CN111187838B - Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof - Google Patents

Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof Download PDF

Info

Publication number
CN111187838B
CN111187838B CN201911361331.7A CN201911361331A CN111187838B CN 111187838 B CN111187838 B CN 111187838B CN 201911361331 A CN201911361331 A CN 201911361331A CN 111187838 B CN111187838 B CN 111187838B
Authority
CN
China
Prior art keywords
lung cancer
methylation
benzo
dna
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911361331.7A
Other languages
Chinese (zh)
Other versions
CN111187838A (en
Inventor
郭欢
孟华
魏巍
李谷亚男
魏晟
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong University of Science and Technology
Original Assignee
Huazhong University of Science and Technology
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong University of Science and Technology filed Critical Huazhong University of Science and Technology
Priority to CN201911361331.7A priority Critical patent/CN111187838B/en
Publication of CN111187838A publication Critical patent/CN111187838A/en
Application granted granted Critical
Publication of CN111187838B publication Critical patent/CN111187838B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/154Methylation markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis, a screening method and application thereof, wherein the diagnosis marker is selected from at least one methylation site on human chromosome 1, chromosome 2 and chromosome 8, and the lung cancer is diagnosed at an early stage by detecting the change of DNA methylation level caused by benzo [ a ] pyrene exposure in peripheral blood. The methylation levels of the three sites have high diagnostic value for the occurrence of the lung cancer, can be conveniently detected by a blood sample, and is favorable for early diagnosis of the lung cancer based on the methylation levels and the cut-off values of the three sites.

