CN111164097A - Mnep monomer variant and application thereof - Google Patents

Mnep monomer variant and application thereof Download PDF

Info

Publication number
CN111164097A
CN111164097A CN201980002444.XA CN201980002444A CN111164097A CN 111164097 A CN111164097 A CN 111164097A CN 201980002444 A CN201980002444 A CN 201980002444A CN 111164097 A CN111164097 A CN 111164097A
Authority
CN
China
Prior art keywords
mnep
mutation
monomer
porin
variant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN201980002444.XA
Other languages
Chinese (zh)
Other versions
CN111164097B (en
Inventor
刘少伟
周雅
陈呈尧
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qitan Technology Ltd Beijing
Original Assignee
Qitan Technology Ltd Beijing
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qitan Technology Ltd Beijing filed Critical Qitan Technology Ltd Beijing
Priority claimed from PCT/CN2019/109333 external-priority patent/WO2021056599A1/en
Publication of CN111164097A publication Critical patent/CN111164097A/en
Application granted granted Critical
Publication of CN111164097B publication Critical patent/CN111164097B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/35—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Mycobacteriaceae (F)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6869—Methods for sequencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/32—Mycobacterium

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Analytical Chemistry (AREA)
  • Immunology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides a polypeptide comprising SEQ ID NO: 1, position 92-104, and porins or constructs comprising at least one Mnep monomer variant, and uses thereof. The invention also provides a method of characterising a target polynucleotide.

Description

Mnep monomer variant and application thereof
Technical Field
The invention relates to the technical field of characterization of nucleic acid characteristics, in particular to a Mnep monomer variant, a porin containing the Mnep monomer variant, a construct and a method for characterizing a target polynucleotide by applying the Mnep monomer variant or the porin.
Background
The nanopore sequencing technology is a gene sequencing technology which takes a single-stranded nucleic acid molecule as a sequencing unit, utilizes a nanopore capable of providing an ion current channel to enable the single-stranded nucleic acid molecule to pass through the nanopore under the driving of electric field force, generates corresponding blocking current due to physical space occupying effect when polynucleotide is translocated through the nanopore, and reads different generated signals in real time to further analyze and obtain polynucleotide sequence information. Nanopore sequencing technology has the following advantages: under the condition of no need of amplification, the library can be simply and conveniently established; the reading speed is high, and the reading speed of the single-stranded molecules can reach tens of thousands of bases per hour; longer read lengths, typically up to several kilobases; measurement of DNA or RNA modified by methylation or the like can be directly performed.
However, there is still a need for improved accuracy in that each or a series of nucleotides, when passed through a nanopore protein under the influence of an electric field, will produce a specific blocking current, and the current signal recorded at this time corresponds to the sequence of the polynucleotide, but typically 3-4 or more nucleotides control the current level at some level. Currently, accuracy can be improved by altering the polynucleotide structure, the duration at the nanopore, and developing new nanopores to control translocation of the polynucleotide.
For example: patent WO2013057495A3 discloses a novel method for characterising a target polynucleotide using a pore and a Hel308 helicase or molecular motor capable of binding to nucleotides within the target polynucleotide. The helicase or molecular motor of the invention may be effective to control the movement of the target polynucleotide through the pore.
Patent CN102216783B discloses a mycobacterium smegmatis porin (Msp) nanopore and sequencing using the nanopore, wherein the 90 or 91 position of wild-type Msp is mutated to increase the conductance of an analyte during sequencing and decrease the translocation speed of the analyte during sequencing.
Patent CN103460040A discloses a mutant Msp monomer and its use in nanopore sequencing. The mutant Msp monomers show greater ability to discriminate between different nucleotides in nanopore sequencing.
However, Mnep monomer variants and their use in sequencing are not mentioned in the prior art, and there are few types of porins available in the prior art for sequencing.
Therefore, the present invention further provides a novel nanopore protein, a Mnep monomer variant is prepared by mutating Mnep monomer wild-type protein that cannot be used for sequencing, and the function of the Mnep monomer variant in sequencing is confirmed.
Disclosure of Invention
The invention proves that the preparation of the Mnep monomer variant with mutation of the specific site of the Mnep mutant protein can be used for nanopore sequencing, but the Mnep monomer wild type does not have the function. In addition, the porin provided by the invention is applied to nanopore sequencing, so that the difference of various nucleotide current signals can be obviously seen, and the nanopore sequencing method has higher sequencing accuracy.
The Mnep is derived from new mycobacterium aurum. Preferably, said "Mnep" is derived from Mycobacterium neoaurum.
Specifically, in a first aspect of the invention, there is provided a Mnep monomer variant comprising SEQ ID NO: 1, position 92-104 or any one or more amino acid mutation.
Preferably, the variant comprises one or a combination of two or more of a mutation of glycine (G) at position 92, a mutation of aspartic acid (D) at position 93, a mutation of glycine (G) at position 95 or a mutation of alanine (a) at position 104.
Further preferably, said variant comprises one of the following mutations:
a: a mutation of glycine (G) at position 92; b: a mutation of aspartic acid (D) at position 93; c: a mutation of glycine (G) at position 95; d: a mutation of alanine (a) at position 104; e: a mutation of glycine (G) at position 92, a mutation of aspartic acid (D) at position 93; f: a mutation of glycine (G) at position 92, a mutation of glycine (G) at position 95; g: a mutation of glycine (G) at position 92, a mutation of alanine (a) at position 104; h: a mutation of aspartic acid (D) at position 93, a mutation of glycine (G) at position 95; i: a mutation of aspartic acid (D) at position 93, a mutation of alanine (a) at position 104; j: a mutation of glycine (G) at position 95 or a mutation of alanine (a) at position 104; k: a mutation of glycine (G) at position 92, a mutation of aspartic acid (D) at position 93, a mutation of glycine (G) at position 95; l: a mutation of glycine (G) at position 92, a mutation of aspartic acid (D) at position 93, a mutation of alanine (a) at position 104; m: a mutation of aspartic acid (D) at position 93, a mutation of glycine (G) at position 95, or a mutation of alanine (A) at position 104.
Most preferably, the variant comprises at least one of the following mutations:
the G92 mutation was: arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, modified arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the D93 mutation was: tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G95 mutation was: proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the a104 mutation is: proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or a modified proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or an unnatural amino acid.
In one embodiment of the invention, the variant comprises at least one of the following mutations:
(1)G92K；(2)D93F；(3)G95L；(4)A104K。
in particular, the variant comprises one of the following mutations:
1)G92K；2)D93F；3)G95L；4)A104K；5)G92K、D93F；6)G92K、G95L；7)G92K、A104K；8)D93F、G95L；9)D93F、A104K；10)G95L、A104K；11)G92K、D93F、G95L；12)G92K、D93F、A104K；13)G92K、G95L、A104K；14)D93F、G95L、A104K；15)G92K、D93F、G95L、A104K。
in one embodiment of the invention, the Mnep monomer variant comprises the mutations G92K, D93F, G95L and a 104K.
Preferably, said Mnep monomer variant further comprises SEQ ID NO: 1, any one or more amino acid mutations at positions 80-91 and/or 105-120.
Further preferably, said Mnep monomer variant further comprises SEQ ID NO: 1, 1-79 and/or 121-191.
Preferably, the variant further comprises one or a combination of two or more of a mutation of aspartic acid (D) at position 125, a mutation of glutamic acid (E) at position 141, a mutation of glutamic acid (E) at position 146, a mutation of glutamic acid (E) at position 110, a mutation of glycine (G) at position 76, a mutation of glycine (G) at position 78, or a mutation of glutamine (Q) at position 133.
Further preferably, said variant comprises at least one of the following mutations:
the D125 mutation is: lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, a modified lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E141 mutation was: lysine (K), asparagine (N) or glutamine (Q), or, a modified lysine (K), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E146 mutation is: arginine (R), asparagine (N) or glutamine (Q), or, a modified arginine (R), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E110 mutation was: phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, a modified phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G76 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G78 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the Q133 mutation is: asparagine (N), serine (S) or threonine (T), or, modified asparagine (N), serine (S) or threonine (T), or, an unnatural amino acid.
In a particular embodiment of the invention, said variant may further comprise at least one of the following mutations:
D125R、E141R、E146K；
D125R、E141R、E146K、E110D；
D125R、E141R、E146K、E110D、G76K、G78K；
D125R、E141R、E146K、E110D、G76K、G78K、Q133A。
the Mnep monomer variants of the present invention may also comprise other mutations in addition to the types of mutations described above, provided that the mutations do not affect the discrimination of the polynucleotides from one another by the pore proteins.
Preferably, the variant may also include mutations that introduce cysteine for the attachment of molecules for sequencing, such as nucleic acid binding proteins and the like.
The Mnep monomer variants described herein may contain only a narrow region fragment sequence of the porin forming domain and retain pore forming activity. Excess residues may be removed or other amino acid residues added, and pore-forming activity retained. The fragment may be at least 12, 20, 40, 50, 100 or 150 amino acids in length.
Preferably, the Mnep monomer variants may be modified to facilitate identification or purification. For example: by adding an aspartic acid residue (asp tag), a streptavidin tag, a flag tag, or a histidine residue (His tag).
Preferably, the Mnep monomer variant may carry a revealing label. For example: fluorescent molecule, radioisotope125I. Radioisotope35S, polynucleotide, biotin, antigen or antibody.
The Mnep monomer variants described herein also include molecular motors. Preferably, the molecular engine is an enzyme. Further preferably, the enzyme is a polymerase, an exonuclease or a Klenow fragment.
In a second aspect of the invention, there is provided a construct comprising at least one Mnep monomer variant according to the invention. Wherein the construct retains the ability to form pores.
Preferably, the construct comprises 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 of said Mnep monomer variants, wherein said Mnep monomer variants are the same or different.
Further preferably, the construct comprises 1-20 Mnep monomer variants, wherein the Mnep monomer variants are the same or different.
In one embodiment of the invention, the construct comprises 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 Mnep monomer variants, wherein the Mnep monomer variants are the same or different.
Preferably, the construct further comprises a Mnep monomer wild type.
Further preferably, the construct comprises 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 Mnep monomer wild-types.
In one embodiment of the invention, the construct comprises 1-20 Mnep monomer wild-types. Specifically 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 Mnep monomer wild-type.
Preferably, the construct comprises 4-10 Mnep monomer variants.
In one embodiment of the invention, the construct comprises 4, 6, 8, 10 Mnep monomer variants.
Preferably, the Mnep monomer variant and the Mnep monomer variant, the Mnep monomer wild type and the Mnep monomer wild type, and the Mnep monomer variant and the Mnep monomer wild type are connected through covalent linkage.
Preferably, the Mnep monomer variant and the Mnep monomer variant, the Mnep monomer wild type and the Mnep monomer wild type, and the Mnep monomer variant and the Mnep monomer wild type are genetically fused.
In a third aspect of the invention, there is provided a porin comprising at least one Mnep monomeric variant comprising the amino acid sequence of SEQ ID NO: 1, any one or more of amino acids 92-104, which mutation(s) results in a difference in intra-pore electrical resistance due to differences in the physical or chemical properties of different kinds of nucleotides when a single-stranded polynucleotide is passed through the porin containing at least one Mnep monomer variant
Preferably, the mutation results in a change in the charge properties or the hydrophobic properties of the amino acid.
Preferably, the difference in electrical resistance is a characteristic that can be used to characterize a polynucleotide, including the source, length, size, molecular weight, identity, sequence, secondary structure, concentration of the polynucleotide, or whether the polynucleotide of interest is modified. Further preferably, the difference in electrical resistance is a sequence feature that can be used to characterize a polynucleotide, i.e., the porin can be used for sequencing to accurately distinguish between different bases of a polynucleotide.
Preferably, the polynucleotide may be naturally occurring or synthetic. Further preferably, the polynucleotide may be a natural DNA, RNA or modified DNA or RNA.
Still further preferably, one or more of the nucleotides in the target polynucleotide may be modified, for example, methylated, oxidised, damaged, abasic, protein tagged, tagged or a spacer attached to the polynucleotide sequence.
Still further preferably, the artificially synthesized nucleic acid is selected from the group consisting of Peptide Nucleic Acid (PNA), Glycerol Nucleic Acid (GNA), Threose Nucleic Acid (TNA), Locked Nucleic Acid (LNA) or other synthetic polymers having nucleoside side chains.
Preferably, the target polynucleotide is single-stranded, double-stranded or at least partially double-stranded. Preferably, the Mnep monomer variant comprises one or a combination of two or more of a mutation of glycine (G) at position 92, a mutation of aspartic acid (D) at position 93, a mutation of glycine (G) at position 95 or a mutation of alanine (a) at position 104.
Further preferably, said Mnep monomer variant comprises at least one of the following mutations:
the G92 mutation was: arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, modified arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the D93 mutation was: tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G95 mutation was: proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the a104 mutation is: proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or a modified proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or an unnatural amino acid.
Still further preferably, said Mnep monomer variant comprises at least one of the following mutations:
(1)G92K；(2)D93F；(3)G95L；(4)A104K。
in one embodiment of the invention, the Mnep monomer variant comprises the mutations G92K, D93F, G95L and a 104K.
Preferably, said Mnep monomer variant further comprises SEQ ID NO: 1, any one or more amino acid mutations at positions 80-91 and/or 105-120.
Further preferably, said Mnep monomer variant further comprises SEQ ID NO: 1, 1-79 and/or 121-191.
Preferably, the Mnep monomer variant further comprises one or a combination of two or more of a mutation of aspartic acid (D) at position 125, a mutation of glutamic acid (E) at position 141, a mutation of glutamic acid (E) at position 146, a mutation of glutamic acid (E) at position 110, a mutation of glycine (G) at position 76, a mutation of glycine (G) at position 78 or a mutation of glutamine (Q) at position 133.
Further preferably, said Mnep monomer variant comprises at least one of the following mutations:
the D125 mutation is: lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, a modified lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E141 mutation was: lysine (K), asparagine (N) or glutamine (Q), or, a modified lysine (K), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E146 mutation is: arginine (R), asparagine (N) or glutamine (Q), or, a modified arginine (R), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E110 mutation was: phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, a modified phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G76 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G78 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the Q133 mutation is: asparagine (N), serine (S) or threonine (T), or, modified asparagine (N), serine (S) or threonine (T), or, an unnatural amino acid.
Preferably, the porin comprises 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 of said Mnep monomer variants, wherein said Mnep monomer variants are the same or different.
More preferably, the porin comprises 1-20 Mnep monomer variants, in particular 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 Mnep monomer variants, wherein said Mnep monomer variants are the same or different.
Preferably, the porin also includes the Mnep monomer wild type.
Further preferably, the porin comprises 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 Mnep monomer wild-types.
Still further preferably, the porin comprises 1-20 Mnep monomer wild-type. Specifically 1, 2,3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 Mnep monomer wild-type.
In one embodiment of the invention, the porin comprises 4 to 10 variants of the same or different Mnep monomers.
In one embodiment of the invention, the porin comprises 4, 6, 8, 10 Mnep monomer variants.
Preferably, the Mnep monomer variant and the Mnep monomer variant, the Mnep monomer wild type and the Mnep monomer wild type, and the Mnep monomer variant and the Mnep monomer wild type are connected through covalent linkage.
Preferably, the Mnep monomer variant and the Mnep monomer variant, the Mnep monomer wild type and the Mnep monomer wild type, and the Mnep monomer variant and the Mnep monomer wild type are genetically fused.
Preferably, the Mnep monomer variants contained in the porin are the same or different. For example: the porin may comprise eight identical or different Mnep monomer variants. Preferably, the porin comprises a Mnep monomeric variant and seven identical monomers, wherein the Mnep monomeric variant is different from the identical monomers. Alternatively, the porin comprises two identical or different Mnep monomer variants and six identical monomers, wherein the Mnep monomer variants are different from the identical monomers. Alternatively, the porin comprises three identical or different Mnep monomer variants and five identical monomers, wherein the Mnep monomer variants are different from the identical monomers. Alternatively, the porin comprises four identical or different Mnep monomer variants and four identical monomers, wherein the Mnep monomer variants are different from the identical monomers. Alternatively, the porin comprises five identical or different Mnep monomeric variants and three identical monomers, wherein the Mnep monomeric variants are different from the identical monomers. Alternatively, the porin comprises six identical or different Mnep monomer variants and two identical monomers, wherein the Mnep monomer variants are different from the identical monomers. Alternatively, the porin comprises seven identical or different Mnep monomeric variants and a monomer, wherein the Mnep monomeric variants are different from a monomer.
Preferably, said porin comprises eight of said Mnep monomer variants, which may be the same or different.
Preferably, the porin may be homologous or heterologous.
Preferably, the diameter of the pore of the porin stenosis region is less than that of the pore of the porin stenosis region
Figure BDA0002275278060000111
Further preferably, the diameter of the pore of the porin stenosis region is less than
Figure BDA0002275278060000112
Even more preferably, the pore diameter of the porin stenosis region is less than
Figure BDA0002275278060000113
Figure BDA0002275278060000114
Or
Figure BDA0002275278060000115
In one embodiment of the invention, the pore diameter of the porin stenosis region is about equal to
Figure BDA0002275278060000116
Preferably, the porin allows hydrated ions to flow from one side of the membrane to another layer of the membrane driven by an applied potential. Wherein the membrane is a bilayer membrane, and more preferably a lipid bilayer membrane.
In a fourth aspect of the invention, there is provided a nucleotide sequence encoding a Mnep monomer variant according to the invention, a porin according to the invention or a construct according to the invention.
Preferably, the nucleotide sequence encoding the Mnep monomer variant has the same nucleotide sequence as SEQ ID NO: 2 or SEQ id no: 11, and encoding a nucleotide sequence of said Mnep monomer variant, having 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9% homology.
In one embodiment of the invention, the nucleotide sequence encoding the Mnep monomer variant is SEQ ID NO: shown at 11.
In a fifth aspect of the invention, there is provided a vector comprising a nucleotide sequence encoding a Mnep monomer variant according to the invention, a porin according to the invention or a construct according to the invention.
Preferably, the vector may be a plasmid, viral or phage vector provided with an origin of replication, optionally a promoter for expression of the nucleotide sequence and optionally regulatory signal genes for the promoter. The vector may contain one or more selectable marker genes, such as a tetracycline resistance gene. Promoters and other expression regulatory signals may be selected to be compatible with the host cell for which the expression vector is designed. The promoter is selected from T7, trc, lac, ara or lambda L promoter.
The Mnep monomer variant can be prepared by chemical synthesis or recombination, and is preferably prepared by recombination.
Preferably, said vector comprises a promoter operably linked to a nucleotide sequence encoding said porin of the present invention, said Mnep monomeric variant or said construct.
Further preferably, the promoter is an inducible promoter or a constitutive promoter, wherein the inducible promoter includes but is not limited to acetamide inducible promoter.
Preferably, the nucleotide sequence encoding a porin protein comprises at least one nucleotide sequence encoding a Mnep monomer variant.
Further preferably, the nucleotide sequence encoding porin also comprises at least one nucleotide sequence encoding the wild-type of the Mnep monomer.
Still further preferably, the nucleotide sequence encoding the Mnep monomer variant and the nucleotide sequence encoding the Mnep monomer variant, the nucleotide sequence encoding the Mnep monomer variant and the nucleotide sequence encoding the wild type of the Mnep monomer, or the nucleotide sequence encoding the wild type of the Mnep monomer and the nucleotide sequence encoding the wild type of the Mnep monomer are linked by an amino acid linker sequence.
In a sixth aspect of the invention, there is provided a mutant bacterium which expresses the Mnep monomer variant, the construct or the porin of the invention, said bacterium comprising: (a) deletion of the Mnep monomer wild type; and (b) a vector according to any one of the present invention.
Preferably, the bacterium comprises a vector comprising a promoter operably linked to a nucleotide sequence encoding a Mnep monomer variant, a construct comprising a Mnep monomer variant, or a porin comprising a Mnep monomer variant.
Further preferably, the Mnep monomer variants include paralogues or homologues of Mnep monomer variants.
Further preferably, the construct comprising the Mnep monomer variant comprises a paralog or homolog construct or monomer of the Mnep monomer variant.
Further preferably, said porin comprising a Mnep monomer variant comprises a paralog or homolog porin or monomer of the Mnep monomer variant.
Preferably, the bacterium may further comprise a vector comprising a promoter operably linked to a nucleotide sequence encoding a Mnep monomer wild-type, a construct comprising a Mnep monomer wild-type, or a porin comprising a Mnep monomer wild-type.
Further preferably, the Mnep monomer wild type comprises a paralog or homolog monomer of the Mnep monomer wild type.
Further preferably, the construct comprising the Mnep monomer wild type is a Mnep monomer wild type paralog or homolog construct or monomer.
Further preferably, the porin comprising the Mnep monomer wild type is a paralog or homolog porin or monomer of the Mnep monomer wild type.
Preferably, the bacterium is mycobacterium neoaurum. Further preferably, the bacterium is a Mycobacterium neoaurum.
In a seventh aspect of the invention, there is provided a method of producing Mnep porin, said method comprising transforming a bacterium of the invention with a vector comprising any of the invention, to induce the bacterium to express Mnep porin.
In an eighth aspect of the invention, there is provided a method of making a Mnep monomer variant, said vector being introducible into a suitable host cell, by inserting said nucleotide sequence encoding said Mnep monomer variant into a vector, introducing said vector into a compatible bacterial host cell and culturing said host cell under conditions permitting expression of said nucleotides to produce said Mnep monomer variant of the invention.
In a ninth aspect of the invention, there is provided a cell comprising said nucleotide sequence or said vector.
More preferably, the cell is a dam + -type strain (e.g., DH5 α strain).
In a tenth aspect of the invention, there is provided a method of characterising a target polynucleotide comprising:
(a) contacting a target polynucleotide with a porin of the present invention such that the target polynucleotide sequence passes through the porin; and
(b) one or more characteristics of nucleotide-porin interactions as a target polynucleotide passes through the porin are obtained to characterize the target polynucleotide.
Preferably, steps (a), (b) are repeated one or more times.
Preferably, the target polynucleotide in step (a) may be conjugated to an enzyme derived from polynucleotide processing to control the translocation speed. Further preferably, the polynucleotide processive enzyme is a polypeptide capable of interacting with a polynucleotide and modifying at least one property thereof. The polynucleotide treatment enzyme may or may not have an enzymatic activity, as long as the enzyme binds to the polynucleotide and controls the translocation speed thereof in the well. Wherein the nucleic acid may be associated with one or more polynucleotide processing enzymes.
Preferably, the polynucleotide processing enzyme is a nucleolytic enzyme. Further preferably, the polynucleotide processing enzyme includes, but is not limited to, a nucleic acid binding protein, helicase, polymerase, reverse transcriptase, transposase, exonuclease, telomerase or topoisomerase.
In one embodiment of the invention, the polynucleotide processing enzyme is a gyrase.
Preferably, step (a) further comprises contacting the polynucleotide of interest with a combination of one or more of a nucleic acid binding protein, helicase, polymerase, reverse transcriptase, transposase, exonuclease, telomerase and/or topoisomerase such that the rate of translocation of the polynucleotide sequence of interest through the pore protein is less than the rate of translocation in the absence of the nucleic acid binding protein, helicase, polymerase, reverse transcriptase, transposase, exonuclease, telomerase and/or topoisomerase.
Further preferably, the nucleic acid binding protein includes, but is not limited to, one or a combination of two or more of modified or wild-type eukaryotic single-chain binding protein, bacterial single-chain binding protein, archaic single-chain binding protein, viral single-chain binding protein, or double-chain binding protein. Such nucleic acid binding proteins include, but are not limited to, SSBEco from Escherichia coli, SSBBhe from Bartonella henselae, SSBCbu from Coxiella burnetii, SSBTma from Thermatharamaritima, SSBHpy from Helicobacter pylori, SSBDra from Deinococcus radiodurans, SSBTaq from Thermus aquaticus, SSBMsmm from Mycobacterium smegmatis, SSBSso from Sulfolobus solfatariticus, SSBS7D from Sulfolobus solfataricus, SSBMHsmt from Homo sapiens, SSBMbmble from Mycopeprereae, SSBS32T 32T4 from Bacillus vitreofaciens, gp 4 from Bacteriophage gp 6757, or Thage 7 from Thage 7. 7.
Further preferably, the helicase may be any one of Hel308 family helicase and modified Hel308 family helicase, RecD helicase and variants thereof, TrwC helicase and variants thereof, Dda helicase and variants thereof, TraI Eco and variants thereof, XPD Mbu and variants thereof.
Further preferably, the polymerase includes, but is not limited to, modified or wild-type DNA polymerase including, but not limited to, Phi29 DNA polymerase, Tts DNA polymerase, M2DNA polymerase, VENT DNA polymerase, T5DNA polymerase, PRD1DNA polymerase, Bst DNA polymerase or REPLI-gscrna polymerase.
Further preferably, the exonuclease includes, but is not limited to, modified or wild exonuclease I from E.coli, exonuclease III from E.coli, bacteriophage lambda exonuclease or RecJ from Thermus thermophilus.
In one embodiment of the present invention, the step (a) comprises contacting the target polynucleotide with a helicase, the helicase is EF8813, and the helicase has the amino acid sequence of SEQ ID NO: 3, the nucleotide sequence of the helicase is SEQ ID NO: 4, respectively. Preferably, the target polynucleotide may be contacted with one or more helicases. Further preferably, the target polynucleotide may be contacted with 2-20 helicases, or even more helicases. Wherein the helicases that bind to the target polynucleotide may be the same or different. And the plurality of helicases bound to the target polynucleotide are covalently linked to each other.
Preferably, the one or more characteristics are selected from the source, length, size, molecular weight, identity, sequence, secondary structure, concentration of the target polynucleotide or whether the target polynucleotide is modified.
In one embodiment of the invention, the features are sequences.
Preferably, said one or more characteristics of step (b) are carried out by electrical and/or optical measurements.
It is further preferred that the electrical and/or optical signal is generated by electrical and/or optical measurement, and that each nucleotide corresponds to a signal level, followed by conversion of the electrical and/or optical signal into a sequence characteristic of the nucleotide.
The electrical measurement of the present invention is selected from the group consisting of a current measurement, an impedance measurement, a Field Effect Transistor (FET) measurement, a tunneling measurement, and a wind tunnel measurement.
The electrical signal according to the present invention is selected from the measurement of current, voltage, tunneling, resistance, potential, conductivity or lateral electrical measurement.
In one embodiment of the invention, the electrical signal is a current passing through the aperture. I.e. the current passes through the pore in a nucleotide specific manner, and the nucleotide is present if a characteristic current associated with the nucleotide is detected to flow through the pore. Otherwise, it is absent. However, for discrimination between similar nucleotides or modified nucleotides, it is determined based on the magnitude of the current.
Preferably, the conductivity generated during polynucleotide characterization using the porins of the present invention is higher than that of wells formed by the wild-type Mnep monomer.
Preferably, the method further comprises the step of applying a potential difference across the porins contacted by the target polynucleotide. Wherein the potential difference is sufficient to translocate the target polynucleotide from the channel of the porin.
Preferably, the target polynucleotide may be natural DNA, RNA or modified DNA or RNA.
The target polynucleotides of the present invention are macromolecules containing one or more nucleotides.
The target polynucleotide of the present invention may be naturally occurring or artificially synthesized. Preferably, one or more of the nucleotides in the target polynucleotide may be modified, for example, methylated, oxidised, damaged, abasic, protein labelled, tagged or linked to a spacer within the polynucleotide sequence. Preferably, the artificially synthesized nucleic acid is selected from Peptide Nucleic Acid (PNA), Glycerol Nucleic Acid (GNA), Threose Nucleic Acid (TNA), Locked Nucleic Acid (LNA), or other synthetic polymers with nucleoside side chains.
Preferably, the porin allows hydrated ions to flow from one side of the membrane to another layer of the membrane driven by an applied potential. Wherein the membrane forms a barrier to ion, nucleotide and nucleic acid flow. More preferably, the membrane is a bilayer membrane, and still more preferably a lipid bilayer membrane. The lipid bilayer membrane includes but is not limited to one or a mixture of more than two of phospholipid, glycolipid, cholesterol and mycolic acid.
Preferably, the porin channel is located between a first conductive liquid medium and a second conductive liquid medium, wherein at least one conductive liquid medium comprises the target polynucleotide, and the first conductive liquid medium and the second conductive liquid medium may be the same or different, provided that the purpose of analyzing one or more characteristics of the target polynucleotide is achieved.
Preferably, the target polynucleotide is single-stranded, double-stranded or at least partially double-stranded.
In one embodiment of the invention, the target polynucleotide is at least partially double-stranded. Wherein the double-stranded portion constitutes a Y adaptor structure comprising a leader sequence that screws preferentially into the porin, the 3' end of the leader sequence being linked to a thiol, biotin or cholesterol for binding to a membrane of a lipid bilayer membrane to point the target polynucleotide in the correct direction and have a pulling effect.
In one embodiment of the present invention, the 3' end of the leader sequence is linked to cholesterol for binding to a membrane of a lipid bilayer membrane.
Adjusting the voltage, salt concentration, buffer, additive or temperature during characterization of the target polynucleotide can control the degree to which the porin of the present invention distinguishes between different nucleotides in characterizing the target polynucleotide. Wherein the additive is selected from DTT, urea or betaine.
Preferably, the voltage range is-250 mV to +250 mV. Further preferably, the voltage is selected from the group consisting of-250 mV, -210mV, -180mV, -140mV, -110mV, -90mV, -70mV, -40mV, 0mV, +40mV, +70mV, +90mV, +110mV, +140mV, +180mV, +210mV, +250 mV.
In one embodiment of the invention, the voltage is between-180 mV and +180 mV.
In one embodiment of the present invention, the method comprises: inserting said porin into a membrane, then contacting the target polynucleotide with said porin, nucleic acid binding protein, polymerase, reverse transcriptase, transposase, exonuclease, topoisomerase, telomerase, or helicase, and applying a potential difference to the porin contacted across the target polynucleotide, such that the target polynucleotide sequence passes through the porin; and
obtaining a current signature of nucleotide-porin interaction of the target polynucleotide through the porin to identify whether the polynucleotide is present, what nucleotide, or modified.
Preferably, the method of inserting the porin into the membrane may be any method known in the art for the purpose of characterizing a polynucleotide. Further preferably, the porin may be suspended in purified form in a solution containing a lipid bilayer such that it diffuses into the lipid bilayer and is inserted into the lipid bilayer by binding to the lipid bilayer and assembling into a functional state.
In an eleventh aspect of the invention, there is provided a use of said Mnep monomer variant, said construct, said nucleotide sequence, said vector, said cell or said porin for characterising a target polynucleotide.
In a twelfth aspect of the invention, a kit for characterizing a target polynucleotide, said kit comprising said Mnep monomer variant, said construct, said nucleotide sequence, said vector, said cell or said porin.
Preferably, said Mnep monomer variant, said construct, said nucleotide sequence, said vector, said cell or said porin may be plural.
Preferably, the kit further comprises one or more of nucleic acid binding protein, reverse transcriptase, transposase, exonuclease, topoisomerase, helicase, telomerase or polymerase, or a combination of two or more thereof.
Preferably, the kit further comprises a lipid bilayer chip, and the porin spans across the lipid bilayer.
Preferably, the kit comprises one or more lipid bilayers, each lipid bilayer comprising one or more of the porins.
Preferably, the kit further comprises reagents or means for performing the characterization of the target polynucleotide. Further preferably, the reagent comprises a buffer and a tool required for PCR amplification.
In a thirteenth aspect of the invention, there is provided a device for characterising a target polynucleotide, said device comprising said Mnep monomer variant, said construct, said nucleotide sequence, said vector, said cell or said porin.
Preferably, the device further comprises one or more of a nucleic acid binding protein, a reverse transcriptase, a transposase, an exonuclease, a topoisomerase, a helicase, a telomerase or a polymerase, or a combination of two or more thereof.
Preferably, the device further comprises a sensor for supporting the porin and for transmitting a signal of the porin's interaction with the polynucleotide, at least one memory for storing the target polynucleotide, and a solution required for performing the characterization process.
Preferably, the device further comprises a patch clamp amplifier and/or a data acquisition device.
In a fourteenth aspect of the present invention, there is provided a sensor for characterising a target polynucleotide, said sensor comprising said Mnep monomer variant, said construct, said nucleotide sequence, said vector, said cell or said porin.
Further preferred are non-natural amino acids including, but not limited to, N-ethylaspartyl, hydroxylysine, 3-hydroxyproline, 2-aminobutyric acid, β -alanine, β -aminopropionic acid, 2-aminoadipic acid, 3-aminoadipic acid, 4-aminobutyric acid, 6-aminocaproic acid, 2-aminoheptanoic acid, allo-isoleucine, isodesmosine, 4-hydroxyproline, allo-hydroxylysine, 2-aminoisobutyric acid, N-methylglycine, N-methylisoleucine, 3-aminoisobutyric acid, 6-N-methyllysine, 2, 4-diaminobutyric acid, N-methylvaline, ornithine, norleucine, desmosine, 2' -diaminopimelic acid, 2, 3-diaminopropionic acid, N-ethylglycine, or 2-aminopimelic acid, and the like.
"modified amino acid … …" according to the present invention is an amino acid having a side chain chemically modified. For example: post-translationally modified amino acids, either with the side chain containing a novel functional group (e.g., sulfhydryl, amino, or carboxyl), or with the side chain containing a signal-generating moiety (e.g., a fluorophore or a radiolabel).
The "diameter of the pore passage in the narrow region" as referred to herein means the diameter of the narrowest part of the cross-section of the inner pore of the porin.
The "nucleotide" of the present invention includes, but is not limited to: adenosine Monophosphate (AMP), Guanosine Monophosphate (GMP), Thymidine Monophosphate (TMP), Uridine Monophosphate (UMP), cytosine nucleoside monophosphate (CMP), cyclic adenosine monophosphate (cAMP), cyclic guanosine monophosphate (cGMP), deoxyadenosine monophosphate (dAMP), deoxyguanosine monophosphate (dggmp), deoxythymidine monophosphate (dTMP), deoxyuridine monophosphate (dUMP), and deoxycytidine monophosphate (dCMP). Preferably, the nucleotide is selected from AMP, TMP, GMP, CMP, UMP, dAMP, dTMP, dGMP or dCMP.
The term "and/or" as used herein includes a list of items in the alternative as well as any number of combinations of items.
The terms "comprises" and "comprising" as used herein are intended to be open-ended terms that specify the presence of the stated elements or steps, and not substantially affect the presence of other stated elements or steps.
The term "about" as used herein is intended to mean the standard deviation permitted by the value and the device or method used to determine the value.
"homology" as used herein means that, in the context of using a protein sequence or a nucleotide sequence, one skilled in the art can adjust the sequence as needed to obtain a sequence having (including but not limited to) 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 11%, 12%, 13%, 14%, 15%, 16%, 17%, 18%, 19%, 20%, 21%, 22%, 23%, 24%, 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 70%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9% sequence identity.
A "Mnep monomer variant" as described herein refers to a Mnep monomer variant that has at least or at most 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, or 99.9% or more identity to Mnep monomer wild type, or can come from any range therebetween, but less than 100% identity and retains the ability to form channels when combined with one or more other Mnep monomer variants or Mnep monomer wild type. Optionally, the Mnep monomer variant is further identified as comprising a mutation in a portion of the sequence that promotes the formation of a narrow region of a fully formed channel-forming porin. The Mnep monomer variant may be, for example, a recombinant protein. The Mnep monomer variant may comprise any of the mutations described herein.
A "paralog or homolog porin of a Mnep monomer variant" as described herein refers to a paralog or homolog porin of a Mnep monomer variant that has at least or at most 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, or 99.9% or more, or can be from any range therebetween, but less than 100% identity to a paralog or homolog porin of a Mnep monomer wild-type, and retains channel-forming ability. Optionally, a paralogue or homolog porin of the Mnep monomer variant is further identified as comprising a mutation in that portion of the sequence that promotes the formation of a narrow region of fully formed channel-forming porin. Paralogues or homologues of Mnep monomer variants porins may for example be recombinant proteins. Paralogs or homolog porins of any Mnep monomer variant may optionally be used in any of the embodiments herein.
A "paralog or homolog construct of a Mnep monomer variant" as described herein refers to a paralog or homolog construct of a Mnep monomer variant that has at least or at most 70, 75, 80, 85, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, or 99.9% or more, or can be from any range therebetween, but less than 100% identity to a paralog or homolog construct of a Mnep monomer variant wild-type of Mnep monomer and retains the ability to form channels. Optionally, paralogs or homolog constructs of the Mnep monomer variants are further identified as comprising a mutation in that portion of the sequence that promotes the formation of a narrow region of the fully formed channel-forming porin. Paralogs or homolog constructs of Mnep monomer variants can be, for example, recombinant proteins. Paralogs or homolog constructs of any of the Mnep monomer variants can optionally be used in any of the embodiments herein.
Drawings
Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:
FIG. 1: a stick MODEL of nanopores containing Mnep monomer variants (G92K/D93F/G95L/A104K) showed amino acid distribution characteristics in the narrow region of the channel, homology modeling was performed by SWISS MODEL, templating pdb position 1 uun.
FIG. 2: a stick MODEL of wild-type Mnep nanopores showing amino acid distribution characteristics in the narrow region of the channel, and homology modeling was performed by SWISS MODEL, template pdb position 1 uun.
FIG. 3: the structural diagram of the test DNA construct X2& cX2-80-15, in which segment a corresponds to the sequence shown in SEQ ID NO: 7, b corresponds to the helicase EF8813-1 (containing the N-terminal histidine tag and its variant protein fused to the TOPV-HI domain, SEQ ID NO: 3-4) which can bind to the segment marked a, segment c corresponds to SEQ ID NO: segment d corresponds to SEQ ID NO: 5, segment e corresponds to SEQ ID NO: 8, which is complementary paired at its 5 ' end with 45 bases to the c-segment region of the test strand, and at its 3 ' end with 40 thymines and a3 ' cholesterol TEG tag corresponding to g, and segment f corresponds to SEQ ID NO: 9.
FIG. 4: the structural diagram of the test DNA construct S1T & S1MC, in which segment a corresponds to SEQ ID NO: 10, b corresponds to helicase EF8813-1 (containing an N-terminal histidine tag and its variant protein fused to a TOPV-HI domain, SEQ ID NO: 3-4) which can bind to the segment labeled a, segment h refers to dspacer retaining only the phosphate backbone, labeled x, segment c corresponds to SEQ ID NO: 12, segment d corresponds to SEQ ID NO: 13, segment e corresponds to SEQ ID NO: 14, which is complementary paired at its 5 ' end by 45 bases to the c-segment region of the test strand, contains 20 thymines at its 3 ' end and a3 ' cholesterol TEG tag corresponding to g, and segment f corresponds to SEQ ID NO: 15.
FIG. 5: and (3) the result of the purification of the Mnep- (G92K/D93F/G95L/A104K) monomer variant protein anion exchange column chromatography. Wherein, Lane 1 is the disrupted whole cell lysate, Lane 2 is the supernatant after centrifugation of the whole cell lysate, Lane 3 is the penetrating component of the anion exchange column, Lanes 4, 5 and 6 are three elution peaks of NaCl linear elution, and the result shows that the second elution peak (the result shown in Lane 5) contains the highest amount of the target protein.
FIG. 6: mnep- (G92K/D93F/G95L/A104K) monomer variant protein molecular sieve exclusion chromatography purification results. Lanes 1-6 show the electrophoresis results of different fractions collected from the molecular sieves.
FIG. 7: single channel behavior at ± 180mV voltage for the Mnep monomer wild-type pore channel, where the y-axis coordinate is current (pA) and the x-axis coordinate is time(s).
FIG. 8: the Mnep- (G92K/D93F/G95L/a104K) monomer variant opens pore current and its gating characteristics at +180mV, 0mV and-180 mV voltages, with current (pA) on the y-axis and time(s) on the x-axis.
FIG. 9: a nanopore comprising a Mnep monomer variant (Mnep- (G92K/D93F/G95L/a104K)) signals nucleic acid passing through the nanopore at a voltage of +180mV, wherein the y-axis coordinate is current (pA) and the x-axis coordinate is time(s).
FIG. 10A: exemplary current trajectories when helicase (EF8813-1) controls translocation of DNA construct X2& cX2-80-15 through a nanopore comprising a Mnep- (G92K/D93F/G95L/a104K) monomeric variant, wherein the y-axis coordinate is current (pA) and the X-axis coordinate is time(s); fig. 10B and 10C show the enlarged results of the current trace in the partial region of fig. 10A.
FIG. 11: fig. A, B, C, D, E, F is a plot of the results of different segments of an exemplary current trajectory when helicase (EF8813-1) controls translocation of DNA construct X2& cX2-80-15 through a nanopore comprising a Mnep- (G92K/D93F/G95L/a104K) monomeric variant, respectively, where the y-axis coordinate is current (pA) and the X-axis coordinate is time(s).
FIG. 12A: an exemplary current trace when helicase (EF8813-1) controls translocation of DNA construct S1T & S1MC through a nanopore containing a Mnep- (G92K/D93F/G95L/a104K) monomeric variant, fig. 12B, C is an enlargement of the current trace of the partial region of fig. 12A, and the maximum of the current indicated by the arrow in fig. 12C shows the characteristic peak of dspacer, where the y-axis coordinate of the two traces is current (pA) and the x-axis coordinate is time (S).
Detailed Description
The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only some embodiments of the present invention, and not all embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.
Example 1 preparation of Mnep monomer variants
First, construction of plasmid
The Mnep monomer variant protein sequence is optimized by codons of corresponding amino acids, proper restriction enzyme cutting sites are added at two ends of the gene, specifically, an NcoI site ccatgg is added at the 5 'end, an xhoI site ctcgag is added at the 3' end, then, the gene synthesis is carried out, and the synthesized gene is cloned into an expression vector pET24 b.
Secondly, site-directed mutagenesis of the target gene to prepare the Mnep monomer variant nucleotide sequence
The induced mutation gene (PCR reaction) takes the plasmid to be mutated as a template, and uses the designed primer and KOD plus high fidelity enzyme to carry out PCR amplification reaction to induce the mutation of the target gene.
The method comprises the following specific steps:
1. a point mutation primer was designed, a template plasmid DNA (plasmid DNA containing SEQ ID NO: 2) was prepared, amplification was performed in a 50. mu. LPCR reaction system, DH5 α strain was used as a host strain, the number of clones was often low in the end + -type strain, but the mutation efficiency was not affected.
Point mutation primer:
SEQ ID NO：16
CCACCCCGAATGTGGCACTGAGTAAATTTCCGCTGTTTGGCATTACCGGCATTGGCGGCAAACTGCCGGTGATTGGCGAAATTG
SEQ ID NO：17
CAATTTCGCCAATCACCGGCAGTTTGCCGCCAATGCCGGTAATGCCAAACAGCGGAAATTTACTCAGTGCCACATTCGGGGTGG
50 μ L PCR reaction:
Figure BDA0002275278060000231
PCR amplification reaction
Cycle temperature reaction time:
Figure BDA0002275278060000232
the PCR amplification reaction was completed to obtain the Mnep monomer variant nucleotide sequence (SEQ ID NO: 11), ice-washed for 5min, and then left at room temperature (to avoid repeated freeze-thawing).
2. Template digestion and extraction of Mnep monomer variant gene
After the completion of the PCR reaction, the methylated plasmid was digested with DpnI enzyme to select a mutant plasmid DNA (plasmid containing SEQ ID NO: 11). PCR reaction products were prepared. The method comprises the following specific steps: mu.L (10U/. mu.L) of DpnI enzyme was added and incubated at 37 ℃ for 2 hours. (when the amount of plasmid DNA used is too large, the reaction with the sample may be incomplete; if the mutation rate is low, the reaction time may be prolonged appropriately or the amount of the DpnI enzyme used may be increased.)
3. Transforming to obtain a strain containing the Mnep monomer variant gene
DH5 α was selected when plasmid DNA was transformed into E.coli by creating a gap in plasmid DNA after the reaction was completed, and specifically the procedure was to add 4. mu.L of mutant plasmid DNA sample to 50. mu.L of DH5 α competent cells, then place on ice for 30min, heat shock 90s at 42 ℃, immediately ice-wash for 2min, add 500. mu.L of SOC medium to culture for 1 hour at 37 ℃ and finally apply 100. mu.L of bacterial suspension to the resistant selection plate.
4. Sequencing validation
And 4 transformants are selected for culturing and sequencing, and positive transformants with correct mutation are selected for extracting plasmids and storing for later use.
Preparation of Mnep monomer variants
The Mnep monomer variant plasmid with correct sequencing verification is transferred into BL21(DE3) for cultivation. Then purifying the protein, wherein the formula of the reagent for purifying the protein is shown in the table 1.
12 μ L of Mnep-K0 BL21(DE3) glycerol was pipetted into 12mL (1: 1000) of fresh LB medium containing 50mg/mL kanamycin at a final concentration and activated overnight at 37 ℃ with shaking at 200 rpm; the next day, the cells were expanded to 2L of LB medium containing 50mg/mL final concentration of kanamycin at 1% inoculum size. After culturing at 37 ℃ and 220rpm until OD600 is 0.6-0.8, the temperature of the ice bath is rapidly reduced, IPTG (isopropyl thiogalactoside) is added to the culture system to a final concentration of 1mM, and expression is induced at 220rpm at 18 ℃ overnight.
The next day, 6000rpm, centrifugation at 4 ℃ for 15min, and collecting the thalli according to the ratio of the thalli: lysis buffer 1: resuspending the cells at a ratio of 10(m/v), adding a mixed protease inhibitor, and crushing under high pressure until the cells become clear.
Adding 1% of OPOE (octyl phenol polyoxyethylene ether) and 0.1% of FC12 (N-dodecyl choline phosphate), and stirring and solubilizing for 1-2 h at room temperature. And (3) treating the solubilized lysate in a boiling water bath for 20min, immediately carrying out ice bath for 60min, adding PEI (polyetherimide) with the final concentration of 0.3%, fully mixing uniformly, standing on ice for 5min, carrying out 14000rpm, centrifuging at 4 ℃ for 30min, and collecting the supernatant.
The supernatant was filtered through a 0.45 μ M filter and purified by an anion exchange column equilibrated with Buffer B, the supernatant was passed through the column at a flow rate of 5mL/min, followed by elution of the hetero-proteins with Buffer B, and finally, by linear gradient elution with Buffer C at a salt concentration of 0-1M, and the eluted fractions were collected. The anion exchange column purification results are shown in FIG. 5.
Concentrating the collected elution sample by using a 100kDa ultrafiltration tube, centrifuging at 14000rpm and 4 ℃ for 20min, and keeping the supernatant; taking a proper amount of concentrated supernatant to perform molecular exclusion chromatography, balancing 2 column volumes by using SEC Buffer in advance, loading, concentrating and performing SDS-PAGE gel electrophoresis detection. The results of size exclusion chromatography are shown in FIG. 6.
TABLE 1 formulation of reagents for protein purification
Figure BDA0002275278060000251
Example 2 preparation of porins
1. 12 μ L of Mnep-K0 BL21(DE3) glycerol was pipetted into 12mL (1: 1000) of fresh LB medium containing 50mg/mL kanamycin at a final concentration and activated overnight at 37 ℃ with shaking at 200 rpm; the next day, the cells were expanded to 2L of LB medium containing 50mg/mL final concentration of kanamycin at 1% inoculum size. Cultured at 37 ℃ and 220rpm to OD600After rapidly lowering the temperature in the ice bath after 0.6 to 0.8, IPTG was added to the culture system to a final concentration of 1mM, and expression was induced overnight at 18 ℃ and 220 rpm.
2. The next day, 6000rpm, centrifugation at 4 ℃ for 15min, and collecting the thalli according to the ratio of the thalli: lysis buffer 1: resuspending the cells at a ratio of 10(m/v), adding a mixed protease inhibitor, and crushing under high pressure until the cells become clear.
3. 1% OPOE and 0.1% FC12 were added, and the mixture was solubilized by stirring at room temperature for 1 to 2 hours.
4. Treating the solubilized cleavage product in a boiling water bath for 20min, immediately carrying out ice-bath for 60min, adding PEI with the final concentration of 0.3%, fully mixing uniformly, standing on ice for 5min, carrying out centrifugation at 14000rpm at 4 ℃ for 30min, and collecting the supernatant;
5. the supernatant was filtered through a 0.45 μ M filter and purified by an anion exchange column equilibrated with Buffer B, the supernatant was passed through the column at a flow rate of 5mL/min, followed by elution of the hetero-proteins with Buffer B, and finally, by linear gradient elution with Buffer C at a salt concentration of 0-1M, and the eluted fractions were collected.
6. Concentrating the collected elution sample by using a 100kDa ultrafiltration tube, centrifuging at 14000rpm and 4 ℃ for 20min, and keeping the supernatant; taking a proper amount of concentrated supernatant to perform molecular exclusion chromatography, balancing 2 column volumes by using SEC Buffer in advance, loading, concentrating and performing SDS-PAGE gel electrophoresis detection.
Example 3 sequencing applications of porins
In buffer (400mM KCl, 10mM HEPES pH 8.0, 50mM MgCl)2) In (3), a single nanopore is inserted into a phospholipid bilayer and electrical measurements are obtained from the single nanopore.
The method comprises the following specific steps:
in SEQ ID NO in which the amino acid sequence was mutated G92K/D93F/G95L/A104K: 1 (Mnep-K0 nanopore, stick model shown in FIG. 1) into the phospholipid bilayer, buffer (400mM KCl, 10mM HEPES pH 8.0, 50mM MgCl2) Flow through the system to remove any excess Mnep-K0 nanopores. DNA construct X2&cX2-80-15 or S1T&S1MC (1-2 nM final concentration) was added to the Mnep-K0 nanopore assay system, mixed well, and buffered (400mM KCl, 10mM HEPES pH 8.0, 50mM MgCl)2) Flow through the system to remove any excess DNA construct X2&cX2-80-15 or S1T&S1 MC. A pre-mix of helicase (EF8813-1, 15nM final concentration), fuel (ATP3mM final concentration) was then added to the single Mnep-K0 nanopore assay system and sequencing of Mnep-K0 pore proteins was monitored at +180mV voltage.
The control group was identical to the above procedure except that the Mnep-K0 nanopores were replaced with wild-type Mnep nanopores (the stick-surface potential model is shown in figure 2). Wherein, the stick model of the wild type Mnep nanopore shows the amino acid distribution characteristics of the narrow area of the channel. Wherein the key amino acid residues in the narrow region of the pore canal mainly comprise serine at position 91, glycine at position 92, aspartic acid at position 93 and 110 positioned in the folded loop regionGlutamic acid of (1). The diameters of the narrow regions formed by S91 and E110 are respectively
Figure BDA0002275278060000272
And
Figure BDA0002275278060000271
in contrast to wild-type Mnep nanopores, the rod-surface potential model of nanopores containing Mnep monomer variants (rod-surface potential model shown in fig. 1) shows the amino acid distribution characteristics of the narrowed region of mutant channel, wherein the key amino acid residue distribution of the narrowed region of mutant channel is lysine at position 92 pointing to the amino acid residue at the center of the channel, and the diameter of the channel is about
Figure BDA0002275278060000273
The phenylalanine at position 93 and the leucine side chain at position 95 swing to the outer side of the pore canal and participate in strengthening hydrophobic accumulation acting force for stabilizing the narrow area of the pore canal, and the lysine at position 104 is probably closely related to the correct assembly of the channel compound.
Wherein, the specific sequence of X2& cX2-80-15 (the specific structure is shown in figure 3) is as follows:
X2：
TGGTTTTTGTTTGTTTTTAGAATTTTTTTACACTACCACTGCTAGCATTTTTCA(SEQ ID NO：5)
TTTCTCACTATCCCGTTCTCATTGGTGCACCATCTTTTTTTGGTT(SEQ ID NO：6)
TTTTTGCAGCAGCAT(SEQ ID NO：7)
cX2-80-15：
AACCAAAAAAAGATGGTGCACCAATGAGAACGGGATAGTGAGAAA(SEQ ID NO：8)
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT(SEQ ID NO：9)
the specific sequence of S1T & S1MC (the specific structure is shown in FIG. 4) is as follows:
S1T：
TTTTTTTTTTTTTTCCTTCC(SEQ ID NO：10)
x (sector h)
TTCTTTTCCCGTCCGCTCGT(SEQ ID NO：12)
TCGCGCCTGTCTGCTTGTTTTTTTTTTTCTTTTTTTTTTTCTCACTATCGCATTCTCATGCAGGTCGGTGGTCGCAGTA(SEQ ID NO：13)
S1MC：
ACGAGCGGACGGGAAAAGAA(SEQ ID NO：14)
TTTTTTTTTTTTTTTTTTTT(SEQ ID NO：15)
The sequencing results are shown in fig. 7-12, wherein fig. 7 shows the single-channel behavior characteristics of the wild-type Mnep nanopore channel at a voltage of +/-180 mV, the full-open current of the wild-type channel in the test system under the condition of +180mV is about 347pA, the gating is obvious, and the full-open current under the condition of-180 mV is larger, is close to-450 pA, and the gating is stronger. Obviously, the wild-type channel can not meet the requirements of the nanopore protein and can not complete the sequencing purpose.
FIG. 8 shows the opening current and its gating characteristics for the Mnep- (G92K/D93F/G95L/A104K) monomer variant at +180mV, 0mV and-180 mV, and the results show that the mutant channel has no positive gating, and the full opening current is about 180pA at +180mV in the test system, and the gating is stronger at negative voltage. FIG. 9 shows the signal of a nucleic acid passing through a nanopore at +180mV of nanopore Mnep- (G92K/D93F/G95L/A104K) voltage.
Exemplary current traces when helicase (EF8813-1) controls translocation of DNA construct X2& cX2-80-15 through a nanopore comprising Mnep- (G92K/D93F/G95L/A104K) monomeric variants (see FIG. 10A, B, C).
Exemplary current traces when helicase (EF8813-1) controls translocation of DNA construct X2& cX2-80-15 through a nanopore comprising a Mnep- (G92K/D93F/G95L/A104K) monomeric variant (see FIG. 11A, B, C, D, E, F).
Exemplary current traces when helicase (EF8813-1) controlled translocation of DNA construct S1T & S1MC through mutant Mnep- (G92K/D93F/G95L/A104K) nanopores (see FIG. 12A, B, C).
The preferred embodiments of the present invention have been described in detail, however, the present invention is not limited to the specific details of the above embodiments, and various simple modifications may be made to the technical solution of the present invention within the technical idea of the present invention, and these simple modifications are within the protective scope of the present invention.
It should be noted that the various technical features described in the above embodiments can be combined in any suitable manner without contradiction, and the invention is not described in any way for the possible combinations in order to avoid unnecessary repetition.
Figure BDA0002275278060000291
Figure BDA0002275278060000301
Figure BDA0002275278060000311
Figure BDA0002275278060000321
Figure BDA0002275278060000331
Figure BDA0002275278060000341
Figure BDA0002275278060000351
Figure BDA0002275278060000361
Figure BDA0002275278060000371
Figure BDA0002275278060000381
Figure BDA0002275278060000391
Figure BDA0002275278060000401
Figure BDA0002275278060000411
Figure BDA0002275278060000421
Figure BDA0002275278060000431
Figure BDA0002275278060000441
Figure BDA0002275278060000451
Figure BDA0002275278060000461
Figure BDA0002275278060000471
Figure BDA0002275278060000481
Figure BDA0002275278060000491
Figure BDA0002275278060000501
Figure BDA0002275278060000511
Sequence listing
<110> Beijing Qicarbo science and technology Co., Ltd
<120> Mnep monomer variant and application thereof
<160>17
<170>SIPOSequenceListing 1.0
<210>1
<211>191
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>1
Met Gly Leu Asp Asn Glu Leu Ser Leu Val Asp Gly Lys Asp Arg Thr
1 5 10 15
Leu Thr Ile Gln Gln Trp Asp Thr Phe Leu Asn Gly Val Phe Pro Leu
20 25 30
Asp Arg Asn Arg Leu Thr Arg Glu Trp Phe His Ser Gly Lys Ala Lys
35 40 45
Tyr Ile Val Ser Gly Pro Gly Ala Glu Asp Phe Glu Gly Ala Leu Glu
50 55 60
Leu Gly Tyr Gln Val Gly Phe Pro Trp Ser Leu Gly Val Gly Ile Asn
65 70 75 80
Phe Ser Tyr Thr Thr Pro Asn Val Ala Leu Ser Lys Phe Pro Leu Phe
85 90 95
Gly Ile Thr Gly Ile Gly Gly Lys Leu Pro Val Ile Gly Glu Ile Ala
100 105 110
Thr Pro ProLeu Phe Pro Gly Ala Ser Ile Ser Ala Asp Leu Gly Asn
115 120 125
Gly Pro Gly Ile Gln Glu Val Ala Thr Phe Ser Thr Glu Val Ala Gly
130 135 140
Pro Glu Gly Ala Val Ala Val Ser Asn Ala His Gly Thr Val Thr Gly
145 150 155 160
Ala Ala Gly Gly Val Leu Leu Arg Pro Phe Ala Arg Leu Val Ser Ser
165 170 175
Leu Gly Asp Ser Val Thr Thr Tyr Gly Glu Pro Trp Asn Met Asn
180 185 190
<210>2
<211>576
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>2
atgggcttag ataacgaact gtctttagtg gatggcaaag atcgcacttt aaccattcag 60
cagtgggaca cctttctgaa cggtgtgttt ccgctggatc gcaaccgttt aacccgcgag 120
tggtttcaca gcggcaaagc caaatatatt gtgagcggcc cgggtgcaga agactttgaa 180
ggcgtgctgg agctgggcta tcaagttggt tttccgtgga gtctgggcgt gggcatcaac 240
tttagctaca ccaccccgaa tgtggcactg agtaaatttc cgctgtttgg cattaccggc 300
attggcggca aactgccggt gattggcgaa attgcaaccc cgccgctgtt tccgggtgca 360
agcattagcg ccgatttagg taacggtccg ggcattcaag aagttgccac ctttagcacc 420
gaagtggctg gtccggaagg tgccgttgcc gtgagcaatg ctcatggcac tgtgactggt 480
gccgctggtg gcgttttact gcgcccgttt gcccgtttag tgagcagtct gggtgatagc 540
gtgaccacct atggcgaacc gtggaatatg aactaa 576
<210>3
<211>863
<212>PRT
<213> Artificial Sequence (Artificial Sequence)
<400>3
Met Gly Ser Ser His His His His His His Ser Ser Gly Leu Val Pro
1 5 10 15
Arg Gly Ser His Met Lys Ile Glu Ser Leu Asp Leu Pro Asp Glu Val
20 25 30
Lys Gln Phe Tyr Leu Asp Ser Gly Ile Leu Glu Leu Tyr Pro Pro Gln
35 40 45
Ala Glu Ala Val Glu Lys Gly Leu Leu Glu Gly Arg Asn Leu Leu Ala
50 55 60
Ala Ile Pro Thr Ala Ser Gly Lys Thr Leu Leu Ala Glu Leu Ala Met
65 70 75 80
Leu Lys Ser Ile Leu Asn Gly Gly Lys Ala Leu Tyr Ile Val Pro Leu
85 90 95
Arg Ala Leu Ala Ser Glu Lys Phe Lys Arg Phe Arg Glu Phe Ser Lys
100 105110
Leu Gly Ile Arg Val Gly Ile Ser Thr Gly Asp Tyr Asp Leu Arg Asp
115 120 125
Glu Gly Leu Gly Val Asn Asp Ile Ile Val Ala Thr Ser Glu Lys Thr
130 135 140
Asp Ser Leu Leu Arg Asn Glu Thr Val Trp Met Gln Glu Ile Ser Val
145 150 155 160
Val Val Ala Asp Glu Val His Leu Ile Asp Ser Pro Asp Arg Gly Pro
165 170 175
Thr Leu Glu Ile Thr Leu Ala Lys Leu Arg Lys Met Asn Pro Ser Cys
180 185 190
Gln Ile Leu Ala Leu Ser Ala Thr Ile Gly Asn Ala Asp Glu Leu Ala
195 200 205
Ala Trp Leu Glu Ala Gly Leu Val Leu Ser Glu Trp Arg Pro Thr Glu
210 215 220
Leu Arg Glu Gly Val Phe Phe Asn Gly Thr Phe Tyr Cys Lys Asp Arg
225 230 235 240
Glu Lys Ser Ile Glu Gln Ser Thr Lys Asp Glu Ala Val Asn Leu Val
245 250 255
Leu Asp Thr Leu Arg Glu Asp Gly Gln Cys Leu Val Phe Glu Asn Ser
260 265270
Arg Lys Asn Cys Met Ala Phe Ala Lys Lys Ala Ser Ser Ala Val Lys
275 280 285
Lys Ile Leu Ser Ala Glu Asp Lys Glu Ala Leu Ala Glu Ile Ala Asp
290 295 300
Glu Val Leu Glu Asn Ser Glu Thr Asp Thr Ser Ala Ala Leu Ala Ala
305 310 315 320
Cys Ile Arg Ser Gly Thr Ala Phe His His Ala Gly Leu Thr Thr Pro
325 330 335
Leu Arg Glu Leu Val Glu Asp Gly Phe Arg Ala Gly Lys Ile Lys Leu
340 345 350
Ile Ser Ser Thr Pro Thr Leu Ala Ala Gly Leu Asn Leu Pro Ala Arg
355 360 365
Arg Val Val Ile Arg Ser Tyr Arg Arg Tyr Ser Ser Glu Asp Gly Met
370 375 380
Gln Pro Ile Pro Val Ile Glu Tyr Lys Gln Met Ala Gly Arg Ala Gly
385 390 395 400
Arg Pro Arg Leu Asp Pro Tyr Gly Glu Ala Val Leu Val Ala Lys Ser
405 410 415
Tyr Glu Glu Phe Val Phe Leu Phe Arg Asn Tyr Ile Glu Ala Asp Ala
420 425430
Glu Asp Ile Trp Ser Lys Leu Gly Thr Glu Asn Ala Leu Arg Thr His
435 440 445
Val Leu Ser Thr Ile Ser Asn Gly Phe Ala Arg Thr Lys Glu Glu Leu
450 455 460
Met Glu Phe Leu Glu Ala Thr Phe Phe Ala Phe Gln Tyr Ser Asn Phe
465 470 475 480
Gly Leu Ser Thr Val Val Asp Glu Cys Leu Asn Phe Leu Arg Gln Glu
485 490 495
Glu Met Leu Glu Lys Thr Asp Thr Leu Ile Ser Thr Ser Phe Gly Lys
500 505 510
Leu Val Ser Lys Leu Tyr Ile Asp Pro Leu Ser Ala Ala Arg Ile Val
515 520 525
Lys Gly Leu Lys Glu Ala Lys Ile Leu Thr Glu Leu Thr Leu Leu His
530 535 540
Leu Val Cys Ser Thr Pro Asp Met Arg Leu Leu Tyr Met Arg Asn Gln
545 550 555 560
Asp Tyr Gln Asp Ile Asn Asp Tyr Val Ile Ala His Ala Asp Glu Phe
565 570 575
Val Arg Val Pro Ser Pro Phe Asn Tyr Thr Glu Tyr Glu Trp Phe Leu
580 585 590
Gly Glu Val Lys Thr Ser Leu Leu Leu Val Asp Trp Ile His Glu Lys
595 600 605
Ser Glu Asn Glu Ile Cys Leu Lys Phe Gly Ile Gly Glu Gly Asp Ile
610 615 620
His Ala Ile Ala Asp Ile Ala Glu Trp Leu Met His Val Thr Ala Gln
625 630 635 640
Leu Ala Arg Leu Leu Glu Leu Lys Gly Ala Lys Glu Ala Ala Glu Leu
645 650 655
Glu Lys Arg Ile His Tyr Gly Ala Ser Pro Glu Leu Met Asp Leu Leu
660 665 670
Asp Ile Arg Gly Ile Gly Arg Met Arg Ala Arg Lys Leu Tyr Glu Ser
675 680 685
Gly Phe Arg Ser Ser Ala Glu Leu Ala Gly Ala Asp Pro Val Lys Val
690 695 700
Ala Ala Leu Leu Gly Pro Lys Ile Ala Asp Arg Ile Phe Lys Gln Ile
705 710 715 720
Gly Arg Arg Glu Val Leu Pro Glu Ile Ala Glu Pro Thr Leu Pro Glu
725 730 735
Lys Ser Pro Ser Ser Gly Gln Lys Thr Ile Asn Asp Tyr Gly Thr Gly
740 745 750
Gly Gly Gly Ser Trp Lys Glu Trp Leu Glu Arg Lys Val Gly Glu Gly
755 760 765
Arg Ala Arg Arg Leu Ile Glu Tyr Phe Gly Ser Ala Gly Glu Val Gly
770 775 780
Lys Leu Val Glu Asn Ala Glu Val Ser Lys Leu Leu Glu Val Pro Gly
785 790 795 800
Ile Gly Asp Glu Ala Val Ala Arg Leu Val Pro Gly Tyr Lys Thr Leu
805 810 815
Arg Asp Ala Gly Leu Thr Pro Ala Glu Ala Glu Arg Val Leu Lys Arg
820 825 830
Tyr Gly Ser Val Ser Lys Val Gln Glu Gly Ala Thr Pro Asp Glu Leu
835 840 845
Arg Glu Leu Gly Leu Gly Asp Ala Lys Ile Ala Arg Ile Leu Gly
850 855 860
<210>4
<211>2592
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>4
atgggcagca gccatcatca tcatcatcac agcagcggcc tggtgccgcg cggcagccat 60
atgaagatcg aaagcctgga cctgccggac gaagttaaac agttttacct ggatagcggt 120
attttagaac tgtacccgcc gcaggcagaa gcagtagaaa aaggcctgtt agaaggacgt 180
aatctgctgg cagcaattcc gaccgcaagc ggtaagacac tgctggctga attagcaatg 240
ctgaaaagca tactgaatgg gggaaaagca ctgtatattg ttccgctgag agcactggca 300
tcagaaaaat ttaaacgttt tagagagttc agcaagttag gtataagagt gggtattagc 360
acaggagact atgacctgag agatgaaggt ctgggtgtta atgatattat tgtggcaaca 420
agcgaaaaaa ccgatagcct gctgcgtaat gaaaccgttt ggatgcagga aattagcgtt 480
gttgttgcag atgaagttca tctgattgat agcccggatc gtggtccgac cctggaaatt 540
accctggcaa aactgcgtaa aatgaatccg agctgtcaga ttctggcact gagcgcaacc 600
attggtaatg cagatgaact ggcagcatgg ctggaagcag gtctggttct gagcgaatgg 660
cgtccgaccg aactgcgtga aggtgttttt tttaatggta cattttattg taaagatcgt 720
gaaaaaagca ttgaacagag caccaaagat gaagcagtta atctggttct ggataccctg 780
cgtgaagatg gtcagtgtct ggtttttgaa aatagccgta aaaattgtat ggcatttgca 840
aaaaaagcaa gcagcgcagt taaaaaaatt ctgagcgcag aagataaaga agcactggca 900
gaaattgcag atgaagttct ggaaaatagc gaaaccgata ccagcgcagc actggcagca 960
tgtattcgta gcggtacagc atttcatcat gcaggtctga ccaccccgct gcgtgaactg 1020
gttgaagatg gttttcgtgc aggtaaaatt aaactgatta gcagcacccc gaccctggca 1080
gcaggtctga atctgccggc acgtcgtgtt gttattcgta gctatcgtcg ttatagcagc 1140
gaagatggta tgcagccgat tccggttatt gaatataaac agatggcagg tcgtgcaggt 1200
cgtccgcgtc tggaccctta tggtgaagca gttctggttg caaaaagcta tgaagaattt 1260
gtttttctgt ttcgtaatta tattgaagca gatgcagaag atatttggag caaactgggt 1320
acagaaaatg cactgcgtac ccatgttctg agcaccatta gcaatggttt tgcacgtacc 1380
aaagaagaac tgatggaatt tctggaagca accttttttg catttcagta tagcaatttt 1440
ggtctgagca ccgttgttga tgaatgtctg aattttctgc gtcaggaaga aatgctggaa 1500
aaaaccgata ccctgattag caccagcttt ggtaaactgg ttagcaaact gtatattgat 1560
ccgctgagcg cagcacgtat tgttaaaggt ctgaaagaag caaaaattct gaccgaactg 1620
accctgctgc atctggtttg tagcaccccg gatatgcgtc tgctgtatat gcgtaatcag 1680
gattatcagg atattaatga ttatgttatt gcacatgcag atgaatttgt tcgtgttccg 1740
agcccgttta attataccga atatgaatgg tttctgggtg aagttaaaac cagcctgctg 1800
ctggttgatt ggattcatga aaaaagcgaa aatgaaattt gtctgaaatt tggtattggt 1860
gaaggtgata ttcatgcaat tgcagatatt gcagaatggc tgatgcatgt taccgcacag 1920
ctggcacgtc tgctggaact gaaaggtgca aaagaagcag cagaactgga aaaacgtatt 1980
cattatggtg caagcccgga actgatggat ctgctggata ttcgtggtat tggtcgtatg 2040
cgtgcacgta aactgtatga aagcggtttt cgtagcagcg cagaactggc aggtgcagat 2100
ccggttaaag ttgcagcact gctgggtccg aaaattgcag atcgtatttt taaacagatt 2160
ggtcgtcgtg aagttctgcc ggaaattgca gaaccgaccc tgccggaaaa aagcccgagc 2220
agcggtcaga aaaccattaa tgattatggt accggtggag gcggttcctg gaaggaatgg 2280
ctggagcgta aggttggcga gggccgtgcg cgtcgcctga tcgagtattt cggcagcgcg 2340
ggtgaggttg gcaaattggt cgagaatgcg gaagtcagca aattgctgga agttccgggt 2400
atcggcgacg aggctgtggc tcgcctggtg ccgggttata agaccctgcg cgatgccggt 2460
ctgaccccgg cagaagcaga gcgcgtgctg aagcgctacg gcagcgtcag caaagtgcag 2520
gaaggcgcaa cgccggacga attgcgcgag ttaggtctgg gcgacgccaa gattgcccgc 2580
attctgggtt aa 2592
<210>5
<211>54
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>5
tggtttttgt ttgtttttag aattttttta cactaccact gctagcattt ttca 54
<210>6
<211>45
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>6
tttctcacta tcccgttctc attggtgcac catctttttt tggtt 45
<210>7
<211>15
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>7
tttttgcagc agcat 15
<210>8
<211>45
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>8
aaccaaaaaa agatggtgca ccaatgagaa cgggatagtg agaaa 45
<210>9
<211>40
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>9
tttttttttt tttttttttt tttttttttt tttttttttt 40
<210>10
<211>20
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>10
tttttttttt ttttccttcc 20
<210>11
<211>576
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>11
atgggcttag ataacgaact gtctttagtg gatggcaaag atcgcacttt aaccattcag 60
cagtgggaca cctttctgaa cggtgtgttt ccgctggatc gcaaccgttt aacccgcgag 120
tggtttcaca gcggcaaagc caaatatatt gtgagcggcc cgggtgcaga agactttgaa 180
ggcgtgctgg agctgggcta tcaagttggt tttccgtgga gtctgggcgt gggcatcaac 240
tttagctaca ccaccccgaa tgtggcactg agtaaatttc cgctgtttgg cattaccggc 300
attggcggca aactgccggt gattggcgaa attgcaaccc cgccgctgtt tccgggtgca 360
agcattagcg ccgatttagg taacggtccg ggcattcaag aagttgccac ctttagcacc 420
gaagtggctg gtccggaagg tgccgttgcc gtgagcaatg ctcatggcac tgtgactggt 480
gccgctggtg gcgttttact gcgcccgttt gcccgtttag tgagcagtct gggtgatagc 540
gtgaccacct atggcgaacc gtggaatatg aactaa 576
<210>12
<211>20
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>12
ttcttttccc gtccgctcgt 20
<210>13
<211>79
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>13
tcgcgcctgt ctgcttgttt ttttttttct tttttttttt ctcactatcg cattctcatg 60
caggtcggtg gtcgcagta 79
<210>14
<211>20
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>14
acgagcggac gggaaaagaa 20
<210>15
<211>20
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>15
tttttttttt tttttttttt 20
<210>16
<211>84
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>16
ccaccccgaa tgtggcactg agtaaatttc cgctgtttgg cattaccggc attggcggca 60
aactgccggt gattggcgaa attg 84
<210>17
<211>84
<212>DNA/RNA
<213> Artificial Sequence (Artificial Sequence)
<400>17
caatttcgcc aatcaccggc agtttgccgc caatgccggt aatgccaaac agcggaaatt 60
tactcagtgc cacattcggg gtgg 84

Claims (45)

1. A Mnep monomer variant, characterized in that said Mnep monomer variant comprises SEQ ID NO: 1, position 92-104 or any one or more amino acid mutation.
2. The Mnep monomer variant according to claim 1, wherein the Mnep monomer variant comprises one or more of a mutation of glycine (G) at position 92, a mutation of aspartic acid (D) at position 93, a mutation of glycine (G) at position 95 or a mutation of alanine (a) at position 104.
3. The Mnep monomer variant according to claim 1 or 2, comprising at least one of the following mutations:
the G92 mutation was: arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, modified arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the D93 mutation was: tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G95 mutation was: proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the a104 mutation is: proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or a modified proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or an unnatural amino acid.
4. The Mnep monomer variant according to any one of claims 1 to 3, comprising at least one of the following mutations:
(1)G92K；(2)D93F；(3)G95L；(4)A104K。
5. the Mnep monomer variant according to any one of claims 1 to 4, wherein the Mnep monomer variant comprises the mutations G92K, D93F, G95L and A104K.
6. The Mnep monomer variant according to any one of claims 1 to 5, further comprising the amino acid sequence of SEQ ID NO: 1, any one or more amino acid mutations at positions 80-91 and/or 105-120.
7. The Mnep monomer variant according to any one of claims 1 to 6, further comprising the amino acid sequence of SEQ ID NO: 1, 1-79 and/or 121-191.
8. The Mnep monomer variant according to any one of claims 1 to 7, further comprising one or a combination of two or more of a mutation of aspartic acid (D) at position 125, a mutation of glutamic acid (E) at position 141, a mutation of glutamic acid (E) at position 146, a mutation of glutamic acid (E) at position 110, a mutation of glycine (G) at position 76, a mutation of glycine (G) at position 78, or a mutation of glutamine (Q) at position 133.
9. The Mnep monomer variant according to any one of claims 1 to 8, comprising at least one of the following mutations:
the D125 mutation is: lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, a modified lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E141 mutation was: lysine (K), asparagine (N) or glutamine (Q), or, a modified lysine (K), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E146 mutation is: arginine (R), asparagine (N) or glutamine (Q), or, a modified arginine (R), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E110 mutation was: phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, a modified phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G76 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G78 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the Q133 mutation is: asparagine (N), serine (S) or threonine (T), or, modified asparagine (N), serine (S) or threonine (T), or, an unnatural amino acid.
10. A construct comprising at least one Mnep monomer variant according to any one of claims 1 to 9.
11. The construct of claim 10, further comprising a Mnep monomer wild type.
12. The construct of claim 10 or 11, comprising 1-20 Mnep monomer variants, wherein said Mnep monomer variants are the same or different; alternatively, the construct comprises 1-20 Mnep monomer wild-type.
13. The construct of claim 11 or 12, wherein the Mnep monomer variant and Mnep monomer variant, Mnep monomer wild type and Mnep monomer wild type, Mnep monomer variant and Mnep monomer wild type are linked by covalent bond.
14. The construct of any one of claims 10 to 13, comprising 4 to 10 variants of the same or different Mnep monomers.
15. A porin comprising at least one Mnep monomeric variant, said Mnep monomeric variant comprising the amino acid sequence of SEQ ID NO: 1, position 92-104, said mutation resulting in a difference in intra-pore electrical resistance due to differences in the physical or chemical properties of different species of nucleotides when a single polynucleotide strand is passed through said porin containing at least one Mnep monomer variant.
16. The porin of claim 15, wherein said Mnep monomer variant comprises one or a combination of two or more of a glycine (G) mutation at position 92, an aspartic acid (D) mutation at position 93, a glycine (G) mutation at position 95, or an alanine (a) mutation at position 104.
17. The porin of claim 15 or 16, wherein said Mnep monomeric variant comprises at least one of the following mutations:
the G92 mutation was: arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, modified arginine (R), glutamine (Q), lysine (K), phenylalanine (F), serine (S), asparagine (N), cysteine (C), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the D93 mutation was: tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified tryptophan (W), tyrosine (Y), phenylalanine (F), methionine (M), isoleucine (I), leucine (L), valine (V), proline (P), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G95 mutation was: proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, modified proline (P), tryptophan (W), phenylalanine (F), methionine (M), alanine (a), isoleucine (I), leucine (L), valine (V), lysine (K), arginine (R), glutamine (Q) or asparagine (N), or, alternatively, an unnatural amino acid; alternatively, the first and second electrodes may be,
the a104 mutation is: proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or a modified proline (P), phenylalanine (F), isoleucine (I), leucine (L), valine (V), lysine (K), or arginine (R), or an unnatural amino acid.
18. The porin of any of claims 15 to 17, wherein said Mnep monomeric variant comprises at least one of the following mutations:
(1)G92K；(2)D93F；(3)G95L；(4)A104K。
19. the porin of any of claims 15 to 18, wherein said Mnep monomeric variant comprises the mutations G92K, D93F, G95L and a 104K.
20. The porin of any of claims 15 to 19, wherein said Mnep monomeric variant further comprises SEQ ID NO: 1, any one or more amino acid mutations at positions 80-91 and/or 105-120.
21. The porin of any of claims 15 to 20, wherein said Mnep monomeric variant further comprises SEQ ID NO: 1, 1-79 and/or 121-191.
22. The porin of any of claims 15-21, wherein said Mnep monomeric variant further comprises one or a combination of two or more of a mutation at aspartic acid (D) 125, a mutation at glutamic acid (E) 141, a mutation at glutamic acid (E) 146, a mutation at glutamic acid (E) 110, a mutation at glycine (G) 76, a mutation at glycine (G) 78, or a mutation at glutamine (Q) 133.
23. The porin of any of claims 15 to 22, wherein said Mnep monomeric variant comprises at least one of the following mutations:
the D125 mutation is: lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, a modified lysine (K), glutamine (Q), cysteine (C) or asparagine (N), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E141 mutation was: lysine (K), asparagine (N) or glutamine (Q), or, a modified lysine (K), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E146 mutation is: arginine (R), asparagine (N) or glutamine (Q), or, a modified arginine (R), asparagine (N) or glutamine (Q), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the E110 mutation was: phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, a modified phenylalanine (F), valine (V), isoleucine (I), leucine (L), alanine (a), or tyrosine (Y), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G76 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the G78 mutation was: serine (S), threonine (T) or arginine (R), or, a modified serine (S), threonine (T) or arginine (R), or, an unnatural amino acid; alternatively, the first and second electrodes may be,
the Q133 mutation is: asparagine (N), serine (S) or threonine (T), or, modified asparagine (N), serine (S) or threonine (T), or, an unnatural amino acid.
24. The porin of any of claims 15 to 23, wherein said porin comprises between 1 and 20 Mnep monomer variants, wherein said Mnep monomer variants are the same or different.
25. The porin of any one of claims 15 to 24, wherein said porin comprises a Mnep monomer wild-type.
26. The porin of any of claims 15 to 25, wherein said porin comprises between 1 and 20 Mnep monomer wild-type forms.
27. The porin of any of claims 15 to 26, wherein said porin comprises between 4 and 10 variants of the same or different Mnep monomer.
28. The porin of any of claims 15 to 27, wherein said Mnep monomer variant is covalently linked to said Mnep monomer variant, said Mnep monomer wild-type and said Mnep monomer wild-type, said Mnep monomer variant and said Mnep monomer wild-type.
29. The porin of any one of claims 15 to 28, wherein said porin has a narrow pore diameter less than
Figure FDA0002275278050000061
Preferably, the pore diameter of the narrow region of the porin is smaller than that of the narrow region of the porin
Figure FDA0002275278050000062
30. A nucleotide sequence encoding a Mnep monomer variant according to any one of claims 1 to 9, a construct according to any one of claims 10 to 14 or a porin according to any one of claims 15 to 29.
31. A vector comprising the nucleotide sequence of claim 30.
32. The vector according to claim 31, comprising a promoter operably linked to a Mnep monomer variant according to any one of claims 1 to 9 or a construct according to any one of claims 10 to 14 or a nucleotide sequence encoding a porin according to any one of claims 15 to 29.
33. The vector of claim 32, wherein said promoter is an inducible promoter or a constitutive promoter, and wherein said inducible promoter is an acetamide-inducible promoter.
34. The vector according to any one of claims 31 to 33, wherein the nucleotide sequence encoding a porin protein comprises a nucleotide sequence encoding a Mnep monomer variant.
35. The vector according to claim 34, wherein the nucleotide sequence encoding a porin protein further comprises at least one nucleotide sequence encoding a Mnep monomer variant and/or a Mnep monomer wild-type.
36. The vector of claim 35, wherein the nucleotide sequence encoding the Mnep monomer variant is linked to the nucleotide sequence encoding the Mnep monomer variant, or to the nucleotide sequence encoding the Mnep monomer wild-type, by an amino acid linker encoding sequence.
37. A mutant bacterium which expresses a Mnep monomer variant according to any one of claims 1 to 9, a construct according to any one of claims 10 to 14 or a porin according to any one of claims 15 to 29, said bacterium comprising:
(a) deletion of the Mnep monomer wild type; and (b) the vector of any one of claims 31-36.
38. The mutant bacterium of claim 37, wherein said bacterium is mycobacterium neoaureum.
39. A method of producing Mnep porin comprising transforming a bacterium according to any one of claims 37 to 38 with a vector comprising any one of claims 31 to 36, and inducing the bacterium to express Mnep porin.
40. A method of characterizing a target polynucleotide, comprising:
(a) contacting a polynucleotide of interest with a porin of any one of claims 15-29, such that the polynucleotide sequence of interest passes through the porin; and
(b) one or more characteristics of nucleotide-porin interactions as a target polynucleotide passes through the porin are obtained to characterize the target polynucleotide.
41. A method according to claim 40 wherein step (a) further comprises the step of contacting the target polynucleotide with a combination of one or more of a nucleic acid binding protein, helicase, polymerase, reverse transcriptase, transposase, exonuclease, telomerase and/or topoisomerase such that the translocation velocity of the target polynucleotide sequence through the pore protein is less than the translocation velocity in the absence of the nucleic acid binding protein, helicase, polymerase, reverse transcriptase, transposase, exonuclease, telomerase and/or topoisomerase.
42. A method according to claim 40 or 41 further comprising the step of applying a potential difference across the porins contacted by the target polynucleotide.
43. Use of a porin as claimed in any one of claims 15 to 29, a Mnep monomer variant as claimed in any one of claims 1 to 9, a construct as claimed in any one of claims 10 to 14, a nucleotide sequence as claimed in claim 30, a vector as claimed in any one of claims 31 to 36 or a mutant bacterium as claimed in any one of claims 37 to 38 for characterising a target polynucleotide.
44. A kit for characterising a target polynucleotide, the kit comprising a porin of any one of claims 15 to 29, a Mnep monomer variant of any one of claims 1 to 9, a construct of any one of claims 10 to 14, a nucleotide sequence of claim 30, a vector of any one of claims 31 to 36 or a mutant bacterium of any one of claims 37 to 38.
45. A device for characterising a target polynucleotide, comprising a porin of any one of claims 15 to 29, a Mnep monomer variant of any one of claims 1 to 9, a construct of any one of claims 10 to 14, a nucleotide sequence of claim 30, a vector of any one of claims 31 to 36 or a mutant bacterium of any one of claims 37 to 38.
CN201980002444.XA 2019-09-29 2019-09-30 Mnep monomer variant and application thereof Active CN111164097B (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
CN201910936954 2019-09-29
CN2019109369546 2019-09-29
PCT/CN2019/109333 WO2021056599A1 (en) 2019-09-29 2019-09-30 Mnep monomer variant and application thereof

Publications (2)

Publication Number Publication Date
CN111164097A true CN111164097A (en) 2020-05-15
CN111164097B CN111164097B (en) 2021-02-19

Family

ID=70562376

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201980002444.XA Active CN111164097B (en) 2019-09-29 2019-09-30 Mnep monomer variant and application thereof

Country Status (4)

Country Link
EP (1) EP4036106A4 (en)
CN (1) CN111164097B (en)
IL (1) IL291788A (en)
ZA (1) ZA202203568B (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113480620A (en) * 2021-08-18 2021-10-08 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof
CN113651876A (en) * 2021-08-18 2021-11-16 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof
CN113773373A (en) * 2021-10-12 2021-12-10 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof
CN113896776A (en) * 2021-10-12 2022-01-07 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof

Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102216783A (en) * 2008-09-22 2011-10-12 华盛顿大学 Msp nanopores and related methods
CN103460040A (en) * 2011-02-11 2013-12-18 牛津纳米孔技术有限公司 Mutant pores
WO2015166275A1 (en) * 2014-05-02 2015-11-05 Oxford Nanopore Technologies Limited Mutant pores
CN107109489A (en) * 2014-10-17 2017-08-29 牛津纳米孔技术公司 Nano-pore RNA characterizing methods
CN108699540A (en) * 2016-02-29 2018-10-23 吉尼亚科技公司 Polymerase-template composite for nano-pore sequencing
US20190017990A1 (en) * 2015-12-01 2019-01-17 Purdue Research Foundation Proteoliposome and production method thereof
CN109312401A (en) * 2016-05-25 2019-02-05 牛津纳米孔技术公司 The nano-pore sequencing method of the nucleic acid of connection

Patent Citations (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102216783A (en) * 2008-09-22 2011-10-12 华盛顿大学 Msp nanopores and related methods
CN103460040A (en) * 2011-02-11 2013-12-18 牛津纳米孔技术有限公司 Mutant pores
WO2015166275A1 (en) * 2014-05-02 2015-11-05 Oxford Nanopore Technologies Limited Mutant pores
CN107109489A (en) * 2014-10-17 2017-08-29 牛津纳米孔技术公司 Nano-pore RNA characterizing methods
US20190017990A1 (en) * 2015-12-01 2019-01-17 Purdue Research Foundation Proteoliposome and production method thereof
CN108699540A (en) * 2016-02-29 2018-10-23 吉尼亚科技公司 Polymerase-template composite for nano-pore sequencing
CN109312401A (en) * 2016-05-25 2019-02-05 牛津纳米孔技术公司 The nano-pore sequencing method of the nucleic acid of connection

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113480620A (en) * 2021-08-18 2021-10-08 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof
CN113651876A (en) * 2021-08-18 2021-11-16 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof
CN113651876B (en) * 2021-08-18 2024-02-02 成都齐碳科技有限公司 Mutant of porin monomer, protein hole and application thereof
CN113480620B (en) * 2021-08-18 2024-02-06 成都齐碳科技有限公司 Mutant of porin monomer, protein hole and application thereof
CN113773373A (en) * 2021-10-12 2021-12-10 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof
CN113896776A (en) * 2021-10-12 2022-01-07 成都齐碳科技有限公司 Mutant of porin monomer, protein pore and application thereof
CN113896776B (en) * 2021-10-12 2024-02-06 成都齐碳科技有限公司 Mutant of porin monomer, protein hole and application thereof
CN113773373B (en) * 2021-10-12 2024-02-06 成都齐碳科技有限公司 Mutant of porin monomer, protein hole and application thereof

Also Published As

Publication number Publication date
EP4036106A1 (en) 2022-08-03
ZA202203568B (en) 2023-02-22
CN111164097B (en) 2021-02-19
EP4036106A4 (en) 2024-01-17
IL291788A (en) 2022-07-01

Similar Documents

Publication Publication Date Title
CN111164097B (en) Mnep monomer variant and application thereof
CN111164096B (en) Mmup monomer variant and application thereof
EP3619224B1 (en) Transmembrane pore consisting of two csgg pores
CN108699138B (en) Abrupt change hole
CN106459159B (en) Abrupt change hole
JP7027334B2 (en) Alpha hemolysin variants and their use
ES2843099T3 (en) Biological nanopores for detection and sequencing of biopolymers based on actinoporin FraC
US7960312B2 (en) Method and agent for immobilizing protein via protein bound to silicon oxide-containing substance
JP7499761B2 (en) pore
CN109022387B (en) Mutant Pfu DNA polymerase and preparation method and application thereof
JP2019525911A (en) Long-life alpha hemolysin nanopore
CN112500459B (en) Aerolysin mutant nanopore and application thereof in molecular biological detection
EP3955002A1 (en) Method for controlling speed of polypeptide passing through nanopore, and application thereof
JP4355830B2 (en) Novel DNA replication factor
WO2021056599A1 (en) Mnep monomer variant and application thereof
WO2021056598A1 (en) Mmup monomer variant and application thereof
Kumar et al. Purification of Lac repressor protein using polymer displacement and immobilization of the protein
US12024541B2 (en) Transmembrane pore consisting of two CsgG pores
WO2024138664A1 (en) Nucleic acid ligase and use thereof
WO2023019471A1 (en) Mutant of porin monomer, protein pore and application thereof
CN118086286A (en) DNA-peptide conjugate, ARCFU-like helicase and application thereof in detecting peptide fragments
CN117384867A (en) Modified Cas3 translocation enzyme and application thereof
Palmer et al. The Design and Preparation of a Model Spectrin Protein: βII-Spectrin L2079P
JPH01252289A (en) Methionine enkephalin

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
EE01 Entry into force of recordation of patent licensing contract
EE01 Entry into force of recordation of patent licensing contract

Application publication date: 20200515

Assignee: Chengdu Qicarbon Taike Biotechnology Co.,Ltd.

Assignor: QITAN TECHNOLOGY Ltd. BEIJING

Contract record no.: X2023980041526

Denomination of invention: A Mnep Monomer Variant and Its Application

Granted publication date: 20210219

License type: Common License

Record date: 20230911