CN111189900B - Novel electrochemical detection method for coronavirus 2019-nCoV - Google Patents

Novel electrochemical detection method for coronavirus 2019-nCoV Download PDF

Info

Publication number
CN111189900B
CN111189900B CN202010108629.3A CN202010108629A CN111189900B CN 111189900 B CN111189900 B CN 111189900B CN 202010108629 A CN202010108629 A CN 202010108629A CN 111189900 B CN111189900 B CN 111189900B
Authority
CN
China
Prior art keywords
probe
concentration
ncov
rgo
buffer solution
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010108629.3A
Other languages
Chinese (zh)
Other versions
CN111189900A (en
Inventor
李灿鹏
赵卉
张亚平
刘凤
谢伟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yunnan University YNU
Original Assignee
Yunnan University YNU
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yunnan University YNU filed Critical Yunnan University YNU
Priority to CN202010108629.3A priority Critical patent/CN111189900B/en
Publication of CN111189900A publication Critical patent/CN111189900A/en
Application granted granted Critical
Publication of CN111189900B publication Critical patent/CN111189900B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3278—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction involving nanosized elements, e.g. nanogaps or nanoparticles
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/28—Electrolytic cell components
    • G01N27/30—Electrodes, e.g. test electrodes; Half-cells
    • G01N27/327—Biochemical electrodes, e.g. electrical or mechanical details for in vitro measurements
    • G01N27/3275—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction
    • G01N27/3277—Sensing specific biomolecules, e.g. nucleic acid strands, based on an electrode surface reaction being a redox reaction, e.g. detection by cyclic voltammetry
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N27/00—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means
    • G01N27/26—Investigating or analysing materials by the use of electric, electrochemical, or magnetic means by investigating electrochemical variables; by using electrolysis or electrophoresis
    • G01N27/416—Systems
    • G01N27/48—Systems using polarography, i.e. measuring changes in current under a slowly-varying voltage
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Physics & Mathematics (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Electrochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Spectroscopy & Molecular Physics (AREA)
  • Engineering & Computer Science (AREA)
  • Nanotechnology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to an electrochemical detection method of a novel coronavirus 2019-nCoV, which comprises the steps of designing three probes for targeting two structural domains in an RNA sequence of the novel coronavirus 2019-nCoV, preparing three substances and constructing an electrochemical sensor. The electrochemical detection method for the novel coronavirus 2019-nCoV has the remarkable advantages of simplicity in operation, rapidness/accuracy in detection and low cost.

Description

Novel electrochemical detection method for coronavirus 2019-nCoV
Technical Field
The invention belongs to the technical field of biotechnology, and particularly belongs to the technical field of electrochemical detection of novel coronavirus (2019-nCoV).
Background
The novel coronavirus (2019-nCoV) is a novel coronavirus which is not found in human before, can be transmitted in the modes of spray, aerosol, contact and the like, can cause various symptoms from common cold to severe pneumonia, and has high infectivity and harmfulness. At present, the conventional detection method of 2019-nCoV is basically a fluorescence PCR method, but the method has the problems of expensive equipment, time consumption, high maintenance cost, low detection sensitivity and the like. The electrochemical method has the advantages of high efficiency, rapidness, sensitivity, low price and the like, but no report is found in the current research on electrochemical detection of 2019-nCoV.
Disclosure of Invention
The invention aims to provide a method for detecting 2019-nCoV, which is convenient and fast, has high detection sensitivity and can be carried out without expensive instruments. The invention is used for detecting RNA of a novel human coronavirus (2019-nCoV) based on a probe recognition technology. The electrochemical detection method for the novel coronavirus 2019-nCoV has the remarkable advantages of simplicity in operation, rapidness/accuracy in detection and low cost.
The invention is realized by adopting the following technical scheme.
An electrochemical detection method of a novel coronavirus 2019-nCoV comprises the following steps:
(1) ferroferric oxide (Fe)3O4) Preparation of nano-microspheres
Adding ferric chloride hydrate to ethylene glycolAdding sodium acetate and polyethylene glycol, stirring for 30-60 min, heating in a hydrothermal reaction kettle, cooling to room temperature to obtain black precipitate, washing the precipitate with absolute ethanol, and drying to obtain Fe3O4Nano-microspheres;
wherein the mass volume concentration of the ferric trichloride in the ethylene glycol is 0.2-0.5%, the hydrothermal reaction is carried out for 5-10 hours at 120-220 ℃, the drying is carried out for 6-10 hours at 60-100 ℃, the mass ratio of the sodium acetate to the ferric trichloride is 3-6: 1, and the mass ratio of the polyethylene glycol to the ferric trichloride is 1: 2-3: 1;
(2) gold nanoparticle-loaded Fe3O4Nanocomposite (Au @ Fe)3O4) Preparation of
The step (1) is Fe3O4Dispersing the nano-microspheres in ultrapure water, ultrasonically dispersing uniformly, sequentially adding polyethylene glycol 400, trisodium citrate, chloroauric acid and ascorbic acid, stirring, separating by using a magnet to obtain black precipitate, and washing by using absolute ethyl alcohol to obtain Au @ Fe3O4A complex;
the concentrations of the polyethylene glycol 400, the trisodium citrate, the chloroauric acid and the ascorbic acid in the ultrapure water are respectively 0.10-0.25 mg/mL, 1-5 mg/mL, 2-6 mg/mL and 1-6 mg/mL;
(3) preparation of gold nanoparticles/sulfonated calix [8] arene/reduced graphene oxide/electric signal substance complex (Au @ RGO-SCX8@ MB)
Adding 4-sulfonic acid cup [8]]Dispersing aromatic hydrocarbon hydrate (SCX8) and graphene oxide (RGO) into deionized water, adjusting the pH value to 7.0-12.0 after ultrasonic treatment, centrifuging after reflux reaction, removing supernatant, and washing the solid with deionized water for 3-4 times to obtain a reduced graphene oxide-SCX 8 compound (RGO-SCX 8); dispersing RGO-SCX8 compound in deionized water, ultrasonic dispersing uniformly, and adding HAuCl4Stirring, centrifugally separating, removing supernatant, washing the solid with deionized water, and obtaining an Au @ RGO-SCX8 compound; the Au @ RGO-SCX8 complex is ultrasonically dispersed in deionized water, then an electric signal substance is added, stirring and centrifugal separation are carried out to obtain a precipitate, the precipitate is washed by the deionized water, and finally Au @ RGO-SCX 8-electric signal substance complex;
the mass concentration of the SCX8 and the mass concentration of the graphite oxide in the deionized water are both 0.1-0.5%; HAuCl4The mass concentration of the RGO-SCX8 complex (RGO-SCX8) dispersion liquid is 1-5%;
the electric signal substance is an electric active substance which can be identified by SCX8 or other macrocyclic supermolecules, and 0.2-1 mg of the electric signal substance is added into each 1mL of Au @ RGO-SCX8 compound dispersion liquid; the electro-signaling substance may be toluidine blue, methylene blue or ferrocene.
(4) Probe sequence Synthesis
The RNA reference sequence (GenBank No. MN908947.3) of the 2019-nCoV virus was downloaded from the NCBI database (https:// www.ncbi.nlm.nih.gov /), two targets were screened for the two domains ORF1ab and N, respectively, and the specificity of these two targets was examined by the UCSC database (www.genome.ucsc.edu).
Detection of each target requires three probe Capture Probes (CP), a label signal probe (LP), and an Accessory Probe (AP).
The 3' ends of the capture probe CP and the signal probe LP are modified by sulfydryl, so that the two probes can be respectively connected to Au @ Fe through coordination and combination3O4Complex and Au @ RGO-SCX8 complex.
Target 1: ORF1ab
CP：ACCTTTCCACATACCGCAGACG-(CH2)6-SH
LP：TCGAGTTACGCTAAGCGCGGAGTTGATCACAACTA-(CH2)6-SH
AP：CTTAGCGTAACTCGA-TAGTTGTGATCAACTCCGCG
Target 2: n is a radical of
CP：CAATCTGTCAAGCAGCAGCA-(CH2)6-SH
LP：TCGAGTTACGCTAAG AGACATTTTGCTCTCAAGCT-(CH2)6-SH
AP：CTTAGCGTAACTCGA AGCTTGAGAGCAAAATGTCT
(5) Construction of electrochemical sensors
Mixing Au @ Fe3O4The complex was ultrasonically dispersed in buffer I, Au @ Fe3O4The concentration of the compound in the buffer solution I is 0.5-3 mg/mL, a capture probe is added, the concentration of the capture probe in the buffer solution I is 0.5-10 mu mol/L, the buffer solution I is placed for 5-20 hours at 4 ℃, and a magnet is separated; then adding the solid into a buffer solution I and hexanethiol, wherein the concentration of the solid in the buffer solution I is 0.5-3 mg/mL, the concentration of the hexanethiol in the buffer solution I is 1-5 mmol/L, the hexanethiol is used for sealing nonspecific sites, standing at room temperature for 10-40 min, separating with a magnet, adding a buffer solution II into the separated solid, and keeping the concentration range of the buffer solution II to 10-18～10- 9The concentration of the separated solid in the buffer solution II is 0.5-5 mg/mL for the target RNA in mol/L; placing for 1-2 hours at room temperature, then separating by a magnet, sequentially adding a signal probe, an auxiliary probe and Au @ RGO-SCX 8-electric signal substance compound dispersion liquid into the separated solid, placing for 1-2 hours at room temperature, then separating by the magnet, dispersing the solid in a phosphate buffer solution, taking the dispersion liquid to be dropped on the surface of a screen printing electrode, determining the relation between the concentration and the peak current of target RNA by using a differential pulse voltammetry method, a cyclic voltammetry method or an alternating current voltammetry method on an electrochemical workstation, and obtaining a standard curve of current intensity and RNA concentration, thereby completing the construction of the electrochemical sensor;
wherein the initial concentration of the signal probe and the auxiliary probe is 10-20 mu mol/L, and 100-150 mu L of the signal probe and the auxiliary probe are respectively added into each 1mg of separated solid; the concentration of the Au @ RGO-SCX 8-electric signal substance complex dispersion (deionized water dispersion) is 1-5 mg/mL, 1-1.5 mL of the Au @ RGO-SCX 8-electric signal substance complex dispersion is added to 1mg of the separated solid, and the probe is diluted with ultrapure water.
The concentration of the added solid is 2-10 mu L per 0.1mg of the solid and is in the range of 10-18～10-9mol/L of target RNA.
The buffer solution I contains 10mmol/L Tris-HCl, 1mmol/L EDTA, 300mmol/L NaCl and 1mmol/L MgCl2The solution of (1);
the buffer II is a solution containing 10mmol/L Tris-HCl, 1mmol/LEDTA, 300mmol/L NaCl and 1 mmol/LTCEP.
The phosphate buffer pH was 7.2.
And (5) calculating the concentration of the RNA in the 2019-nCoV in the sample to be detected according to the standard curve obtained in the step (5), and evaluating whether the 2019-nCoV exists in the sample to be detected according to the result so as to judge whether the sample is infected by the virus.
The technology can be used in the fields of sample rapid, bedside instant diagnosis, minimally invasive detection and the like.
(6) Determination of target RNA (2019-nCoV-specific RNA fragment)
The 2019-nCoV specific RNA fragment was determined by using the constructed electrochemical sensor, and as shown in FIG. 1, for two target RNAs (ORF1ab and N), the electrochemical signal was lower when there was no target RNA, and the current was significantly increased when there was a target RNA fragment, thereby demonstrating the feasibility of the sensor. The signal can be used to determine the presence or further quantification of the target RNA.
Besides the technical scheme, the invention can also be macrocyclic supermolecules which can form host-guest inclusion compound with signal molecules, such as calix [6] arene, cyclodextrin, pillared arene and the like besides the 4-sulfonic acid calix [8] arene hydrate SCX8 in the third step.
The technical key points and the principle of the invention are briefly described as follows:
1. the key technical point of the method is that the amplification of electrochemical signals is realized through the enrichment and catalysis of graphene, gold nanoparticles and macrocyclic supermolecules on signal molecules. The supermolecule is relatively stable, and a foundation is laid for realizing the industrial application of the supermolecule;
2. the used electric signal enrichment material is SCX8 or other macrocyclic supermolecules with stronger identification capability such as p-toluidine blue and the like, so that the electric signal amplification effect is better; meanwhile, the SCX8 has better chemical stability, which is beneficial to the stability and the industrialized development of products;
4. the target RNA detected by the electrochemical sensor is identified by a single-stranded DNA capture probe of a base candidate, and has stronger specificity;
5. in the invention, the electrochemical sensor has Fe3O4Catalytic effect of (1), enrichment effect of SCX8 and goldThe conductive effect of the rice grains can effectively amplify signals, so that the detection limit is low;
6. the method has the advantages of simplicity, controllability, low detection limit, easy signal acquisition and the like, can quickly detect the concentration of the sample to be detected, and has high sensitivity;
7. the electrochemical sensor of the present invention can measure the actual concentration of RNA, i.e., can quantify it absolutely. Compared with the prior art, the invention has the following characteristics:
1. the invention does not need the processes of PCR amplification of nucleic acid and the like, and can effectively save the time of sample pretreatment;
2. the invention does not need complicated operation process of marking and fixing DNA probe molecules, and mainly utilizes the coordination of the sulfydryl modified at the tail end of the capture probe molecule and the gold nano particles on the surface of the nano material to form a stable probe;
3. the electric signal enrichment material used in the electrochemical sensor is SCX8 or other large-ring supermolecules with strong recognition capability such as p-toluidine blue and the like, so that the electric signal amplification effect is good; meanwhile, macrocyclic supermolecules such as SCX8 and the like have better chemical stability, and are beneficial to the stability and industrial development of products;
4. the target RNA detected by the electrochemical sensor is identified by a single-stranded DNA capture probe of a base candidate, and has stronger specificity;
5. in the invention, the electrochemical sensor has Fe3O4The catalytic effect, the enrichment effect of SCX8 and the conductive effect of the gold nanoparticles can effectively amplify signals, so that the sensor has a lower detection limit;
6. the method has the advantages of simplicity, controllability, low detection limit, easy signal acquisition and the like, can quickly detect the concentration of the sample to be detected, and has high sensitivity;
7. the electrochemical sensor of the invention can measure the actual concentration of RNA, namely can be absolutely quantitative;
8. the electrochemical sensor can directly detect the RNA sample without reverse transcription of the RNA sample to be detected into cDNA detection.
The invention is further explained below with reference to the drawings and the detailed description.
Drawings
FIG. 1 is a graph showing the response of the electrochemical sensor of the present invention to a target nucleic acid (2019-nCoV-specific RNA fragment ORF1ab domain).
FIG. 2 is a graph showing the response of the electrochemical sensor of the present invention to a target nucleic acid (2019-nCoV-specific RNA fragment N domain).
Detailed Description
An electrochemical detection method of a novel coronavirus 2019-nCoV comprises the following steps:
(1) ferroferric oxide (Fe)3O4) Preparation of nano-microspheres
Adding ferric trichloride hydrate into ethylene glycol to form a clear solution, adding sodium acetate and polyethylene glycol, stirring for 50 minutes, putting into a hydrothermal reaction kettle, heating for reaction, cooling to room temperature to obtain black precipitate, washing the precipitate with absolute ethyl alcohol, and drying to obtain Fe3O4Nano-microspheres;
wherein the mass volume concentration of the ferric trichloride in the ethylene glycol is 0.3 percent, the hydrothermal reaction is carried out for 8 hours at 180 ℃, the drying is carried out for 6 hours at 70 ℃, the mass ratio of the sodium acetate to the ferric trichloride is 4:1, and the mass ratio of the polyethylene glycol to the ferric trichloride is 1: 1;
(2) gold nanoparticle-loaded Fe3O4Nanocomposite (Au @ Fe)3O4) Preparation of
The step (1) is Fe3O4Dispersing the nano-microspheres in ultrapure water, ultrasonically dispersing uniformly, sequentially adding polyethylene glycol 400, trisodium citrate, chloroauric acid and ascorbic acid, stirring, separating by using a magnet to obtain black precipitate, and washing by using absolute ethyl alcohol to obtain Au @ Fe3O4A complex;
the concentrations of the polyethylene glycol 400, the trisodium citrate, the chloroauric acid and the ascorbic acid in the ultrapure water are respectively 0.15mg/mL, 2mg/mL, 3mg/mL and 5 mg/mL;
(3) preparation of gold nanoparticles/sulfonated calix [8] arene/reduced graphene oxide/electric signal substance complex (Au @ RGO-SCX8@ MB)
Adding 4-sulfonic acid cup [8]]Dispersing aromatic hydrocarbon hydrate (SCX8) and graphene oxide (RGO) into deionized water, adjusting the pH value to 7.4 after ultrasonic treatment, performing reflux reaction, centrifuging, discarding supernatant, and washing the solid with deionized water for 4 times to obtain a reduced graphene oxide-SCX 8 compound (RGO-SCX 8); dispersing RGO-SCX8 compound in deionized water, ultrasonic dispersing uniformly, and adding HAuCl4Stirring, centrifugally separating, removing supernatant, washing the solid with deionized water, and obtaining an Au @ RGO-SCX8 compound; the Au @ RGO-SCX8 compound is ultrasonically dispersed in deionized water, then an electric signal substance is added, stirring and centrifugal separation are carried out to obtain a precipitate, the precipitate is washed by the deionized water, and finally the Au @ RGO-SCX 8-electric signal substance compound is obtained.
(4) Construction of electrochemical sensors
Mixing Au @ Fe3O4The complex was ultrasonically dispersed in buffer I, Au @ Fe3O4The concentration of the complex in the buffer solution I is 1mg/mL, a capture probe is added, the concentration of the capture probe in the buffer solution I is 2 mu mol/L, the buffer solution I is placed for 12 hours at the temperature of 4 ℃, and the magnetic separation is carried out; adding the solid into buffer I and hexanethiol, wherein the concentration of the solid in the buffer I is 1mg/mL, the concentration of the hexanethiol in the buffer I is 2mmol/L, the hexanethiol is used for blocking nonspecific sites, standing at room temperature for 20min, separating with a magnet, adding buffer II into the separated solid, and the concentration of the buffer II is within 10-18～10-9The concentration of the separated solid in the buffer solution II is 2 mg/mL; placing the mixture for 1 hour at room temperature, then separating the magnet, sequentially adding a signal probe, an auxiliary probe and Au @ RGO-SCX 8-electric signal substance compound dispersion liquid into the separated solid, placing the mixture for 2 hours at room temperature, then separating the magnet, dispersing the solid into a phosphate buffer solution, taking the dispersion liquid to be dropped on the surface of a screen printing electrode, determining the relation between the concentration of target RNA and peak current by using a differential pulse voltammetry method, a cyclic voltammetry method or an alternating current voltammetry method on an electrochemical workstation, and obtaining a standard curve of current intensity and RNA concentration, thereby completing the construction of an electrochemical sensor;
wherein the initial concentration of the signal probe and the auxiliary probe is 20 mu mol/L, and 120 mu L of the signal probe and the auxiliary probe are respectively added into each 1mg of separated solid; the concentration of the Au @ RGO-SCX 8-electric signal substance complex dispersion (deionized water dispersion) was 2mg/mL, and 1.2mL of the Au @ RGO-SCX 8-electric signal substance complex dispersion was added to 1mg of the separated solid, and the probe was diluted with ultrapure water.
The concentration of 5. mu.L per 0.1mg of solid is in the range of 10-18～10-9mol/L of target RNA.
The buffer solution I contains 10mmol/L Tris-HCl, 1mmol/L EDTA, 300mmol/L NaCl and 1mmol/L MgCl2The solution of (1);
the buffer II is a solution containing 10mmol/L Tris-HCl, 1mmol/LEDTA, 300mmol/L NaCl and 1 mmol/LTCEP.
The phosphate buffer pH was 7.2.
And (4) calculating the concentration of the RNA in the 2019-nCoV in the sample to be detected according to the standard curve obtained in the step (4), and evaluating whether the 2019-nCoV exists in the sample to be detected according to the result so as to judge whether the sample is infected by the virus.
The technology can be used in the fields of sample rapid, bedside instant diagnosis, minimally invasive detection and the like.
(5) Determination of target RNA (2019-nCoV-specific RNA fragment)
2019-nCoV specific RNA fragments were determined using electrochemical sensors constructed as shown in FIGS. 1 and 2 for two target RNAs (ORF1ab and N, 10)-12M), when there is no target RNA, the electrochemical signal is low, and the current is significantly increased when the target RNA fragments are present, thereby demonstrating the feasibility of the sensor. The signal can be used to determine the presence or further quantification of the target RNA.
The above description is only a specific embodiment of the present invention, and the common general knowledge of the known specific structures and characteristics in the schemes is not described herein too much. It should be noted that the above-mentioned embodiments do not limit the present invention in any way, and all technical solutions obtained by means of equivalent substitution or equivalent transformation for those skilled in the art are within the protection scope of the present invention. The scope of the claims of the present application shall be determined by the contents of the claims, and the description of the embodiments and the like in the specification shall be used to explain the contents of the claims.
<110> university of Yunnan
<120> novel electrochemical detection method of coronavirus 2019-nCoV
<160>6
<210>1
<211>22
<212>DNA
<213> Artificial sequence
<400>1
ACCTTTCCACATACCGCAGACG
<210>2
<211>35
<212>DNA
<213> Artificial sequence
<400>1
TCGAGTTACGCTAAGCGCGGAGTTGATCACAACTA
<210>3
<211>35
<212>DNA
<213> Artificial sequence
<400>1
CTTAGCGTAACTCGATAGTTGTGATCAACTCCGCG
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<400>1
CAATCTGTCAAGCAGCAGCA
<210>5
<211>35
<212>DNA
<213> Artificial sequence
<400>1
TCGAGTTACGCTAAGAGACATTTTGCTCTCAAGCT
<210>6
<211>35
<212>DNA
<213> Artificial sequence
<400>1
CTTAGCGTAACTCGAAGCTTGAGAGCAAAATGTCT

Claims (11)

1. An electrochemical detection method of a novel coronavirus 2019-nCoV, which is characterized by comprising three probes aiming at an ORF1ab structural domain in an RNA sequence of the novel coronavirus 2019-nCoV: a capture probe CaptureProbe, CP, a label signal probe, LP and an Auxiliary probe Autoxiliary probe, AP; wherein:
CP：5' - ACCTTTCCACATACCGCAGACG - 3'；
LP：5' - TCGAGTTACGCTAAGCGCGGAGTTGATCACAACTA- 3'；
AP：5' - CTTAGCGTAACTCGA-TAGTTGTGATCAACTCCGCG - 3'；
the detection method comprises three probes aiming at an N structural domain in a novel coronavirus 2019-nCoV RNA sequence as a target: capture probes Capture probe, CP, label signal probe, LP and Auxiliary probe Autoxiliary probe, AP; wherein:
CP：5' - CAATCTGTCAAGCAGCAGCA - 3'；
LP：5' - TCGAGTTACGCTAAG AGACATTTTGCTCTCAAGCT - 3'；
AP：5' -CTTAGCGTAACTCGAAGCTTGAGAGCAAAATGTCT- 3'；
the method comprises the following steps: fe3O4Nano microsphere and gold nanoparticle loaded Fe3O4Nano-composite: au @ Fe3O4Composite, gold nanoparticle/sulfonated cup [8]]Arene/reduced graphene oxide/electrical signal substance complex: au @ RGO-SCX 8-electric signaling substance complex;
the detection method comprises the construction of an electrochemical sensor, and comprises the following steps: mixing Au @ Fe3O4Ultrasonically dispersing the compound in a buffer solution I, adding a capture probe, standing for 5-20 hours at 4 ℃, and separating by using a magnet; the solid was then added to buffer I and hexanethiol, which was used to block non-specific sites and left at room temperatureStanding for 10-40 min, separating by using a magnet, and adding a buffer solution II and target RNA into the separated solid; placing for 1-2 hours at room temperature, then separating by a magnet, sequentially adding a signal probe, an auxiliary probe and Au @ RGO-SCX 8-electric signal substance compound dispersion liquid into the separated solid, placing for 1-2 hours at room temperature, then separating by the magnet, dispersing the solid in a phosphate buffer solution, taking the dispersion liquid to be dropped on the surface of a screen printing electrode, determining the relation between the concentration and the peak current of target RNA by using a differential pulse voltammetry method, a cyclic voltammetry method or an alternating current voltammetry method on an electrochemical workstation, and obtaining a standard curve of current intensity and RNA concentration, thereby completing the construction of the electrochemical sensor;
the pH of the phosphate buffer is 7.2;
the detection method comprises the steps of calculating the concentration of RNA in the new coronavirus 2019-nCoV in a sample to be detected by using the standard curve, and evaluating whether the 2019-nCoV exists in the sample to be detected according to the result so as to judge whether the sample to be detected is infected by the virus.
2. The method for electrochemically detecting the novel coronavirus 2019-nCoV according to claim 1, wherein the Capture probe Capture probe, CP and the tag signal probe Labeled signal probe, LP are modified with thiol at the 3' end.
3. The method of claim 1, wherein the electrochemical detection of the coronavirus 2019-nCoV is Fe3O4The preparation method of the nano-microsphere comprises the following steps: adding ferric trichloride hydrate into ethylene glycol to form a clear solution, adding sodium acetate and polyethylene glycol, stirring for 30-60 minutes, putting into a hydrothermal reaction kettle for heating reaction, cooling to room temperature to obtain a black precipitate, washing the precipitate with absolute ethyl alcohol, and drying to obtain Fe3O4And (4) nano microspheres.
4. The method of claim 3, wherein the electrochemical detection of the coronavirus 2019-nCoV is Fe3O4The preparation method of the nano-microsphere comprises the following parameters: wherein the trichlorinationThe mass volume concentration of the iron hydrate in the ethylene glycol is 0.2-0.5%, the hydrothermal reaction is carried out for 5-10 hours at 120-220 ℃, the drying is carried out for 6-10 hours at 60-100 ℃, the mass ratio of the sodium acetate to the ferric trichloride is 3-6: 1, and the mass ratio of the polyethylene glycol to the ferric trichloride is 1: 2-3: 1.
5. The method for electrochemically detecting the novel coronavirus 2019-nCoV according to claim 1, wherein the gold nanoparticles are loaded with Fe3O4The preparation method of the nano-composite comprises the following steps: mixing Fe3O4Dispersing the nano-microspheres in ultrapure water, ultrasonically dispersing uniformly, sequentially adding polyethylene glycol 400, trisodium citrate, chloroauric acid and ascorbic acid, stirring, separating by using a magnet to obtain black precipitate, and washing by using absolute ethyl alcohol to obtain Au @ Fe3O4And (c) a complex.
6. The method for electrochemically detecting the novel coronavirus 2019-nCoV according to claim 5, wherein the gold nanoparticles are loaded with Fe3O4The preparation method of the nano-composite comprises the following parameters: the concentrations of the polyethylene glycol 400, the trisodium citrate, the chloroauric acid and the ascorbic acid in the ultrapure water are respectively 0.10-0.25 mg/mL, 1-5 mg/mL, 2-6 mg/mL and 1-6 mg/mL.
7. The method for electrochemically detecting the novel coronavirus 2019-nCoV as claimed in claim 1, wherein the gold nanoparticle/sulfonated cup [8]]The preparation method of the aromatic hydrocarbon/reduced graphene oxide/electric signal substance compound comprises the following steps: adding 4-sulfonic acid cup [8]]Dispersing aromatic hydrocarbon hydrate SCX8 and graphene oxide into deionized water, adjusting the pH value to 7.0-12.0 after ultrasonic treatment, centrifuging after reflux reaction, removing supernatant, and washing the solid with deionized water for 3-4 times to obtain a reduced graphene oxide-SCX 8 compound RGO-SCX 8; dispersing RGO-SCX8 compound in deionized water, ultrasonic dispersing uniformly, and adding HAuCl4Stirring, centrifugally separating, removing supernatant, washing the solid with deionized water, and obtaining an Au @ RGO-SCX8 compound; sonicating the Au @ RGO-SCX8 complexDispersing in deionized water, adding an electric signal substance, stirring, performing centrifugal separation to obtain a precipitate, washing the precipitate with deionized water, and finally obtaining the Au @ RGO-SCX 8-electric signal substance compound.
8. The method for electrochemically detecting the novel coronavirus 2019-nCoV according to claim 7, wherein the gold nanoparticle/sulfonated cup [8]]The preparation method of the aromatic hydrocarbon/reduced graphene oxide/electric signal substance compound comprises the following parameters: the mass concentration of the SCX8 and the mass concentration of the graphene oxide in deionized water are both 0.1% -0.5%; HAuCl4The mass concentration of the RGO-SCX8 dispersion liquid is 1% -5%;
the electric signal substance is an electric active substance which can be identified by SCX8 or other macrocyclic supermolecules, and 0.2-1 mg of the electric signal substance is added into each 1mL of Au @ RGO-SCX8 compound dispersion liquid; the electric signal substance is toluidine blue, methylene blue or ferrocene.
9. The electrochemical detection method of the novel coronavirus 2019-nCoV as claimed in claim 1, wherein the construction steps of the electrochemical sensor specifically comprise: ultrasonically dispersing an Au @ Fe3O4 compound in a buffer solution I, wherein the concentration of the Au @ Fe3O4 compound in the buffer solution I is 0.5-3 mg/mL, adding a capture probe, the concentration of the capture probe in the buffer solution I is 0.5-10 mu mol/L, standing for 5-20 hours at 4 ℃, and carrying out magnet separation; then adding the solid into a buffer solution I and hexanethiol, wherein the concentration of the solid in the buffer solution I is 0.5-3 mg/mL, the concentration of the hexanethiol in the buffer solution I is 1-5 mmol/L, the hexanethiol is used for sealing nonspecific sites, standing at room temperature for 10-40 min, separating with a magnet, adding a buffer solution II into the separated solid, and keeping the concentration range of the buffer solution II to 10-18~10-9The concentration of the separated solid in the buffer solution II is 0.5-5 mg/mL for the target RNA in mol/L; standing for 1-2 hours at room temperature, then separating a magnet, sequentially adding a signal probe, an auxiliary probe and Au @ RGO-SCX 8-electric signal substance compound dispersion liquid into the separated solid, standing for 1-2 hours at room temperature, then separating the magnet, dispersing the solid into a phosphoric acid buffer solution, taking the dispersion liquid to drop on a screen printing electrode surfaceAnd determining the relation between the concentration of the target RNA and the peak current by using differential pulse voltammetry, cyclic voltammetry or alternating current voltammetry on an electrochemical workstation, and obtaining a standard curve of current intensity and RNA concentration so as to complete the construction of the electrochemical sensor.
10. The method for the electrochemical detection of the novel coronavirus 2019-nCoV according to claim 1 or 9, wherein the electrochemical sensor is constructed by the following parameters:
wherein the initial concentration of the signal probe and the auxiliary probe is 10-20 mu mol/L, and 100-150 mu L of the signal probe and the auxiliary probe are respectively added into each 1mg of separated solid; the concentration of the Au @ RGO-SCX 8-electric signal substance compound dispersion liquid is 1-5 mg/mL, 1-1.5 mL of the Au @ RGO-SCX 8-electric signal substance compound dispersion liquid is added into each 1mg of separated solid, and the probe is diluted by ultrapure water;
adding 2-10 μ L of the solid in each 0.1mg of the solid to obtain a concentration range of 10-18~10-9Target RNA of mol/L;
the buffer solution I contains 10mmol/L Tris-HCl, 1mmol/L EDTA, 300mmol/L NaCl and 1mmol/L MgCl2The solution of (1);
the buffer II is a solution containing 10mmol/L Tris-HCl, 1mmol/LEDTA, 300mmol/L NaCl and 1 mmol/LTCEP.
11. The method for electrochemically detecting the novel coronavirus 2019-nCoV according to claim 7 or 8, wherein in the preparation method of the gold nanoparticle/sulfonated calix [8] arene/reduced graphene oxide/electric signal substance complex, except for 4-sulfonated calix [8] arene hydrate SCX8, the substitute substances are: calix [6] arene, cyclodextrin and pillared arene, namely macrocyclic supermolecule which can form a host-guest inclusion compound with signal molecules.
CN202010108629.3A 2020-02-21 2020-02-21 Novel electrochemical detection method for coronavirus 2019-nCoV Active CN111189900B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010108629.3A CN111189900B (en) 2020-02-21 2020-02-21 Novel electrochemical detection method for coronavirus 2019-nCoV

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010108629.3A CN111189900B (en) 2020-02-21 2020-02-21 Novel electrochemical detection method for coronavirus 2019-nCoV

Publications (2)

Publication Number Publication Date
CN111189900A CN111189900A (en) 2020-05-22
CN111189900B true CN111189900B (en) 2020-10-27

Family

ID=70705527

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010108629.3A Active CN111189900B (en) 2020-02-21 2020-02-21 Novel electrochemical detection method for coronavirus 2019-nCoV

Country Status (1)

Country Link
CN (1) CN111189900B (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU2021322710A1 (en) * 2020-08-06 2023-02-02 F. Hoffmann-La Roche Ag Compositions and methods for the detection of severe acute respiratory syndrome coronavirus 2 (SARS-2), influenza A, and influenza B
CN113155924B (en) * 2021-03-19 2022-02-15 云南大学 Detection method of norovirus
CN114381553B (en) * 2022-01-27 2023-07-04 云南大学 Biological material for African swine fever virus detection, kit and method for detecting African swine fever virus for non-diagnostic purpose

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160083167A (en) * 2014-12-30 2016-07-12 재단법인 바이오나노헬스가드연구단 Biosensor for detecting target material using nano-gap electrode and metal-nanostructure and method for preparing the same
CN109666070A (en) * 2017-10-13 2019-04-23 清华大学 Monoclonal antibody MERS-4V2 and its encoding gene and application
CN109844514A (en) * 2018-06-21 2019-06-04 云南大学 The preparation method and applications of the electrochemical sensor of non-coding RNA

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9580679B2 (en) * 2012-09-21 2017-02-28 California Institute Of Technology Methods and devices for sample lysis
WO2020075105A2 (en) * 2018-10-10 2020-04-16 Amir Pourjafar Controlling sub-acute ruminal acidosis in a dairy cow

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20160083167A (en) * 2014-12-30 2016-07-12 재단법인 바이오나노헬스가드연구단 Biosensor for detecting target material using nano-gap electrode and metal-nanostructure and method for preparing the same
CN109666070A (en) * 2017-10-13 2019-04-23 清华大学 Monoclonal antibody MERS-4V2 and its encoding gene and application
CN109844514A (en) * 2018-06-21 2019-06-04 云南大学 The preparation method and applications of the electrochemical sensor of non-coding RNA

Also Published As

Publication number Publication date
CN111189900A (en) 2020-05-22

Similar Documents

Publication Publication Date Title
CN111189900B (en) Novel electrochemical detection method for coronavirus 2019-nCoV
Li et al. An ultrasensitive CRISPR/Cas12a based electrochemical biosensor for Listeria monocytogenes detection
Jie et al. Quantum dots-based multifunctional dendritic superstructure for amplified electrochemiluminescence detection of ATP
CN105241939B (en) A kind of preparation method and application based on gold and silver core-shell magnetic graphene Adsorption of Cadmium immunosensor
Wei et al. Magnified fluorescence detection of silver (I) ion in aqueous solutions by using nano-graphite-DNA hybrid and DNase I
Hai et al. Electrochemiluminescence sensor using quantum dots based on a G-quadruplex aptamer for the detection of Pb 2+
Xiang et al. An aptamer-based signal-on and multiplexed sensing platform for one-spot simultaneous electronic detection of proteins and small molecules
CN110687182A (en) Preparation method of electrochemical immunosensor for detecting prostate specific antigen
Ma et al. A PCR based magnetic assembled sensor for ultrasensitive DNA detection
Li et al. Proximity hybridization-regulated electrochemical stripping of silver nanoparticles via nanogold induced deposition for immunoassay
WO2019241948A1 (en) Method for preparing electrochemical sensor for non-coding rna and use thereof
Zhang et al. Highly efficient colorimetric detection of ATP utilizing a split aptamer target binding strategy and superior catalytic activity of graphene oxide–platinum/gold nanoparticles
CN104152449A (en) MiRNA capture probe, modifying electrode thereof, capture probe complementary strand, capture probe complementary strand modified carbon nanotube-gold magnetic nanoparticle compound
Zhu et al. A colorimetric aptasensor for the simple and rapid detection of human papillomavirus type 16 L1 proteins
Bolourinezhad et al. Design of a rapid electrochemical biosensor based on MXene/Pt/C nanocomposite and DNA/RNA hybridization for the detection of COVID-19
Duan et al. A CG@ MXene nanocomposite-driven E-CRISPR biosensor for the rapid and sensitive detection of Salmonella Typhimurium in food
CN105466989B (en) The electrochemical detection method of lead in a kind of soy sauce
Yuan et al. Electrochemical proximity assay-coupled highly nonenzymatic amplifying strategy for total protein of Nosema bombycis detection
Jia et al. A regenerative electrochemical biosensor for mercury (II) by using the insertion approach and dual-hairpin-based amplification
Wei et al. A nano-graphite–DNA hybrid sensor for magnified fluorescent detection of mercury (ii) ions in aqueous solution
Malla et al. Synthesis and characterization of Au-decorated graphene oxide nanocomposite for magneto-electrochemical detection of SARS-CoV-2 nucleocapsid gene
Ma et al. Application and progress of electrochemical biosensors for the detection of pathogenic viruses
Gui-Ying et al. Progresses of magnetic relaxation switch sensor in medical diagnosis and food safety analysis
CN102279172B (en) Nano probe chip for detecting hand-foot-and-mouth disease pathogen and application method thereof
Wu et al. A dual-mode “signal-on” split-type aptasensor for bisphenol A via target-induced hybridization chain reaction amplification

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant