |
Publications (1)
Publication Number | Publication Date |
---|---|
CN111206108A true CN111206108A (en) | 2020-05-29 |
Family
ID=70786405
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN201911138231.8A Pending CN111206108A (en) | 2019-11-20 | 2019-11-20 | PCR detection kit and detection method for listeria monocytogenes |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN111206108A (en) |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040267002A1 (en) * | 2003-02-03 | 2004-12-30 | Lawrence Mark L. | Use of novel virulence-specific genes as targets for diagnosis and potential control of virulent strains of listeria monocytogenes |
CN102010913A (en) * | 2010-12-03 | 2011-04-13 | 浙江省疾病预防控制中心 | Real-time fluorescence polymerase chain reaction (PCR) detection kit for screening listeria monocytogenes and detection method thereof |
-
2019
- 2019-11-20 CN CN201911138231.8A patent/CN111206108A/en active Pending
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20040267002A1 (en) * | 2003-02-03 | 2004-12-30 | Lawrence Mark L. | Use of novel virulence-specific genes as targets for diagnosis and potential control of virulent strains of listeria monocytogenes |
CN102010913A (en) * | 2010-12-03 | 2011-04-13 | 浙江省疾病预防控制中心 | Real-time fluorescence polymerase chain reaction (PCR) detection kit for screening listeria monocytogenes and detection method thereof |
Non-Patent Citations (3)
Title |
---|
卢国钧等: "荧光定量PCR在实验室室间质控中的应用", 《铁路节能环保与安全卫生》, vol. 4, no. 06, 28 December 2014 (2014-12-28), pages 294 - 296 * |
王丽丽等: "北京市人源性单核细胞增生李斯特菌耐药特征及分子分型研究", 《中国食品卫生杂志》, vol. 28, no. 04, 30 July 2016 (2016-07-30), pages 426 - 430 * |
韩斌等: "单核细胞增生李斯特菌分子检测标记的数据挖掘", 《食品科学》, vol. 30, no. 04, 15 February 2009 (2009-02-15), pages 197 - 200 * |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN107022644A (en) | Six kinds of multiple LAMP detection primers of food-borne pathogens, detection kit and detection method in fruits and vegetables | |
CN106367492A (en) | Method for rapidly detecting listeria monocytogenes at constant temperature, primer and applications of primer | |
CN108588250B (en) | LAMP primer for detecting watermelon bacterial fruit blotch and detection method thereof | |
Almeida et al. | A PCR protocol using inl gene as a target for specific detection of Listeria monocytogenes | |
CN102605055A (en) | Multiplex quantitative PCR (polymerase chain reaction) detection kit for vibrio parahaemolyticus and detection method | |
CN106987626B (en) | Primer and probe for rapidly detecting various fungi and identifying strains and application thereof | |
Bai et al. | Development of a loop-mediated isothermal amplification assay for sensitive and rapid detection of Mycoplasma bovis | |
CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
CN105256048B (en) | Multiple PCR detection primer group and probe group for oral pathogenic bacteria and application thereof | |
CN101575640B (en) | Primer group for bovine tuberculosis mycobacterium detection, rapid detection method and detection kit | |
CN108220474A (en) | A kind of LAMP detection primer of Fusarium graminearum and its application | |
CN108676910A (en) | A kind of LAMP detection primer of fusarium prolifertum and its application | |
CN104263838B (en) | Listeria monocytogenes LAMP-LFD detection kit and detection method thereof | |
CN104450940A (en) | Nucleotide sequence for detecting listeria monocytogenes and detection method and detection kit | |
Zhang et al. | Development of a multiplex PCR for simultaneous detection of Pasteurella multocida, Mannheimia haemolytica and Trueperella pyogenes | |
Alamian et al. | A novel PCR assay for detecting Brucella abortus and Brucella melitensis | |
Gumaa et al. | Specific detection and differentiation between Brucella melitensis and Brucella abortus by a duplex recombinase polymerase amplification assay | |
Özbaş et al. | Development of a multiplex and semi-nested PCR assay for detection of Yersinia enterocolitica and Aeromonas hydrophila in raw milk | |
CN109811073B (en) | Primer for rapidly detecting streptococcus agalactiae and streptococcus iniae at early stage by double PCR (polymerase chain reaction) and application of primer | |
CN110468223B (en) | Primer, probe, kit and method for detecting nucleic acid of mycoplasma pneumoniae and bauxiella based on dUTP/UNG method | |
Okamura et al. | Rapid, sensitive, and specific detection of the O4 group of Salmonella enterica by loop-mediated isothermal amplification | |
CN110656192B (en) | Loop-mediated isothermal amplification primer group for detecting neisseria meningitidis and detection method | |
CN103882140A (en) | Rapid diagnosis kit for mycobacterium tuberculosis | |
CN111206108A (en) | PCR detection kit and detection method for listeria monocytogenes | |
CN109750114A (en) | The constant-temperature amplification detection method and its primer special and kit of the sour klebsiella spp of production |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination |