CN1111599C - Choline monooxidase gene and method for culturing drought-and salinity-resistant plant - Google Patents

Abstract

The present invention provides a novel mountainous spinach choline hydroxide single oxide enzyme, a gene encoding the enzyme, a plant expression vector containing the gene and a method for cultivating plants with salt resistance and drought resistance. The gene of the present invention can be used for cultivating the plants with salt resistance and drought resistance.

Description

Choline single oxygenase gene and the method for cultivating drought-enduring salt-tolerant plants

The present invention relates to choline single oxygenase, the gene of this enzyme of encoding contains the plant expression vector of this gene and the method for cultivating the drought-enduring plant of salt tolerant.

Arid and salt damage are the major causes that causes crop failure, and cultivating drought-enduring salt tolerant crop is one of major objective of breeding.Trimethyl-glycine is a kind of plant Osmolyte regulator.In plant, its biosynthesizing relates to 2 enzymes: choline single oxygenase (CMO) and betaine-aldehyde dehydrogenase (BADH).CMO participates in the reaction of the trimethyl-glycine synthetic the first step, arid and saline and alkaline expression of inducing this enzyme.Prunella asiatica (Atriplex hortensis) is a kind of salt-tolerant plant, the contriver has cloned the CMO gene cDNA and has made up and has been applicable to list respectively from prunella asiatica, the expression vector of dicotyledons, transformation mode plant tobacco, transgene tobacco have tangible high-salt tolerance and high drought tolerance.

An object of the present invention is to provide a kind of choline single oxygenase with stronger drought-resistant and anti-saline and alkaline effect, this kind of enzyme derives from prunella asiatica (Atriplex hortensis).Its aminoacid sequence is shown in Fig. 1.

Another object of the present invention provides a kind of gene of the choline single oxygenase of the present invention of encoding.In a preferred embodiment, described gene has nucleotide sequence as shown in Figure 1.

A further object of the present invention provides a kind of method of cultivating salt tolerant anti-morning of plant, and this method comprises the gene constructed plant expression vector with choline single oxygenase of the present invention; With the plant expression vector transformed plant cells that makes up; The plant transformed cell culture is become plant.

Another purpose of the present invention provides a kind of expression carrier that contains said choline single oxygenase.Can use any expression vector that can guide foreign gene in plant, to express.These plant expression vectors include, but not limited to the double base agrobacterium vector, for example Bin 19 (Bevan, M., 1984, nucleic acids research 12:8711-8721) and the carrier that is used for the monocotyledons micropellet bombardment.Carrier can also comprise 3 ' untranslated zone.3 ' untranslated zone is meant a kind of part of gene, but it contain a kind of comprise the polyadenylic acid signal and any other effect mRNA processing or the dna fragmentation of genetic expression.Polyadenylic acid signal guidance polyadenylic acid joins 3 ' end of mRNA precursor.The example in 3 ' zone comprises and contains Agrobacterium tumor inducing (Ti) plasmid gene (for example rouge alkali synthetase (Nos gene)); and 3 ' the untranslated zone of transcribing of plant gene (for example soybean storage protein plasmagene and ribulose-1,5-bisphosphate, the little subunit gene of 5-bisphosphate carboxylase (ssRUBISCO)).3 ' untranslated zone of choline single oxygenase of the present invention can be used to express in plant.

Carrier of the present invention also can contain suitable promotor.Can use any strong promoter in the present invention.These promotors include but not limited to cauliflower mosaic virus (CAMV 35S).It can use separately or be used in combination with other plant promoter.

Expression vector of the present invention also can comprise enhanser when needed, no matter be translational enhancer or transcriptional enhancer.These enhanser zones include but not limited to ATG initiator codon and neighboring region.Initiator codon must with the reading frame homophase of encoding sequence, to guarantee the translation of whole sequence.The translation control signal can be multiple different source with initiator codon, can be natural or synthetic.Translation initiation region can be from the transcription initiation zone, or from structure gene.

For the ease of the evaluation of plant transformed cell, can carry out further genetically engineered operation to comprise the alternative mark of plant to carrier of the present invention.Spendable selected marker comprises the enzyme to antibiotics resistance, and microbiotic comprises gentamicin, Totomycin, kantlex etc.Equally, can use the enzyme that can produce the compound of discerning by colour-change (for example GUS (β-glucuronidase)) or luminous (for example luciferase).

Expression vector of the present invention can be by using Ti-plasmids, Ri plasmid, plant viral vector, directly DNA conversion, microinjection, importing such as electroporation vegetable cell.To the summary of these technology referring to Weissbach and Weissbach, molecular biology of plants method (Method for Plantmolecular Biology), Academy Press, New York VIII, pp.421-463 (1988); With Geiserson and Corey, molecular biology of plants (Plant Molecular Biology), second edition (1988).

Can use method plant transformed host of the present invention to comprise monocotyledons and dicotyledons, corn for example, barley, wheat, paddy rice, rye, oat, tobacco etc.

Brief Description Of Drawings:

Fig. 1 is prunella asiatica CMO (AhCMO) gene complete sequence and amino acid sequence coded, ^*Expression mature polypeptide initial amino acid,  represents Rieske-Type[2F _e-2S] the conservative Cys-His of bunch land is right, Represent the conservative amino acid residues of many iron atom nuclears in conjunction with the territory.Fig. 2 is illustrated in the Northern analytical results that 2%NaCl salt solution induces AhCMO genetic expression in the spinach blade, before handling, handles back sampling in the time of 1,2,3 and 4 day, and the 18S rRNA results of hybridization of total RNA is as interior mark.

Fig. 3 represents to change AhCMO tobacco 1# and to growth conditions contrast in the saliferous MS substratum that impinges upon 0.9% (A), 1.2% (B, C), 1.5% (D, E) NaCl, A, B, D are 1 ^#, C, E are contrast.

Fig. 4 represents to change AhCMO tobacco 1-4# and to impinging upon growth conditions contrast in the MS substratum that contains 10%PEG-6000, A, B, C, D are 1-4 ^#, E is contrast.

Fig. 5 represents to change the Northern checking result of AhCMO genetic tobacco.Three swimming lanes from left to right are followed successively by contrast (CK), untreated transgene tobacco 1 ^#(-), 1.2%NaCl handle the transgene tobacco 1 of a day (+) ^#, the 18S rRNA results of hybridization of total RNA is as interior mark.Fig. 6 represents the Southern analytical results of prunella asiatica genomic dna, and B is BamHI, and D is DraI, and E is EcoRI, and H is HindIII.

Embodiment one. prunella asiatica cDNA library construction and AhCMO cDNA clone, AhCMO expression of gene 1. prunella asiatica cDNA library constructions and AhCMO cDNA clone, evaluation under sequential analysis and the environment stress

The prunella asiatica kind is in basin, after 50 days, to contain the pouring of 2.0%NaCl solution.The cDNA library construction is undertaken by Sambrook (1987) method.Collecting fresh blade 1g grinds in liquid nitrogen, be suspended from the 4mol/L sulphur hydracid guanidine, the acid phenol of mixture, the chloroform extracting adds dehydrated alcohol and precipitates total RNA in the supernatant, precipitate through 4mol/L LiCl suspension RNA again, the chloroform extracting once, use sodium acetate/ethanol sedimentation RNA then, afterwards, water-soluble.Handle through the mRNA purification kit, obtain mRNA.Get 2ug mRNA and carry out reverse transcription reaction, and then carry out two chains and synthesize.Double-stranded cDNA is connected the back phosphorylation with the EcoRI joint, (Sephacryl-400) removes unnecessary joint through the preparative centrifugation post, is connected with the dephosphorization pExcell carrier (Pharmacia) that enzyme is cut then, gets 5ul and connects product adding packaging protein, builds up the cDNA library.

Spinach CMO cDNA with the contriver clone is that probe has screened 2.5 * 10 ⁵The spot that do not increase obtains 37 positive spots, and it inserts fragment is 1.77Kb.The cloned sequence order-checking adopts Taq DyePrimer Cycle Sequencing test kit (Amersham) to carry out on ABI377 type automatic sequencer.This fragment comprises the opening code-reading frame of a 1314bp, the polypeptide that coding is made up of 438 amino acid, and its 5 ' end is 136bp, 3 ' end is 314bp.Prunella asiatica AhCMO cDNA complete sequence and aminoacid sequence are seen Fig. 1.2. the active relation with environment-stress of prunella asiatica AhCMO

Handled prunella asiatica continuously 4 days with 2.0%NaCl solution,, collected blade in 3 and 4 days, extract RNA and do the Northern analysis respectively 1,2.The result shows that AhCMO expression of gene amount increased with the time of salt stress.The expression amount of handling 4 days is about 4 times before handling.Therefore, the AhCMO gene is to be subjected to salt inductive (Fig. 2).The structure and the agrobacterium mediation converted of two .AhCMO gene plant expression plasmids

The structure of AhCMO cDNA plant expression vector carries out according to a conventional method.Binary expression vector pBI121 contains the Q fragment of 35S promoter and translational enhancer TMV.AhCMO cDNA skewer after EcoRI and SalI enzyme are cut is gone into pBI121.The plant expression vector that contains 35S promoter that the obtains aseptic tobacco leaf that Agrobacterium AGL1 will about 5mm size of directly transduceing immerses respectively in the AGL1 agrobacterium liquid of 5 times of dilutions, take out behind about 30min, be placed on the aseptic filter paper, bacterium liquid is removed in suction, (the MS minimum medium contains 1mg/6-BA, cultivates altogether in 0.1mg/LIAA) and changes screening and culturing (MS2 contains the plain and 600mg/L cephamycin of that enzyme of 100mg/L card) after 3 days over to be seeded in the MS2 substratum.Contrast is infected with the Agrobacterium that contains pBI121, obtains changeing 7 of the plant of AhCMO gene altogether.Standby with every 6 of breeding of asexual culture technique.Three. the salt tolerance of transfer-gen plant and drought tolerance are measured

Transfer-gen plant is contained 0,0.9,1.2 with contrasting all to be transplanted to respectively, continued growth in the MS substratum of 1.5% NaCl and 10%PEG-6000, under 0.9% and 1.2% salt concn, 7 transgenic lines all grow fine, the contrast of transfer simultaneously is yellow leaf then, cessation of growth cessation; Under 1.5% salt concn, transfer-gen plant and contrast all can not normal growth, yellow leaf and death (Fig. 3).7 strain transfer-gen plants all grow fine in 10%PEG-6000, and here contrast withers cessation of growth cessation (Fig. 4).Four. the Molecular Identification of transfer-gen plant

Northern analyzes and carries out routinely, the results are shown in Fig. 5.Five analyses of .AhCMO gene in the prunella asiatica genome

The total DNA of prunella asiatica is through BamHI, and DraI behind the complete enzymolysis of EcoRI and HindIII is that probe is made Southern and analyzed with AhCMOcDNA, owing to do not contain BamHI and DraI point of contact among the AhCMO cDNA, contains each 1 point of contact of EcoRI and HindIII.Only detect 1 hybrid belt when the BamHI enzyme is cut, illustrate that the AhCMO gene only contains 1 copy in the prunella asiatica genome.Other enzymes have many hybrid belt hints when cutting: contain a plurality of introns (Fig. 6) in the full gene of AhCMO.

Claims (9)

1.,：M A A S A T T M L L K Y P T T V C G I P N S S A 24N N S T D P S N N I V Q I P Q T T T T N S P L L 48K F R T P N K P V N A V A A P A F P S V T T T T 72T T T P S S I Q S L V K D F D P L V P A E D A L 96T P P S S W Y T E P A F Y A H E L D R I F Y K G 120W Q V A G Y S D Q V K E A N Q Y F T G T L G N V 144E Y L V C R D G E G K V H A F H N V C T H R A S 168I L A C G S G K K S C F V C P Y H G W V Y G M N 192G S L T K A S K A T P E Q S L N P D E L G L V P 216L K V A V W G P F I L I S L D R S S R E V G D V 240G S E W L G S C A E D V K A H A F D P N L Q F I 264N R S E F P I E S N W K I F S D N Y L D S S Y H 288V P Y A H K Y Y A T E L D F D T Y Q T D M V G N 312V T I Q R V A G T S N N G F N R L G T Q A F Y A 336F A Y P N F A V E R Y G P W M T T M H I V P L G 360P R K C K L V V D Y Y I E K S K L D D K D Y I E 384K G I A I N D N V Q K E D V V L C E S V Q K G L 408E T P A Y R S G R Y V M P I E K G I H H F H C W 432L H Q V L K * 438。

2. the gene of the choline single oxygenase of the claim 1 of encoding.

3. according to the described gene of claim 2, it has nucleotide sequence as follows:

atacaggcctcgagggccgaattccgttgctgtcgattgttgatcattcatctcatcacctcct 64tatatattatattaaaataaattaataaatattaacaaggaagtgtttaagtttgttgatcatacaacaatc 136ATGGCAGCAAGTGCAACAACAATGTTGCTAAAATACCCAACTACTGTTTGTGGAATACCAAATTCATCCGCA 208AACAATTCTACTGATCCTTCAAATAACATCGTCCAAATTCCACAAACTACTACTACTAATAGCCCGCTACTT 280AAGTTCCGTACTCCTAATAAACCCGTTAACGCCGTCGCTGCCCCGGCTTTTCCGTCCGTAACCACCACTACA 352ACCACCACTCCGTCGTCCATCCAATCACTTGTCAAGGATTTCGATCCTCTTGTTCCGGCCGAGGATGCTCTT 424ACTCCTCCTAGCTCTTGGTATACCGAACCTGCCTTCTATGCTCATGAACTTGACCGTATCTTTTACAAAGGA 496TGGCAAGTCGCAGGGTACAGTGATCAAGTTAAGGAGGCTAACCAATATTTCACCGGAACGTTAGGAAATGTT 568GAATATTTGGTGTGTCGAGATGGAGAAGGAAAAGTTCATGCATTTCACAATGTTTGCACCCATCGTGCATCT 640ATCCTTGCTTGTGGAAGTGGCAAAAAGTCATGTTTCGTATGCCCTTATCATGGATGGGTATATGGCATGAAT 712GGATCGCTTACGAAAGCTTCAAAAGCAACACCAGAACAATCACTAAATCCCGATGAACTTGGGCTTGTACCA 784CTAAAAGTTGCAGTATGGGGCCCATTTATACTCATCAGTTTGGACAGATCAAGCCGTGAAGTAGGTGACGTT 856GGATCTGAATGGCTTGGTAGTTGTGCTGAAGATGTTAAGGCCCATGCTTTTGACCCGAATCTTCAGTTCATT 928AATAGGAGTGAATTTCCAATTGAATCTAATTGGAAGATTTTCAGTGACAACTATTTGGATAGCTCTTACCAT 1000GTTCCTTATGCACACAAATACTATGCAACTGAGCTCGACTTTGATACTTACCAAACCGATATGGTTGGAAAT 1072GTCACGATTCAAAGGGTGGCTGGGACTTCAAACAATGGTTTTAATAGACTTGGAACTCAAGCCTTCTATGCT 1144TTTGCATACCCTAACTTTGCTGTGGAAAGGTATGGCCCTTGGATGACTACAATGCATATTGTTCCATTAGGA 1216CCAAGGAAATGCAAACTAGTGGTGGACTACTATATTGAAAAATCAAAGCTGGACGACAAGGATTACATCGAA 1288AAGGGCATAGCAATCAATGATAATGTGCAGAAAGAAGATGTGGTGTTGTGTGAAAGCGTCCAAAAAGGGTTG 1360GAGACACCAGCATATCGTAGTGGAAGATATGTGATGCCAATTGAGAAAGGAATTCACCATTTCCACTGCTGG 1432TTACACCAAGTGTTGAAGTGAttgcacccagattatatgtaatcttggtttctttccttctatgattggata 1504ttataataagtaaaattataatgtcatcatttagttgagattgttgttagagttgagcttatgctcattagt 1576aacgtgtgtatgtgtgtatgtgtttggtcatggtaaaaaatgtttgttattgctagaattttataataatag 1648tatggtgctgatgtccagtataaataaagaacatagcacccctttccctacttaagaaattatattccatat 1720attttcaggggaactatgagattgtctatgaacaaaaaaaaaaaaaa 1767?。

4. plant expression vector that contains claim 2 or 3 described choline single oxygenase genes.

5. a method of cultivating the drought-enduring plant of salt tolerant comprises the gene constructed plant expression vector with claim 2 or 3 described choline single oxygenases; With the plant expression vector transformed plant cells that makes up; The plant transformed cell culture is become plant.

6. in accordance with the method for claim 5, wherein said plant expression vector is the double base agrobacterium vector.

7. in accordance with the method for claim 5, wherein said conversion is undertaken by agriculture bacillus mediated or particle bombardment.

8. in accordance with the method for claim 5, wherein said plant is monocotyledons or dicotyledons.

9. in accordance with the method for claim 5, wherein said plant is a tobacco.

Images