Description

Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof
Technical Field
The invention relates to the technical field of lung cancer diagnosis and detection, in particular to a benzo [ a ] pyrene pollution-related specific methylation marker for lung cancer diagnosis and a screening method and application thereof.
Background
Lung cancer, as a common malignant tumor with the highest prevalence and mortality in China and even worldwide, has become a major public health problem seriously harming the health and economic development of the whole social population. It is reported that about 180 million people are newly diagnosed as lung cancer every year worldwide, about 160 million people die of lung cancer, and the 5-year survival rate of tumors varies from about 4 to 17% according to the stage and regional difference. The diagnosis of lung cancer is of great significance for therapy.
DNA methylation is one of epigenetic regulation mechanisms, and refers to a chemical modification process in which specific bases on a DNA sequence are catalyzed by DNA methyltransferases (DNMTs) and S-adenosyl methionine (SAM) is used as a methyl donor to transfer methyl to a 5 th carbon atom of DNA cytosine in a covalent bond manner to form 5-methylcytosine (5-mC). The DNA methylation modification can cause the change of chromatin structure, DNA conformation, DNA stability and interaction mode of DNA and protein on the basis of not changing DNA sequence, and regulate gene expression, thereby participating in the process of generating and developing various diseases including cancer.
The association between lung cancer and DNA methylation is mainly reflected in that DNA methylation can promote the occurrence and development of lung cancer by influencing the abnormal expression of related genes. The hypomethylation of the whole genome level can increase the expression level of protooncogenes, thereby promoting the growth, differentiation, invasion, migration and the like of cancer cells to further aggravate the cancer; hypermethylation of local regions such as promoter regions can cause the expression of corresponding genes such as cancer suppressor genes to be silenced, thereby losing the ability to regulate cancer cells. Previous studies found that the major risk factors for lung cancer include smoking, air pollution, heavy metal exposure, occupational exposure, and the like. Recent studies have shown that cigarette smoking, air pollutants, etc. can affect the methylation level of DNA in the body, so that the gene expression is increased or reduced or even silenced, and the epigenetic change related to the environmental factors can have a direct relationship with the cause of cancer. Benzo [ a ] pyrene (Ba P) is a common air pollutant and is a typical representative of carcinogenic Polycyclic Aromatic Hydrocarbon (PAHs) compounds, is listed as a definitive human carcinogen by the international center for cancer research, and can obviously increase the incidence risk of lung cancer. A large number of genome-wide epigenetic studies have shown that environmental contaminants such as benzo [ a ] pyrene can cause abnormal changes in DNA methylation in blood or tissue samples. DNA methylation is involved in the development of lung cancer by changing the expression of the corresponding gene, and early diagnosis of tumors can be achieved by detecting the DNA methylation change caused by benzo [ a ] pyrene exposure in blood or tissues. However, there is currently no study on the alteration of DNA methylation associated with benzo [ a ] pyrene exposure in the diagnosis of lung cancer.
Disclosure of Invention
Aiming at the defects of the prior art, the invention provides a benzo [ a ] pyrene pollution-related specific methylation marker for lung cancer diagnosis, a screening method and application thereof, wherein the methylation site can be used as a specific methylation site of a lung cancer diagnosis marker related to an environmental carcinogen benzo [ a ] pyrene, the methylation level of the methylation site has higher prediction value on lung cancer occurrence, and the methylation site can be used as a marker for early lung cancer diagnosis.
The technical scheme provided by the invention is as follows: a benzo [ a ] pyrene contamination-associated specific methylation marker for lung cancer diagnosis, the lung cancer diagnosis marker being selected from at least one methylation site on human chromosome 1, chromosome 2 and chromosome 8, wherein the methylation site on human chromosome 1 is cg20460771, the methylation site on chromosome 2 is cg10103850, and the methylation site on chromosome 8 is cg 10424125.
Further, the cg20460771 locus is located on 28521540 of chromosome 1 and on the PTAFR gene; the cg10103850 site is located on chromosome 2 at 40658891, on the SLC8a1 gene; the cg10424125 site is located on 124194624 of chromosome 8 and on FAM83A gene.
Further, the nucleotide sequence around the cg20460771 site is shown as SEQ ID No 1, the nucleotide sequence around the cg10103850 site is shown as SEQ ID No 2, and the nucleotide sequence around the cg10424125 site is shown as SEQ ID No 3.
SEQ ID No 1:
TTCCTGAGTCTGTAAGAGCCACACATACTCCCTACCTCACACTT AGCATGATGACTGGCACGTACCAGGAATTCAGTAAATGAAAA TCACTTTATTTACCCAAGCTCCTGTTGAGTGTCCCA
SEQ ID No 2:
CATACCCTTATGTCCTGGAAAAAGTTAAAAGAGGAACTGGATT ACAGGCTTTCATAGCTTCGGGCTGGCTGAGAGCCACCCCACAT TCGCCTACACTCTCTGGCTCATGTTTGCTGCTGATG
SEQ ID No 3:
TCAGGGATGGCATCTTTCCCCCCCACAGGGAAATTCTTATCTTT GAAACAGCATGGGAATCGAGGCACCCAGGAGGGGAGCAGAG GCAGGCAGGCCTCCTTCAGGCCCATCCTCCAGCTGGG
A screening method of specific methylation sites related to benzo [ a ] pyrene pollution for lung cancer diagnosis comprises the following steps:
(1) peripheral blood of lung cancer patients and healthy controls and lung cancer and tissue samples beside the cancer of the lung cancer patients are obtained and used as samples to be tested of study objects, and plasma and blood cells are separated from the peripheral blood. The level of BPDE-Alb adduct was first measured for each plasma sample as a marker for the level of internal exposure of study individuals to benzo [ a ] pyrene. Lung cancer patients and healthy controls were tested for peripheral blood DNA whole genome methylation levels using Illumina 450K methylation chip (Illumina, usa).
(2) Adopting a minifi software package, carrying out correlation analysis on the peripheral blood DNA methylation level and the plasma BPDE-Alb adduct level through a general linear model, and according to the correlation P value of less than 1.0 multiplied by 10-4In order to have statistical significance, DNA methylation sites which are obviously related to the plasma BPDE-Alb adduct level are screened;
(3) and (3) detecting the methylation level of the tissue DNA whole genome of the lung cancer and the tissues beside the lung cancer of the lung cancer patient obtained in the step (1) by using an Illumina 450K methylation chip (Illumina corporation, USA). By rank-sum test, the methylation sites with significant difference in the DNA of the lung cancer and the tissue beside the cancer are screened out according to the fact that the P value is less than 0.05;
(4) comparing the methylation sites of the intersection of the methylation sites screened in the step (2) and the methylation sites screened in the step (3) as candidate sites;
(5) and (3) analyzing the correlation between the methylation level of the candidate sites obtained in the step (4) in peripheral blood DNA and the occurrence risk of the lung cancer in lung cancer and control populations by using a multivariate logistic regression model, and further screening out the methylation sites related to the lung cancer according to a test standard that the correlation P value of multiple correction of a Bonferroni method is less than 0.05. And evaluating the diagnosis value of the methylation level of the sites on the occurrence of the lung cancer by drawing a ROC curve.
A benzo [ a ] pyrene pollution-related specific methylation detection primer for lung cancer diagnosis comprises at least one of a primer pair for detecting methylation sites on a PTAFR gene, an SLC8A1 gene and a FAM83A gene, wherein the sequences of the primer pair of the PTAFR gene are shown as SEQ ID No 4 and SEQ ID No 5; the primer pair sequence of the SLC8A1 gene is shown as SEQ ID No. 6 and SEQ ID No. 7; the primer pair sequences of the FAM83A gene are shown as SEQ ID No. 8 and SEQ ID No. 9.
SEQ ID No 4:AGGAAAGTAAATTGGGTTATGG
SEQ ID No 5:AAAAAAAAATTAACCCCTAAACCTAAAAC
SEQ ID No 6:GTTAAAAGAGGAATTGGATTATAGGT
SEQ ID No 7:ACAATTTACAATATAAACCATCAACAAC
SEQ ID No 8:AGGGAAATTTTTATTTTTGAAATAGTATGG
SEQ ID No 9:TACCTCTACTCCCCTCCTAAAT
A benzo [ a ] pyrene pollution-related specific methylation detection kit for lung cancer diagnosis comprises at least one of primer pairs of genes where three DNA methylation sites are located, PCR amplification is carried out on DNA of peripheral blood of a crowd, the methylation levels of the three DNA methylation sites are detected by adopting a pyrosequencing method, and then early diagnosis is carried out on the lung cancer.
The invention provides application of the DNA methylation marker for lung cancer diagnosis in preparation of a diagnostic reagent and/or an auxiliary diagnostic reagent.
The invention provides a method for detecting lung cancer, which is characterized in that three methylation sites of a PTAFR gene cg20460771, an SLC8A1 gene cg10103850 and an FAM83A gene cg10424125 can be used as lung cancer diagnosis markers related to an environmental carcinogen benzo [ a ] pyrene, the methylation levels of the 3 sites have high diagnosis value on the occurrence of lung cancer, and a primer pair for detecting the genes of the methylation sites is designed.
Drawings
FIG. 1 is a Manhattan plot of a whole genome correlation assay of peripheral blood DNA methylation with plasma BPDE-Alb adduct levels;
FIG. 2 shows the methylation levels of the three sites cg20460771, cg10103850 and cg10424125 in the peripheral blood DNA of lung cancer patients and healthy control groups;
FIG. 3 is a diagram of ROC curve evaluation of methylation levels of cg20460771, cg10103850 and cg10424125 sites in peripheral blood DNA for predicting value of lung cancer occurrence.
Detailed Description
In order to make the objects, technical solutions and advantages of the present invention more apparent, the present invention is described in further detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.
A benzo [ a ] pyrene contamination-associated specific methylation marker for lung cancer diagnosis, the lung cancer diagnosis marker being selected from at least one methylation site on human chromosome 1, chromosome 2 and chromosome 8, wherein the methylation site on human chromosome 1 is cg20460771, the methylation site on chromosome 2 is cg10103850, and the methylation site on chromosome 8 is cg 10424125.
Further, the cg20460771 locus is located on 28521540 of chromosome 1 and on the PTAFR gene; the cg10103850 site is located on chromosome 2 at 40658891, on the SLC8a1 gene; the cg10424125 site is located on 124194624 of chromosome 8 and on FAM83A gene.
Further, the nucleotide sequence around the cg20460771 site is shown as SEQ ID No 1, the nucleotide sequence around the cg10103850 site is shown as SEQ ID No 2, and the nucleotide sequence around the cg10424125 site is shown as SEQ ID No 3.
SEQ ID No 1
TTCCTGAGTCTGTAAGAGCCACACATACTCCCTACCTCACACTT AGCATGATGACTGGCACGTACCAGGAATTCAGTAAATGAAAA TCACTTTATTTACCCAAGCTCCTGTTGAGTGTCCCA
SEQ ID No 2
CATACCCTTATGTCCTGGAAAAAGTTAAAAGAGGAACTGGATT ACAGGCTTTCATAGCTTCGGGCTGGCTGAGAGCCACCCCACAT TCGCCTACACTCTCTGGCTCATGTTTGCTGCTGATG
SEQ ID No 3
TCAGGGATGGCATCTTTCCCCCCCACAGGGAAATTCTTATCTTT GAAACAGCATGGGAATCGAGGCACCCAGGAGGGGAGCAGAG GCAGGCAGGCCTCCTTCAGGCCCATCCTCCAGCTGGG
Example 1
(1) 2ml of peripheral blood was collected from 109 lung cancer patients and 109 healthy controls, and plasma and blood cells were separated. The BPDE-Alb adduct level was measured for each plasma sample as a marker for the level of internal exposure of study individuals to benzo [ a ] pyrene. Lung cancer patients and healthy controls were tested for peripheral blood DNA whole genome methylation levels using Illumina 450K methylation chip (Illumina, usa).
(2) Correlation analysis was performed on peripheral blood DNA methylation levels and plasma BPDE-Alb adduct levels using the minifi software package by a general linear model, and fig. 1 is a manhattan plot of the correlation of plasma BPDE-Alb adduct levels with peripheral blood whole genome DNA methylation levels. P value less than 1.0 x 10 according to relevance-4To be statistically significant, DNA methylation sites were screened for association with plasma BPDE-Alb adduct levels.
(2) 50mg of lung cancer and tissues beside the lung cancer obtained in the surgical operation of 109 cases of lung cancer patients in the step (1) are respectively taken, DNA samples are extracted, and the DNA whole genome methylation level of the lung cancer and tissues beside the lung cancer is detected by adopting an Illumina 450K methylation chip (Illumina company in the united states). Screening methylation sites with difference in lung cancer and tissues beside the lung cancer by rank sum test according to the fact that the P value is less than 0.05 and the methylation sites have statistically significant difference;
(3) and (3) comparing the methylation sites at the intersection of the methylation sites screened in the step (1) and the methylation sites screened in the step (2) to obtain candidate sites. Information on candidate methylation sites is shown in Table 1.
TABLE 110 methylation sites that differ significantly in methylation levels in DNA from lung cancer and paracancerous tissues and are associated with plasma BPDE-Alb adducts
Figure BDA0002337231200000081
Figure BDA0002337231200000091
(4) And (3) further analyzing the correlation between the methylation level of the candidate methylation sites in the peripheral blood DNA and the risk of the occurrence of the lung cancer in lung cancer patients and control populations by using a multivariate logistic regression model, and further screening three methylation sites cg20460771, cg10103850 and cg10424125 which are significantly related to the occurrence of the lung cancer according to a test standard that the correlation P value of multiple correction of a Bonferroni method is less than 0.05. Wherein, the high-level BPDE-Alb adduct can obviously increase the methylation level of the cg20460771 site, and the methylation level of the site can further increase the onset risk of lung cancer; while high levels of BPDE-Alb adduct significantly reduce the methylation levels at sites cg10103850 and cg10424125, the reduced methylation levels at these two sites may further increase the risk of lung cancer. The difference of methylation level of peripheral blood DNA of the lung cancer patients and the healthy control group at the three sites of cg20460771, cg10103850 and cg10424125 is shown in figure 2;
(5) further, the methylation levels of these three sites were evaluated by plotting ROC curves for the diagnostic value of lung cancer development, and the specific results are shown in fig. 3. The result shows that the methylation level of the cg20460771 site has the diagnostic value of 88.9 percent, the sensitivity of 80.73 percent and the specificity of 87.16 percent for the occurrence of the lung cancer; the diagnostic value of the methylation level of the cg10103850 site is 89.2%, the sensitivity is 87.14%, and the specificity is 78.29%; the diagnostic value of the methylation level of the cg10424125 site was 70.8%, the sensitivity was 68.93%, and the specificity was 75.84%.
(6) Further, according to the results of the ROC curve in (5), the methylation levels of cg20460771, cg10103850 and cg10424125 are respectively set as cutoff values of > 67.3%, < 13.9%, < 14.3% for lung cancer diagnosis, namely, the diagnosis result can be determined as positive when the criteria are met. The three indexes are respectively subjected to combined diagnostic analysis, and the detection sensitivity can reach 94.5 percent when the methylation levels of cg20460771 and cg10103850 are detected simultaneously and one index of the two indexes is positive, namely the lung cancer is judged to be positive for diagnosis; when the methylation levels of cg20460771 and cg10424125 are detected simultaneously, if the methylation levels are both positive indexes, the lung cancer is judged to be positive, and the detection specificity can reach 91.74%. Therefore, the methylation levels of cg20460771, cg10103850 and cg10424125 are lung cancer specific diagnostic markers with great potential, can be conveniently detected by peripheral blood samples, and are helpful for early diagnosis of lung cancer based on the methylation levels of the three sites and cut-off values thereof.
A detection primer for benzo [ a ] pyrene pollution-related specific methylation for lung cancer diagnosis comprises at least one of a primer pair for detecting methylation sites on a PTAFR gene, an SLC8A1 gene and a FAM83A gene, wherein the sequences of the primer pair of the PTAFR gene are shown as SEQ ID No 4 and SEQ ID No 5; the primer pair sequence of the SLC8A1 gene is shown as SEQ ID No. 6 and SEQ ID No. 7; the primer pair sequences of the FAM83A gene are shown as SEQ ID No. 8 and SEQ ID No. 9.
SEQ ID No 4:AGGAAAGTAAATTGGGTTATGG
SEQ ID No 5:AAAAAAAAATTAACCCCTAAACCTAAAAC
SEQ ID No 6:GTTAAAAGAGGAATTGGATTATAGGT
SEQ ID No 7:ACAATTTACAATATAAACCATCAACAAC
SEQ ID No 8:AGGGAAATTTTTATTTTTGAAATAGTATGG
SEQ ID No 9:TACCTCTACTCCCCTCCTAAAT
A specific methylation detection kit related to benzo [ a ] pyrene pollution for lung cancer diagnosis comprises at least one of primer pairs of genes where three DNA methylation sites are located, PCR amplification is carried out on peripheral blood of a crowd, the methylation levels of the three DNA methylation sites are detected by pyrosequencing, and then early diagnosis is carried out on the lung cancer.
The above description is only a detailed description of specific embodiments of the present invention, and should not be taken as limiting the invention, and any modifications, equivalents, improvements, etc. made on the design concept of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> university of science and technology in Huazhong
<120> benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis, and screening method and application thereof
<160> 9
<170> SIPOSequenceListing 1.0
<210> 1
<211> 122
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
ttcctgagtc tgtaagagcc acacatactc cctacctcac acttagcatg atgactggca 60
cgtaccagga attcagtaaa tgaaaatcac tttatttacc caagctcctg ttgagtgtcc 120
ca 122
<210> 2
<211> 122
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
cataccctta tgtcctggaa aaagttaaaa gaggaactgg attacaggct ttcatagctt 60
cgggctggct gagagccacc ccacattcgc ctacactctc tggctcatgt ttgctgctga 120
tg 122
<210> 3
<211> 122
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
tcagggatgg catctttccc ccccacaggg aaattcttat ctttgaaaca gcatgggaat 60
cgaggcaccc aggaggggag cagaggcagg caggcctcct tcaggcccat cctccagctg 120
gg 122
<210> 4
<211> 22
<212> DNA
<213> primer for methylation of PTAFR gene (1)
<400> 4
aggaaagtaa attgggttat gg 22
<210> 5
<211> 29
<212> DNA
<213> primer for methylation of PTAFR gene (2)
<400> 5
aaaaaaaaat taacccctaa acctaaaac 29
<210> 6
<211> 26
<212> DNA
<213> primer for methylation of SLC8A1 gene (1)
<400> 6
gttaaaagag gaattggatt ataggt 26
<210> 7
<211> 28
<212> DNA
<213> primer for methylation of SLC8A1 gene (2)
<400> 7
acaatttaca atataaacca tcaacaac 28
<210> 8
<211> 30
<212> DNA
<213> primer for methylation of FAM83A Gene (1)
<400> 8
agggaaattt ttatttttga aatagtatgg 30
<210> 9
<211> 22
<212> DNA
<213> primer for methylation of FAM83A Gene (2)
<400> 9
tacctctact cccctcctaa at 22

Claims (2)

1. Detecting benzo [ a]The application of the primer pair of the pyrene pollution related specific methylation marker in the preparation of the lung cancer diagnostic reagent is characterized in that: the specific methylation marker is a methylation site on the human chromosome 1The cg20460771 site is positioned at the cg20460771 sitePTAFROn the gene, the nucleotide sequence around the cg20460771 site is shown in SEQ ID No 1.
2. The use of the primer pair for detecting the specific methylation marker related to benzo [ a ] pyrene contamination according to claim 1 in the preparation of a lung cancer diagnostic reagent, wherein the primer pair comprises: the sequences of the primer pair are shown as SEQ ID No. 4 and SEQ ID No. 5.
CN201911361331.7A 2019-12-26 2019-12-26 Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof Active CN111187838B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911361331.7A CN111187838B (en) 2019-12-26 2019-12-26 Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911361331.7A CN111187838B (en) 2019-12-26 2019-12-26 Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof

Publications (2)

Publication Number Publication Date
CN111187838A CN111187838A (en) 2020-05-22
CN111187838B true CN111187838B (en) 2021-09-24

Family

ID=70705840

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911361331.7A Active CN111187838B (en) 2019-12-26 2019-12-26 Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof

Country Status (1)

Country Link
CN (1) CN111187838B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113265454B (en) * 2021-04-27 2023-07-18 广州医科大学 Method for combined detection of whole genome DNA adducts based on spot hybridization and chromatin co-immunoprecipitation sequencing
CN114164266A (en) * 2022-01-13 2022-03-11 青岛大学 Epigenetic marker for detecting benzo [ a ] pyrene exposure and application

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018009709A1 (en) * 2016-07-06 2018-01-11 Youhealth Biotech, Limited Lung cancer methylation markers and uses thereof
CN107881234A (en) * 2017-11-09 2018-04-06 南京卡迪睿伯生物技术有限公司 One group of adenocarcinoma of lung related gene label and its application

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP3004387A4 (en) * 2013-05-31 2017-04-12 Onconova Therapeutics, Inc. Methods and compositions for predicting therapeutic efficacy of kinase inhibitors in patients with myelodysplastic syndrome or related disorders

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018009709A1 (en) * 2016-07-06 2018-01-11 Youhealth Biotech, Limited Lung cancer methylation markers and uses thereof
CN107881234A (en) * 2017-11-09 2018-04-06 南京卡迪睿伯生物技术有限公司 One group of adenocarcinoma of lung related gene label and its application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Air pollution and DNA methylation alterations in lung cancer: A systematic and comparative study;Cheng-Lan Jiang等;《Oncotarget》;20161125;第8卷(第1期);摘要、第1372页、Supplementary Table S5-S8、第1384-1386页的材料方法 *
Genome-Wide Analysis of DNA Methylation and Cigarette Smoking in a Chinese Population;Xiaoyan Zhu等;《Environmental Health Perspectives》;20160731;第124卷(第7期);第966-973页 *
HumanMethylation450 v1.2 Manifest file;Illumina;《Illumina》;20130523;第1-2页 *

Also Published As

Publication number Publication date
CN111187838A (en) 2020-05-22

Similar Documents

Publication Publication Date Title
Verma et al. Genome-wide DNA methylation profiling identifies differential methylation in uninvolved psoriatic epidermis
EP2891720B1 (en) Method for screening cancer
JP6606554B2 (en) Use of the methylated site of the Y chromosome as a diagnostic marker for prostate cancer
CA2620528A1 (en) Methods and compositions for identifying biomarkers useful in diagnosis and/or treatment of biological states
WO2016097120A1 (en) Method for the prognosis of hepatocellular carcinoma
KR101992786B1 (en) Method for providing information of prediction and diagnosis of obesity using methylation level of CYP2E1 gene and composition therefor
US20210171617A1 (en) Dna methylation markers for noninvasive detection of cancer and uses thereof
CN111187838B (en) Benzo [ a ] pyrene pollution related specific methylation marker for lung cancer diagnosis and screening method and application thereof
CN107532208B (en) Compositions and methods for determining prognosis of endometrial cancer
KR20100093538A (en) Process for predicting the prognosis of squamous cell lung cancer
WO2020034543A1 (en) Marker for breast cancer diagnosis and screening method therefor
CN110904231A (en) Reagent for auxiliary diagnosis of liver cancer and application of reagent in preparation of kit
KR101992792B1 (en) Method for providing information of prediction and diagnosis of obesity using methylation level of AKR1E2 gene and composition therefor
CN115341031A (en) Screening method of pan-cancer methylation biomarker, biomarker and application
CA3031364A1 (en) Rna editing as biomarkers for mood disorders test
KR101992789B1 (en) Method for providing information of prediction and diagnosis of obesity using methylation level of BZRAP1-AS1 gene and composition therefor
CN111321219B (en) Use of ACTA2 methylation as a diagnostic marker for asthma
CN107119144B (en) Application of DNA binding site CTCF-55 of multifunctional transcription regulatory factor CTCF
WO2009123990A1 (en) Cancer risk biomarker
KR102234382B1 (en) Non-small cell lung cancer progression stage detection method by differential methylation signal association analysis
CN109813912B (en) Application of group of serum differential protein combinations in preparation of reagent for detecting autism
WO2009039190A1 (en) Cancer risk biomarker
CN107227366B (en) Application of DNA binding site CTCF-113 of multifunctional transcription regulatory factor CTCF
CN107151708B (en) Application of DNA binding site CTCF-13 of multifunctional transcription regulatory factor CTCF
JP7105460B2 (en) Methods for detecting adult T-cell leukemia/lymphoma

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant