CN111172161A - Long non-coding RNA and application thereof in diagnosis/treatment of preeclampsia - Google Patents

Abstract

The invention belongs to the field of genetic engineering, and particularly relates to application of PDIA3P1 in preparation of medicines for diagnosing preeclampsia and target treatment; the down regulation of PDIA3P1 in the placenta tissue of the pregnant woman in preeclampsia is related to the occurrence and development of preeclampsia, the PDIA3P1 with low expression level has close relation with the preeclampsia pathogenesis, and the proliferation, apoptosis, invasion, migration and the like of trophoblasts of the pregnant woman in preeclampsia are influenced by changing the expression of PDIA3P1, so that the enhancement of the expression of PDIA3P1 can promote the proliferation, invasion and migration of the trophoblasts.

Description

Long non-coding RNA and application thereof in diagnosis/treatment of preeclampsia

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to application of long non-coding RNA-PDIA3P1 in diagnosis and preparation of a medicament for treating preeclampsia.

Background

Preeclampsia is one of the most common pregnancy complications worldwide and is the leading cause of pregnancy complication-related death, and the statistical reports of the world health organization show that preeclampsia or eclampsia directly causes approximately 14% (about 8500) of maternal deaths worldwide per year, which is one of the most common causes of fetal preterm birth and fetal growth restriction, and maternal death. Despite the current development of medical treatments, the overall patient incidence remains high. With the rapid development of sequencing technology and molecular biology, gene diagnosis and molecular targeted therapy become a hot spot problem in preeclampsia treatment. Therefore, the study of the molecular mechanisms involved in the development and metastasis of preeclampsia is of great importance in the development of specific diagnostic methods and personalized therapeutic strategies.

In the past decade, large-scale human genomics studies have been driven by rapid emerging high throughput sequencing-based gene expression analysis techniques and bioinformatics, leading to the discovery of non-coding RNAs. Only 2% of the coding in the human genome is transcribed into proteins, while the vast majority is transcribed into non-coding RNAs, including small ribonucleic acids, long non-coding RNAs (lncRNAs), and pseudogenes. Recently, the role of mirnas in various aspects of cellular processes has been demonstrated, however, functional studies of lncRNAs are not very thorough. The GENECODE research group new data in the ENCODE project revealed thousands of lncRNAs, but only some of them were biologically functional. Interestingly, these lncRNAs are involved in the regulation of a variety of cellular processes through chromatin remodeling, including recombinant stem cell pluripotency, parental imprinting and tumor cell spreading and metastasis as well as epigenetic modification and adsorption of miRNAs.

Recently, a number of studies have shown that abnormal lncRNAs expression exerts different biological mechanisms involved in the development of a variety of human diseases. For example, lncRNA ROR can promote demethylation of the promoter region H3K9 of TESC to be involved in tumorigenesis by inhibiting methyltransferase G9A. Meanwhile, AOC4P inhibits epithelial-mesenchymal transition (EMT) by binding to vimentin and promoting its degradation, thereby inhibiting hepatocellular carcinoma metastasis. In addition, upregulated SPRY4-IT1 inhibited the proliferation, migration and angiogenic capacity of pre-eclamptic trophoblasts by binding to the HUR. These findings suggest that lncRNAs play a crucial role in the development of human diseases, especially preeclampsia. Therefore, finding more lncRNAs related to preeclampsia and researching their biological functions and mechanisms have important significance for better understanding the molecular biology of preeclampsia occurrence and development.

PDIA3P1 is a long lncRNA of 2099nt in length, the sequence of which is shown in SEQ ID NO. 1, and which is located on human chromosome 1q 21.1. We found that PDIA3P1 was down-regulated in placental tissues of pregnant women prior to eclampsia compared to the expression in the placenta of normal pregnant women. After overexpression or knockout of PDIA3P1, the effect of PDIA3P1 on the occurrence and development of preeclampsia was studied and the function of PDIA3P1 on related target genes in feeder cells of pregnant women during preeclampsia was studied.

Disclosure of Invention

The invention aims to provide application of PDIA3P1 in diagnosing preeclampsia and preparing a medicine for treating preeclampsia.

The invention relates to a long-chain non-coding RNA, the nucleotide sequence of which is shown in SEQ ID NO. 1.

The application of a long-chain non-coding RNA in preparing a medicament for treating preeclampsia;

the application of a long non-coding RNA in preparing a reagent for diagnosing preeclampsia;

a primer for detecting RP11-7K24.3, which comprises the following components: 2RPDIA3P1 FATGGGCCTGTGTGTAAGGTAGTG, SEQ ID NO: 3: PDIA3P1 RGTGGCATCCATCTTGGCTAT;

an siRNA that interferes with RP11-7K24.3, that is: SEQ ID NO 4si-PDIA3P 11 # CATTAGTGATAAAGATGCCTCTATA, SEQ ID NO 5si-PDIA3P 12 # GATAACGGAGATGGTATCATCTTAT;

a kit comprising the primer;

a pharmaceutical composition comprising the long non-coding RNA;

the application of the primer in preparing a reagent for diagnosing preeclampsia;

the application of the pharmaceutical composition in preparing a medicament for treating preeclampsia.

The pharmaceutical composition also comprises auxiliary materials. The auxiliary materials comprise: (lip2000, Opti-mem broth, PBS phosphate buffered saline).

In the kit, the concentration of the primers is 10mol/L respectively.

Technical scheme

The differential expression of PDIA3P1 in clinical tissues is screened by qPCR, and the expression level of PDIA3P1 in the placenta tissues of pregnant women before eclampsia is found to be lower than that in the placenta of normal pregnant women. Guessing: whether PDIA3P1 is involved in the pathogenesis of preeclampsia disease.

And then, selecting internationally recognized normal trophoblasts as an experimental research object, designing an interference sequence of PDIA3P1, and simulating the pathogenesis of preeclampsia diseases after the interference sequence is transferred into cells by taking lip2000 as a transfection vector. By detecting the functions of the cells such as proliferation, apoptosis, angiogenesis and the like after the interference sequence is transferred into the cells. Thus, the fact that the expression of PDIA3P1 is knocked down in normal trophoblast HTR-8/SVneo is proved to influence the function of cells and induce or accelerate the onset and progress of preeclampsia diseases. In contrast, the PDIA3P1 plasmid was constructed to verify the function of PDIA3P1 in trophoblast HTR-8/SVneo.

Through transcriptome sequencing, relevant downstream target genes of PDIA3P1 which are possibly involved in cell functions (such as proliferation, apoptosis or angiogenesis) are detected, then preliminary discussion on a PDIA3P1 regulation mechanism shows that PDIA3P1 is more existed in nucleus of trophoblast cells through means of FISH and the like, and the PDIA3P1 is considered to possibly regulate corresponding target genes at a post-transcriptional level, and the expression of the downstream target genes DCN is detected and verified to be promoted by the PDIA3P1 through recruitment of JMJD2A through RNA co-immunoprecipitation and DNA co-immunoprecipitation experiments.

The various reagents required for the transfection process,

(1) lip2000, a versatile lipofection reagent, is suitable for transfection of DNA, RNA and oligonucleotides, and has high transfection efficiency for most eukaryotic cells. The unique formula of the recombinant DNA gene can be directly added into a culture medium, the transfection efficiency is not influenced by the presence of serum, and the PDIA3P1 interference sequence is transferred into cells.

(2) The Opti-mem culture medium containing HEPES 2400mg/L sodium bicarbonate, hypoxanthine, thymine, sodium pyruvate, L-glutamine, trace elements, growth factors, and phenol red reduced to 1.1mg/L was used as an adjuvant for transfection reagents, which are not harmful to cells themselves, and were better and more efficiently transferred into cells to achieve the intended purpose.

(3) PBS phosphate buffered saline (phosphate buffer saline) generally acts as a solvent to solubilize the protective agent. The buffer solution is the most widely used buffer solution in biochemical research, the main components are Na2HPO4, KH2PO4, NaCl and KCl, and the pH value range of the buffer solution is wide due to the secondary dissociation of the Na2HPO4 and the KH2PO 4; while NaCl and KCl mainly act to increase the salt ion concentration. Excluding its own effect on the subjects.

Tissue collection

30 pairs of placenta tissues of pregnant women with preeclampsia and normal pregnant women without any basic diseases are diagnosed by receiving a caesarean section operation in national hospitals of Jiangsu province and women and children health care hospitals of Jiangsu province from 2017 to 2018. And record clinical features: including the age of the pregnant woman, the history of smoking, the number of gestational weeks, the systolic pressure, the diastolic pressure, the proteinuria and the fetal weight. Tissue samples were collected either in liquid nitrogen for the first time or stored at-80 ℃ until RNA extraction. The study was approved by the ethical committee of the university of medical, Nanjing. Written informed consent was obtained from all patients.

Cell lines

Trophoblasts (HTR-8/SVneo) were selected from university of Queen, Canada. HTR-8/SVneo cells are cultured by using RPMI 1640 medium; the medium contained 5% fetal calf serum, 100U/ml penicillin and 100mg/ml streptomycin. 5% CO₂And culturing at 37 ℃ in an incubator by a conventional method. The culture medium is replaced every 2-3 days, and the cells are passaged when the cell fusion degree reaches 80% -90%. All cell lines were verified by DNA analysis of short tandem repeats.

RNA extraction and quantitative PCR analysis

according to the instruction of using reagent, using Trizol reagent to separate total RNA, reverse transcription reaction uses TaKaRa PrimeScript kit (TaKaRa, Dalian, China) reverse transcription kit to make reverse transcription of 0.8. mu.g of total RNA, and its final volume is 20. mu.l, and the result analysis includes analyzing specificity and amplification efficiency of primer, judging reaction specificity of primer according to dissolution curve, obtaining Ct value according to amplification curve, adopting relative quantity method and internal reference GAPDH to make analysis of target gene relative expression quantity, and its calculation formula is 2^ (- △ Ct), and delta. Ct gene-Ct control.

Plasmid construction

Synthesizing full-length PDIA3P1 cDNA, inserting it into eukaryotic expression vector pCDNA3.1 to construct PDIA3P1 overexpression vector plasmid, transforming said plasmid into colibacillus, shake culturing, selecting monoclone bacteria, culturing and amplifying.

Cell transfection

The plasmid vectors used for transfection (pCDNA3.1-PDIA3P1, si-PDIA3P1 and empty vector plasmids) were extracted with a plasmid extraction kit (DNA Midiprep kit, Qiagen) for endotoxin removal. The interference sequence and the scrambled control (si-NC) of PDIA3P1 were purchased from Invitrogen (Invitrogen, Calif., USA). Cells HTR-8/SVneo were plated at 2X 10 per well⁵Planting the cells on a 6-hole culture plate, and after the cells adhere to the wall, removing the original culture medium 6h before transfection, and replacing the original culture medium with a double-antibody-free culture medium; diluting 10 μ L liposome in 240 μ L OPTI-MEM, gently pumping, mixing, and incubating at room temperature for 5 min; 100pmol siRNA, si-NC or 3ug plasmid vector is respectively diluted in 250 μ L OPTI-MEM, blown and mixed evenly, and incubated for 5min at room temperature; mixing the incubated liposome with siRNA or plasmid diluent, and gently whipping and uniformly mixing. Incubating at room temperature for 20 min; the mixture was dropped into a 6-well plate containing 1.5mL of OPTI-MEM, and gently mixed. After further culturing for 6h at 37 ℃ in a 5% CO2 incubator, the medium was changed to completion. 36h after transfection, collecting cells to extract RNA or protein for real-time quantitative RT-PCR or immunoblot analysis.

Cell proliferation Activity assay

MTT assay, the treated cells were seeded in 96-well culture plates at 2000-3000 cells per well. After 80% of cells adhere to the wall, synchronizing the cells for 12h, and discarding the original culture medium. For each sample, 6 duplicate wells were set, with a total reaction volume of 200. mu.l per well. Mu.l of MTT reaction solution (5 mg/ml in PBS) was added to each well and incubated at 37 ℃ for 4h in the absence of light. The supernatant was discarded, 150. mu.l of dimethyl sulfoxide (DMSO) was added to each well, shaken for 10min, and the absorbance at a wavelength of 490nm was measured with a microplate reader.

Clone formation experiments, treated cells were seeded into 6-well culture plates at 600, 800, 1000 cells per well. Adding 2ml of complete culture medium into each hole, culturing for 10-14 days, then treating, removing the complete culture medium, adding 4% paraformaldehyde for fixing for 30 minutes, removing the paraformaldehyde, and adding crystal violet for dyeing for 2 hours. Finally, the cells were washed with flowing PBS. And (5) drying and taking a picture.

Flow cytometry

Apoptosis assay HTR-8/SVneo cells after 48 hours of transfection were collected by trypsinization and subsequently stained with Annexin V-FITC fluorescent probe and Propidium Iodide (PI) according to the FITCAnnexin V apoptosis assay kit (BD) and instructions for its use. Flow cytometry detection and analysis.

Cell cycle assays were PI stained using the cycleTEST PLUS DNA kit (BD) according to the instructions, followed by FACScan analysis.

Subcellular structure localization (nuclear matter separation)

The nuclei and cytoplasm of HTR-8/SVneo cells were isolated using the PARIS kit (Life Technologies, USA) according to the instructions for use. The distribution of PD1A3P1, GAPDH and U1 in the cytoplasm and nucleus was examined using qPCR method. GAPDH is cytoplasmic and U1 is nuclear. The expression of PDIA3P1, GAPDH and U1 in cytoplasm and nucleus are presented as percent of total RNA.

In situ hybridization technique (FISH)

According to the characteristics of a PDIA3P1 gene transcript, a corresponding probe (synthesized by Shanghai Bo valley Biotech company) is designed, HTR-8/SVneo cells are planted in a 6-pore plate containing 15mm slide glass, when the number of the cells is about 80%, a culture medium is discarded and washed twice by PBS, 2ml of methanol is added for fixing for 30min and then the samples are sent, the Shanghai Bo valley Biotech company carries out the next treatment, an inverted silver light microscope is selected for photographing, the sub-localization of PDIA3P1 in the cells is qualitatively detected, and the nuclear-cytoplasmic separation experiment result is further verified.

RNA-seq (transcriptome sequencing)

The cells are planted in a six-well plate, 10ul of lip2000 si-PDIA3P1 and si-NC are processed after the cells grow to about 80%, the cells are collected by Trizol processing after 48 hours, the cells are sent to a Beijing gene detection mechanism for implementation, and Illumina is selected for carrying out subsequent experiments to obtain and process corresponding data.

RIP-qPCR experiment

Scraping the trophoblasts in the ultra-large dish, and cracking by RIP (RIP-friendly protein) cracking buffer solution; whole cell extracts were incubated with magnetic beads of JMJD2A antibody at 4 ℃ for 8 hours, using mIgG as control; after washing the magnetic beads in various wash buffers, the complexes were incubated with 0.1% SDS/0.5mg/ml proteinase K (30 min at 55 ℃) to remove proteins; the purified RNA was subjected to qRT-PCR analysis to demonstrate that PDIA3P1 can bind to JMJD2A antibody.

ChIP-qPCR

Analysis and detection JMJD2A is bound to the promoter region of DCN gene, and apparently regulates the expression of DCN. Briefly, 550. mu.l of 37% paraformaldehyde was added to a large dish containing 20mL of medium; incubating at room temperature on a shaking bed; adding 10 Xglycine into the culture dish; shaking the mixture on a shaking table to be even and incubating the mixture at room temperature; putting the culture dish on ice for later use; absorbing the culture medium; adding 20ml of PBS to wash the cells; centrifuging; the supernatant was removed. Incubate on ice for 15 minutes, gently vortex the cell lysate every 5 minutes; centrifuging; 0.5ml of cell nucleus lysate to resuspend the cells; performing ultrasonic treatment on ice, and centrifuging; subpackaging the supernatant into EP tubes with 50 μ l each; preparing IP reaction, and adding 450 mul of Dilution buffer into each reaction tube; adding the antibody and 20 mu l of uniformly mixed magnetic beads into the reaction solution, and incubating at 4 ℃ overnight; washing the magnetic bead-antibody by using a buffer vortex, combining the antibody-target protein-DNA compound, and precipitating; washing the deposited complex to remove some non-specific binding; eluting to obtain an enriched target protein-DNA compound; decrosslinking, purifying the enriched DNA-fragments; the DCN promoter region fragments were analyzed by qPCR. The desired cDNA was obtained for the next qRT-PCR analysis.

Western blotting (Westernblotting)

The denatured cell protein lysate is added to a well of a 10% denatured polyacrylamide gel (SDS-PAGE) prepared in advance, and the proteins in the sample are separated. Subsequently transferred to NC membranes and incubated with specific antibodies. Finally, the ECL luminescence hydraulic pressure piece is used for exposure. GAPDH antibody was used as a control and DCN antibody was purchased from Proteintech.

Data processing

The experimental data were analyzed using the SPSS17.0 software, expressed as the mean of three experiments ± standard error, and the differences between groups were tested using the two-tailed Student's T test, the rank-sum test, and the chi-square test. Subsequent reuse of multi-factor analysis with p <0.05 in single factor analysis.

Compared with the prior art, the invention has the technical effects that:

we found a novel lncRNA PDIA3P1 and demonstrated its down-regulation of expression in preeclamptic tissues. The expression of the downregulated PDIA3P1 is closely related to the pathogenesis of preeclampsia. The knocking-down of PDIA3P1 can inhibit cell proliferation and vascularization and promote the apoptosis of trophoblasts. Furthermore, we believe that knocking down PDIA3P 1-mediated suppression of trophoblast growth is to some extent dependent on DCN expression. Here, we demonstrate for the first time that PDIA3P1 performs a related function in human trophoblasts by inhibiting the expression of trophoblast DCN. lncRNAs regulate the expression of target genes by various mechanisms, such as recruitment of chromatin-regulating enzymes to target genes and cis-or trans-regulation of transcription, as scaffolding to bind related molecular elements or adsorption of mirnas. In this study, we found that PDIA3P1 recruits JMJD2A to mediate key regulators of the network of upregulation of trophoblast DCN. After inhibition of JMJD2A, DCN expression was up-regulated, qPCR and immunoblotting showed. Taken together, these findings demonstrate that downregulated PDIA3P1 expression can impair trophoblast biological function by recruiting JMJD2A to mediate the expression of JDP 2.

Our studies found for the first time that expression of PDIA3P1 was down-regulated in maternal placental tissues and cells prior to eclampsia. The expression of the placenta trophoblast HTR-8/SVneo of the pregnant woman in preeclampsia knocks down PDIA3P1, the expression shows a cell inhibition function, and the downregulation of PDIA3P1 shows that the cell proliferation and the angiogenesis capacity are inhibited and the apoptosis is promoted to be increased. Furthermore, the method is simple. Our findings will further enrich the pre-eclamptic pathogenesis and facilitate lncRNA-directed diagnosis and treatment.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.

FIG. 1 shows that PDIA3P1 is expressed and down-regulated in placenta tissues of pregnant women before eclampsia

1A-1BPDIA3P1 was down-regulated in maternal placental tissue (n-30) prior to eclampsia.

1C relative expression of PDIA3P1 was detected in four trophoblast lines, with HTR-8/SVneo expression being the highest and JEG-3 expression being the lowest.

FIG. 2 Effect of PDIA3P1 on the angiogenic potential of HTR-8/SVneo cells

2A-2D knockdown of PDIA3P1 inhibits the angiogenic ability of trophoblast HTR-8/SVneo.

FIG. 3 detection of potential downstream target genes involved in PDIA3P1 mediated trophoblast growth by sequencing

3A RNA transcriptome sequencing was performed after HTR-8/SVneo trophoblasts interfered with PDIA3P 1.

3B, carrying out various bioinformatics technical analyses including GO enrichment analysis and COG functional classification on the sequencing result, wherein the downstream differential gene functions are mainly as follows: cell migration and apoptosis related genes, extracellular matrix related genes, proliferation related genes.

The 3C-3D knockdown of PDIA3P1 was followed by RT-PCR and western blotting methods to verify that DCN is a potential target gene.

FIG. 4PDIA3P1 regulates the expression of DCN by recruiting JMJD 2A.

4A-4BFish and Nuclear-cytoplasmic separation experiments the location of PDIA3P1 was detected in HTR-8/SVneo.

The 4C RIP experiment shows that the PDIA3P1 has the highest association degree and the highest up-regulation fold with JMJD2A protein.

After 4D-4E interfered with JMJD2A, DCN was up-regulated in gene and protein level expression.

Detailed Description

The invention is further illustrated by the following examples, without restricting the invention thereto.

The experimental procedures for specifying conditions in the examples were carried out essentially according to the conditions and methods described in molecular cloning instructions (3 rd edition), molecular cloning, handbook of experiments, scientific Press 2002.8, written by Sambrook, J et al, or according to the conditions and methods suggested by the supplier of the materials, other techniques not described in detail corresponding to standard procedures well known to those skilled in the art.

The material of the invention: the cell lines and culture media mentioned in this application are commercially available or otherwise publicly available, and are by way of example only and not exclusive to the present invention, and may be replaced by other suitable means and biological materials, respectively.

Example 1

Detecting the expression of PDIA3P1 in tissue and cell

0.1g of tissue was ground well (powdered) with liquid nitrogen or 1-5X 107 cells were discarded from the medium and rinsed 2 times with pre-cooled PBS. Adding 1ml Trizol lysate, blowing and beating by an enzyme-free gun head, uniformly mixing, standing for 5min, and transferring the lysate into a pre-marked centrifuge tube with 1.5ml of enzyme. Centrifuging at 4 deg.C for 5min at 7500g, collecting supernatant, adding 1/5 volume of chloroform, mixing by inversion for 30s, and standing for 2 min. Centrifuge at 12000g for 15min at 4 ℃. The solution was divided into three layers (aqueous phase-white precipitate-red organics) and the aqueous layer was transferred to a new 1.5ml centrifuge tube, minimizing the uptake of white precipitate. Adding equal volume of isopropanol, slightly reversing, mixing, and standing for 5-10 min. Centrifuge at 12000g for 10min at 4 ℃. The supernatant was aspirated off, 1ml of 75% ethanol (ready to use) was added, and the RNA pellet was washed. Centrifuge at 7500g for 5min at 4 deg.C, and discard the supernatant. Removing 75% of alcohol as much as possible, and air drying at room temperature for about 15 min. The RNA pellet was dissolved in RNase-free water (20-25. mu.l).

The concentration of RNA was determined by UV absorbance assay. RNA concentration and purity were determined using an ultraviolet spectrophotometer, with the RNA dissolved DEPC water being zeroed prior to measurement. The reading at 260nm is 1, which represents 40 ng/. mu.l, the ratio of A260/A280 of the RNA solution is used for detecting the purity of the RNA, and the ratio ranges from 1.8 to 2.1, which indicates that the requirements are met. Agarose gel electrophoresis identified the integrity of the RNA. 1 percent of agarose gel is prepared. The agarose was dissolved by heating, cooled and 1. mu.l of ethidium bromide (EB,10 mg/ml) was added. Shaking, pouring gel, condensing gel, placing in electrophoresis tank, soaking in 1 × TAE buffer solution, and balancing for 10 min. And (4) spotting. 5 Xnucleic acid electrophoresis loading buffer was mixed with the samples at 1:4(v/v) and each sample contained exactly 1. mu.g of RNA to the gel wells. Electrophoresis at 80V for 50 min. After the electrophoresis was finished, the results were observed on a gel imager.

Tris-acetate (TAE) buffer formulation (1L)50 ×:

242g of 2M Tris base

1M acetic acid 57.1mL glacial acetic acid (17.4M)

100mM EDTA 200mL 0.5M EDTA(pH8.0)

Deionized water to 1L

Real-time quantitative PCR

The total RNA of the placenta tissue of the pregnant women before eclampsia and the placenta tissue specimen of the normal pregnant women and HTR-8/SVneo cells is subjected to reverse transcription reaction by using a TaKaRa PrimeScript kit (Dalianbao bioengineering Co., Ltd.). The reverse transcription reaction system is as follows:

the reverse transcription reaction conditions were as follows: 15min at 37 ℃ (reverse transcription); 5sec at 85 ℃ (inactivation reaction of reverse transcriptase). Designing primer sequences according to gene sequences provided by Genebank,

QPCR employs the 7300PCR system (Applied Biosystems, Warrington, UK). The cDNA sample was amplified using a three-part PCR standard protocol. Reaction system:

reaction conditions are as follows:

and analyzing the specificity and amplification efficiency of the primer, judging the reaction specificity of the primer according to a dissolution curve, obtaining a Ct value according to the amplification curve, and analyzing the relative expression quantity of the target gene by adopting a relative quantity method and an internal reference GAPDH, wherein the calculation formula is 2^ (- △ Ct) and the calculation formula is Ct gene-Ct control.

The primers for PDIA3P1 are as follows:

Primer F 5’-ATGGGCCTGTGAAGGTAGTG-3’，SEQ ID NO：2，

Primer R 5’-GTGGCATCCATCTTGGCTAT-3’，SEQ ID NO：3。

the result shows that the expression of lncRNA PDIA3P1 in the placenta tissue of the pregnant woman before eclampsia is reduced compared with that in the normal tissue. The expression level of 30 pairs of pregnancies placenta tissues in preeclampsia is detected by real-time quantitative PCR (polymerase chain reaction) compared with the expression level of PDIA3P1 in normal tissues. The results show that expression of PDIA3P1 is reduced compared to normal maternal placental tissue (fold >1.5, P <0.05) in 60% (12/20) of pre-eclamptic maternal placental tissue compared to normal tissue (fig. 1A and 1B). Suggesting that PDIA3P1 may play an important role in the diagnosis, development and treatment of preeclampsia diseases.

Example 2.

To investigate the effect of PDIA3P1 on the phenotype of normal trophoblast HTR-8/SVneo and JEG3 cells.

Firstly, selecting a normal trophoblast HTR-8/SVneo cell line as a research object of the experiment, transfecting a PDIA3P1 interference sequence by using lip2000 as a vector to knock down the expression of PDIA3P1 to simulate the onset process of preeclampsia, and detecting MTT and clone proliferation experiments to find that the interference sequence of PDIA3P1 is transfected in the HTR-8/SVneo cell and the cell growth is inhibited after the expression of PDIA3P1 is knocked down. From this, it is shown that PDIA3P1 promotes the proliferative capacity of HTR-8/SVneo cells.

Example 3

Effect of PDIA3P1 on apoptosis of placental trophoblasts HTR-8/SVneo.

To investigate whether PDIA3P1 proliferation of HTR-8/SVneo cells affects cell cycle switching, the expression of PDIA3P1 interference sequences to knock down PDIA3P1 mimicked the onset of preeclampsia using a normal feeder cell HTR-8/SVneo cell line as the subject and lip2000 as the vector. We performed flow cytometry to analyze whether apoptosis was involved in the inhibition of cell growth induced by PDIA3P1 knockdown. As shown in FIG. 2C, early apoptosis (UR) and late apoptosis rate (LR) were higher in PDIA3P1 knockdown HTR-8/SVneo cells than in control cells. Thus, PDIA3P1 inhibits trophoblastic apoptosis.

Example 4

PDIA3P1 is involved in the angiogenic capacity of HTR-8/SVneo cells.

The angiogenic capacity of trophoblasts is an important aspect in the pathogenesis of preeclampsia. The HTR-8/SVneo cell line is used as a research object, and the interference sequence of the transfected PDIA3P1 is used for down-regulating the expression of PDIA3P1 by using lip2000 as a vector. The effect of PDIA3P1 knockdown on the angiogenic capacity of HTR-8/SVneo cells was studied using an angiogenic capacity assay. It can be seen that the low expression of PDIA3P1 affects the angiogenic ability of normal trophoblasts, further affects the shallow implantation of placenta, and induces the occurrence of preeclampsia.

Unless specifically stated otherwise, the numerical values set forth in these examples do not limit the scope of the invention. In all examples shown and described herein, unless otherwise specified, any particular value should be construed as merely illustrative, and not restrictive, and thus other examples of example embodiments may have different values.

SEQUENCE LISTING

<110> Jiangsu province national hospital (the first subsidiary hospital of Nanjing medical university)

<120> a long non-coding RNA and its use in diagnosis/treatment of preeclampsia

<130>2020

<160>5

<170>PatentIn version 3.3

<210>1

<211>2099

<212>DNA

<213>Homo sapiens

<400>1

aaactaaatc aaacttgagt atgaaacttc ttttttttta agtgcctaag tcctgaatga 60

caacaaaaga ctgaagaact gacaacgatt agaggacact aaggagactt aacaactaaa 120

tgcaaaatgg gaccctgaat ctgatcctgg aacacaaaaa ctaaattagt agaaaagtgg 180

taaaataggt ggtcgcgcgc ccgaccgccg cagtcccagt cgagccgcga cccttccggc 240

tgcccccacc ccacctcgcc gccatgtgcc tccgccgccc agcgctgttc ccgggcgtgg 300

cgctgcttct cgccgcggcc cgcctcgcgg ctgcctccga cgtgctagga ctcagggacg 360

acaacttgga gagtcgcatc tccgacacgg gctctgcggg cctcatgctc gtcgagttct 420

tcgccccctg gtgtggacac tgcaagagac ttgctcctga gtatgaagct gcagctacca 480

gattaaaagg aatagtccca ttagcaaagg ctgattgcac tgccaacact aacacctgta 540

ataaatatgg agtcagtgga tatccaaccc tgaatatgtt tagagatggt gaagaagcag 600

gtgcttatga tggacctagg actgctgatg gaattgtcag ccacctgaag aagcaggcag 660

gcccagcttc agtgcctctc aggactgagg aagaatttaa gaaattcatt agtgataaag 720

atgcctctat agtaggtttt ttcgatgatt cattcagtga agctcactcc gagttcctaa 780

aagcagccag caacttgagg gataactacc gatttgcaca tacgaatgtt gagtctctgg 840

tgaacgagta tgatgataac ggagatggta tcatcttatt tcgtccttca catctcacta 900

acaagttgga ggacaagact gtggcatata cagtgcaaaa aatgaccagt ggcaaaatta 960

aaaagtttat ccaggaaaacatttttggta tctgccctca catgacagaa gacaataaag 1020

atttgataca gggcaaggac ttacttattg cttactatga tgtggactat gaaaagaatg 1080

ctaaaggttc caactactgg agaaacaggg taatgatggt ggcaaagaaa ttcctggatg 1140

ctgggcacaa actcaacttt gctgtagcta gccgcaaaac ctttagccat gaactttctg 1200

attttggctt ggagagcact gctggagaga ttcctgttgt tgctatcaga actgctaaag 1260

gagagaagtt tgtcatgcag gaggatttct cgcgtgatgg gaatgctctg gagaggttcc 1320

tgcaggatta ctttgatggc aatctgaaga gatacctgaa gtctgaacct atcccagaga 1380

gcaatgatgg gcctgtgaag gtagtggtag cagagaattt tgatgaaata gtgaataatg 1440

aaaataaaga tgtgctgatt gaattttatg ccccttggtg tggtcactgt aagaacctgg 1500

agcccaagta taaagaactt ggcgagaagc tcagcaaaga cctgaatatc gtcatagcca 1560

agatggatgc cacagccaat gatgtgcctt ctccatatga agtcagagtt ttcctaccat 1620

atacttctct ccagccaaca agaagctaaa tccaaagaaa tatgaaggtg gccatgaatt 1680

aagtgatttt attagctatc tacaacgaga agctacaaac ccccctgtaa ttcaagaaga 1740

aaaacccaag aagaagaagg cacaggagga tctctaaagc agtaggcaaa caccactttg 1800

taaaaggact cttccaccag agatgggaaa accactgggg aggactagga cccatatggg 1860

aattattacg tctcagggcc gagaggacag aatggatata atctgaatcc tgttaaattt 1920

tctctaagcc atttcttagc tgcactgtta tggaaatacc aggaccagtt tatgtttgtg 1980

gttttgggaa aaattattgg tgttggggga aatgttgtgg gagtcgggtt gagttggggg 2040

tattttctaa tttttttgtg catttggaac agtgacaata aataagaccc ctttaaact 2099

<210>2

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>2

atgggcctgt gaaggtagtg 20

<210>3

<211>20

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>3

gtggcatcca tcttggctat 20

<210>4

<211>25

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>4

cattagtgat aaagatgcct ctata 25

<210>5

<211>25

<212>DNA

<213> Artificial sequence (Artificial sequence)

<400>5

gataacggag atggtatcat cttat 25

Claims (8)

1. A long non-coding RNA, PDIA3P1, having the nucleotide sequence of SEQ ID NO: 1.

2. the use of the reagent for the detection of long non-coding RNA according to claim 1 in the preparation of a reagent for the diagnosis of preeclampsia.

3. Use of a composition comprising a long non-coding RNA according to claim 1 in the preparation of a medicament for the treatment of preeclampsia.

4. A primer for detecting PDIA3P1 is characterized in that PDIA3P1 FATGGGCCTGTGTGAAGGTAGGTG (SEQ ID NO: 2) and PDIA3P1 RGTGGCATCCATCCATCTTGGCTATT (SEQ ID NO: 3).

5. An siRNA interfering with PDIA3P1, si-PDIA3P 11 # CATTAGTGATAAAGATGCCTCTATA (SEQ ID NO: 4), si-PDIA3P 12 # GATAACGGAGATGGTATCATCTTAT (SEQ ID NO: 5).

6. A kit comprising the primer of claim 4.

7. Use of a kit according to claim 6 for the manufacture of a kit for the diagnosis of preeclampsia.

8. Use of incrna according to claim 1 for the preparation of a medicament for the treatment of pre-eclampsia.

Images