CN111154785A - Method for modifying ubiquitin and inhibiting ubiquitination pathway - Google Patents

Abstract

The invention discloses a method for modifying ubiquitin and inhibiting ubiquitination pathway. This modification is achieved by a family of effector proteins secreted by the type III secretion system in gram-negative bacteria. The effector protein of the family is Adenosine Diphosphate (ADP) ribosyltransferase, specifically performs single ADP ribosylation modification on threonine residue at the 66 th position of ubiquitin molecule in eukaryote, and has no modification effect on ubiquitin-like protein SUMO and NEDD 8. The modification effect on ubiquitin can not be reversibly modified by hydrolase for removing ADP ribosylation modification in eukaryotic cells, so that ubiquitin-mediated signal pathways in host cells are effectively damaged, and the method plays an important role in killing tumor cells, changing cell signal pathways and the like.

Description

Method for modifying ubiquitin and inhibiting ubiquitination pathway

Technical Field

The invention relates to the technical field of life science and microbial protein function and application, in particular to a novel mode for ubiquitin molecule specific modification, enzymatic activity of an effector protein CteC as ADP ribosyltransferase and a role of the enzyme in researching ADP ribosylation modification.

Background

ADP ribosylation (ADPr) is a reversible regulatory mechanism that is widely present in viruses, bacteria, and most eukaryotes. ADP Ribosyltransferases (ARTs) transfer groups of Adenosine Diphosphate (ADP) ribosyl from NAD to a substrate protein and release nicotinamide. ADPr regulates many important physiological processes in cells, such as DNA damage repair, transcription, cell division, proliferation, and cell death. In addition, ADPr is involved in the pathogenesis of many human diseases, including neurological diseases, cancer, and bacterial or viral infections. ARTs also exist in bacteria, such as Diphtheria (DTX) and Cholera (CTX) exotoxins produced by pathogenic diphtheria bacilli and Vibrio cholerae, which play an important role in the pathogenicity of bacteria. ARTs are divided into two classes, HYE ARTs and RSE ARTs, respectively, according to the conserved amino acid sequences of NAD binding and catalysis. In bacterial HYE ARTs, two hydroxyl groups on histidine (H) and adenosine ribose and an amino group on nicotinamide form hydrogen bonds, benzene rings on tyrosine (Y) and nicotinamide form pi-pi accumulation, and glutamic acid (E) plays a stabilizing role in catalyzing intermediate products formed. In RSEARTs, however, arginine (R) and NAD diphosphate form electrostatic interactions, serine (S) and some sites on the nicotinamide ribosyl form hydrogen bonds, and glutamate exerts the same catalytic activity as in HYE ARTs.

Ubiquitination is a ubiquitous post-translational modification in eukaryotic cells. Ub is first activated by ubiquitin activating enzyme E1 at ATP and Mg²⁺Is activated in the presence of oxygen. E1 uses ATP to generate adenylate, and then transfers the C-terminal glycine residue of Ub to a cysteine residue via a thioester bond. After E1 mediated activation of Ub, Ub is transferred to the cysteine residue of ubiquitin conjugating enzyme E2. Under the catalytic action of different types of E3 ligase, Ub forms different forms of polyubiquitin chains to be connected to substrate proteins to play different physiological functions. For example, the K48 chain is involved in protein degradation, the K63 chain is involved in signal transduction, and the linear chain is involved in NF-kB signal pathway. Ubiquitination, an important post-translational modification of proteins, has been the focus and focus of cell biology and tumor biology research. The ubiquitin-proteasome pathway and the deubiquitinating pathway play important roles in cell signal transduction and tumorigenesis and development. Certain types of tumor cells are very sensitive to blockade of the ubiquitin pathway and rapidly induce apoptosis and death. Therefore, inhibition of ubiquitination pathways in tumor cells would beBecomes a new target point of anti-tumor treatment.

During co-evolution with the host, pathogenic bacteria have evolved specific protein secretion systems, such as type III secretion systems (T3SSs), which introduce toxic effector proteins into the host cell and interfere with the host's immune response-related signaling pathways during infection. Chromobacterium violaceum (Chromobacterium violacea) is a conditional gram-negative pathogen widely distributed in tropical and subtropical waters or soils and is known for its ability to secrete purplish violacein. After a human body is contacted with the skin or food is mistakenly infected with chromobacterium violaceum, severe liver abscess can be caused within a few days, then systemic multiple organs generate abscess symptoms, the systemic diseases can be rapidly developed, clinical symptoms are fever, abdominal pain, tissue necrosis and visceral abscess, and then septicemia is developed, and the death rate is over 50%. The initial infection symptoms of chromobacterium violaceum are not obvious, but the chromobacterium violaceum develops very rapidly, has strong drug resistance to various antibiotics, and is challenged in clinical diagnosis and treatment.

Chromobacterium violaceum strain ATCC12472 was genome-wide sequenced in 2003 and found to possess two type III secretion systems, Cpi-1/1a and Cpi-2, respectively, and the components of the strain have great similarity to those of Salmonella sp-1 and sp-2 in protein sequence, indicating that Cpi-1/1a and Cpi-2 secretion systems may play a role similar to those of Salmonella sp-1 and sp-2 secretion systems during Chromobacterium violaceum infection. Unlike Cpi-2, which codes together in the same region of the genome, the gene island coding for Cpi-1/1a is not together on the genome of Chromobacterium violaceum, but is distributed in two regions. Cpi-1 is located downstream of Cpi-2 on the genome and consists of 28 reading frames CV2615 to CV2642, with a total length of 31004 bp. Cpi-1a is located 200kb upstream of Cpi-1, in reading frame CV2416 to CV2424, and is 4190bp in length. Cpi-2 is located between reading frames CV2574 and CV2610, upstream of Cpi-1, and has a full length of 40291 bp. The specific number of Chromobacterium violaceum type III effector proteins is not yet fully understood, and there are 13 effector proteins identified so far, of which only individual effector protein functions are revealed. The effector protein CtEC (CV1467) disclosed by the invention is one of the effector proteins, but no research report indicating the activity and the function of the effector protein CtEC except the gene sequence is known (NCBI: access AE016825), and only the effector protein CtEC is known to be secreted by Chromobacterium violaceum through a type III secretion system. (Miki, T., Iguchi, M., Akiba, K., Hosono, M., Sobue, T., Danbara, H., and Okada, N. (2010). Chromobacterium pathobiology of type 1type III section characterization system is a major virus molecule for bacterium-induced cell de-aration in nanoparticles 77, 855. 872.)

Several effector proteins in pathogenic bacteria are reported to have activity in interfering with the ubiquitination pathway, such as a deubiquitinase or ubiquitin ligase, deamination modification of ubiquitin molecule or ubiquitin conjugating enzyme Ubc13, and the like. Previous researches find that the SidE family effector protein of the legionella pneumophila can carry out ADP ribosylation modification on 42 th arginine of ubiquitin and further carry out monophosphoryl ribosylation on the modified ubiquitin molecule so as to be covalently connected to serine residues of substrate proteins, and the process does not need participation of E1 and E2 and does not depend on ATP as an energy source, so that the SidE family effector protein is a brand-new ubiquitination modification. Although this class of effector proteins also carries out arginine ADP ribosylation modification of ubiquitin, this modification is not the final product, but is only an intermediate process of catalysis. The function of the ADP ribosyltransferase is greatly different from that of the ADP ribosyltransferase, and the protein related to the invention is completely different from the reported SidE family protein in the aspects of ubiquitin modification site, substrate specificity and the like. (Qiu, J., Sheedlo, M.J., Yu, K., Tan, Y., Nakayasu, E.S., Das, C., Liu, X, and Luo, Z.Q. (2016. inactivation indication of E1 and E2 enzymes by bacteria effects Nature 533,120-

Disclosure of Invention

The invention aims to provide a method for modifying ubiquitin and inhibiting ubiquitination pathway.

The technical scheme is as follows: a method for modifying ubiquitin and inhibiting ubiquitination pathway is characterized by that the recombinant eukaryotic expression vector containing effector protein gene of conditional pathogenic bacteria is introduced into target eukaryotic cell, so that the ubiquitin in the target eukaryotic cell can be mono ADP ribosylated, and the ubiquitination pathway can be inhibited.

By Blast sequence alignment analysis, homologous proteins were found to exist in CtC of Chromobacterium violaceum (Chromobacterium violacea), which are derived from Burkholderia (Burkholderia ubonensis) and Corallococcus (Corallococcus), and the effector proteins of these two bacteria are called CHBU (NCBI, ACCESSION: KVO09808) and CHCS (NCBI, ACCESSION: WP-121752092), respectively. The experimental results show that CtEC, CHBU and CHCS specifically modify Ub with active glutamic acid active residues in the presence of NAD, but do not modify SUMO and NEDD8, thereby determining that the ADP ribosyltransferase is a family protein and exists in various pathogenic bacteria.

The ubiquitin is ubiquitin molecule (Ub), and threonine residue at position 66 of ubiquitin molecule (Ub) is mono ADP ribosylated.

The invention has the beneficial effects that: the invention carries out threonine mono ADP ribosylation on ubiquitin molecules through effector protein families secreted by a bacteria III type secretion system, and the ADP ribosylation can inhibit the protein ubiquitination process and interfere the signal path mediated by ubiquitin in cells, thereby causing cell dysfunction. Ubiquitination pathway in tumor cells is usually more active, and thus has significance for killing tumor cells by inhibiting ubiquitination. The method of the invention will play an important role in killing tumor cells and regulating cell signaling pathways.

Drawings

FIG. 1 is a 12% SDS-PAGE protein gel of CtEC recombinant protein;

FIG. 2 is a graph showing the effect of CtEC on NAD-dependent modification of Ub;

FIG. 3 is a diagram of Ub after recognition of Ctec modification by ADPR antibody;

FIG. 4 is a diagram showing the alignment of the amino acid sequences of CtEC and other ADP ribotransferases;

FIG. 5 is a graph showing the effect of CtC mutants on endogenous Ub modification after transfection into cells;

FIG. 6 is a mass spectrometry of CtEC-modified Ub. The figure shows an ADPR modification at threonine at position 66;

FIG. 7 is a structural diagram of Ub after Ctec modification;

FIG. 8 is a graph showing the results of experiments in which CtEC had no modification effect on SUMO and NEDD 8;

FIG. 9 is a graph showing the experimental results of the effect of ADPR-Ub on ubiquitin chain formation;

FIG. 10 is a graph showing the results of CtEC on the degradation of intracellular IkB α under TNF α stimulation;

FIG. 11 is CtEC vs intracellular GFP^uAn accumulated influence experiment result graph;

FIG. 12 is a graph showing the results of the modification of Ub by CHBU and CHCS;

FIG. 13 is a graph showing the results of the modification sites and specificity of CHBU and CHCS for Ub; wherein A and B represent that CHBU has no modification effect on Ub T66A; c and D represent that CHCS has no modification effect on Ub T66A; e represents that CHBU cannot modify SUMO and NEDD 8; f represents that CHBU cannot modify SUMO and NEDD 8;

Detailed Description

Example 1

Expression and purification of CtEC recombinant protein

1. Construction of expression plasmids

Using the genomic DNA of the mycobacterium violaceum ATCC12472 strain as a template, primer F1 was designed based on the gene sequence (CV _1647) at NCBI: GATAGGATCCATGCTATTTTTCACCGGTCTGC (SEQ ID NO.1) and R1: GATACTCGAGTTAGACCGACGCCAACTCCTG (SEQ ID NO.2) to obtain a CtEC full-length target fragment by PCR amplification.

The full-length target fragment of CteC is constructed into a prokaryotic expression plasmid pRSF-Duet-His-SUMO vector (the vector is inserted into SUMO protein after His tag on the basis of pRSF-Duet1 (Novagen)) resistant to kanamycin by a method of enzyme digestion (the enzyme digestion sites are BamH1 and Xho1) and connection to obtain pRSF-Duet 1-His-SUMO-CteC. His-tag protein can be affinity purified with Ni magnetic beads, and SUMO protein can be specifically recognized by Ulp1 enzyme for subsequent tag protein excision.

2. Protein expression

pRSF-Duet1-His-SUMO-Ctec was transformed into E.coli BL21(DE3) strain, single colonies were picked from the plate and inoculated into 5mL of LB medium, shaken at 37 ℃ to OD₆₀₀About 0.8, transferred to 1L LB medium and shaken until OD is reached₆₀₀About 0.8, adding IPTG with final concentration of 0.1mM, and shake culturing at 18 deg.C for 16 hrIn this case, the cells were collected.

3. Protein purification and characterization

The cells were washed with a precooled buffer (50mM Tris-HCl pH 8.0,150mM NaCl,2mM DTT) and suspended in 40mL of the buffer. The bacterial cells were disrupted by sonication, and the lysate was centrifuged at 18000rpm for 1 hour to obtain a supernatant. After affinity purification on Ni column, the Ni column was washed with 400mL of 20mM imidazole in buffer to remove the contaminating proteins, and the proteins were eluted from the Ni column with 30mL of 300mM imidazole in buffer and digested with Ulp1 enzyme overnight. And (3) enabling the eluent to pass through a desalting column to remove imidazole, enabling the eluent to be compatible with the Ni column again, and removing the SUMO label protein. The eluate was further passed through a well-balanced Hitrap Q column (equilibration buffer fraction: 50mM Tris-HCl pH 8.0) and fractions were collected stepwise to obtain CtEC protein. As shown in figure 1, the purity of the CtEC recombinant protein is more than 90% and the size of the expressed CtEC protein is 31kDa through the identification of 12% SDS-PAGE.

Example 2: ADP ribosylation modification of ubiquitin molecules by effector protein Ctec

mu.M of Ub (purified in the same manner as in Wan et al, 2019, doi:10.1038/s41564-019-0454-1) and 0.1. mu.M of the CtEC protein purified in example 1 were added to a 15. mu.L reaction system (reaction buffer 20mM HEPES pH 7.4,150mM NaCl), and NAD concentration gradients were set to 0, 0.25, 2.5, 25, 250, 2500. mu.M, respectively, and after reaction at 37 ℃ for 30 minutes, the mixture was run on 15% SDS-PAGE and 8% Native PAGE, respectively, and if Ub was modified, it would migrate upward on 15% SDS-PAGE and downward on 8% Native PAGE. In vitro biochemical experiments showed that modification of Ub by CteC requires NAD as a ligand (fig. 2), and that modified Ub can be recognized by antibodies to ADPr (MABE1016, Millipore) (fig. 3). CtEC was found to be similar to some ARTs by sequence alignment analysis, with a conserved "RSE motif" (FIG. 4). In order to test RSE motif of CtEC, mutants CtEC R65A, CtEC S97A and CtEC E220A are prepared by mutating positions R65, E220 and S97 of CtEC to alanine (A), and specifically, the preparation method of CtEC 220A is as follows: designing a point mutation primer on E220 site of Ctec: 5 '-GTGGAGCCGACCGCGGCCAAAATCTGC (SEQ ID NO.3) and 3' -GCAGATTTTGGCCGCGGTCGGCTCCAC (SEQ ID NO.4), firstly, taking bacterial DNA as a template, respectively carrying out first round PCR by using two pairs of primers F1/3 'and R1/5' to obtain two target fragments, and then, taking the two fragments as the template, carrying out second round PCR by using a primer F1/R1 to obtain a mutant Ct eC E220A fragment. The preparation methods of the mutants CtEC R65A and CtEC S97A are the same. And adding Flag tag protein to the N end of the obtained full-length fragments of the mutant CteC R65A, CteC S97A, CteC E220A and CteC respectively, and constructing the full-length fragments into a eukaryotic vector PRK 5-Myc. HEK293T cells were plated in 12-well plates and transfected with 1. mu.g plasmid per well at cell densities around 80% and 2. mu.l of the transfection reagent jetPRIME. Meanwhile, transfection of empty load (vector) is used as a negative control to carry out the experiment of Ctec mutant on the modification activity of the endogenous Ub of the cell. As shown in FIG. 5, CtC did not allow Ub to migrate upward on 15% SDS-PAGE after mutation of R65 and E220 to alanine (A), and CtC did allow Ub to migrate upward after mutation of S97 to alanine (A).

Mass spectrometry and structural analysis of the modified Ub confirmed that CteC modified Ub with mono ADP ribosylation and the modification site was threonine at position 66 (fig. 6 and 7). CtEC was identified as a class of ADP ribosyltransferases with the active site being glutamate at position 220.

The T66 site of Ub is not conserved among other ubiquitin-like protein molecules, and the results of in vitro biochemical experiments on SUMO (which is purified from pRSF-Duet-His-SUMO plasmid referred to in example 1) and NEDD8 (which is constructed into pGEX-6p-2 vector, purified by GST resin affinity and digested overnight with PreScission, Cui et al, 2010, DOI:10.1126/science.1193844) according to the above experimental methods show that CtEC can not modify SUMO and NEDD8 in the presence of biotin-NAD (FIG. 8). Biotin-NAD is a Biotin molecule attached to an NAD molecule so that the NAD is recognized by antibodies to Biotin.

Example 3 effect of ADP ribosylation modification of ubiquitin molecules by effector protein CteC on ubiquitination pathways as well as host cells.

Ubiquitin molecules participate in various signal pathways after forming different forms of ubiquitin chains through cascade reactions. The use of different E2 and E3 forms a specific form of ubiquitin chain. This example used UbcH5c and IpaH3 to synthesize chain K48 and Uev1a, Ubc13 and TRAF6 to synthesize chain K63. (the information and purification method of the protein plasmid referred to in this example are shown in Wanet al, 2019, doi:10.1038/s 41564-019-0454-1). the experimental results show that the efficiency of forming K48 and K63 chains in vitro by CtEC-modified Ub is greatly reduced (FIG. 9).

The NF-kB signal channel plays an important role in cellular immune response, and the degradation of IkB α is an index for detecting whether the channel is activated.

(1) HEK293T cells were plated in 12-well plates and transfected with 1. mu.g of PRK5-Myc-Flag-CtEC WT/E220A (full-length CtEC/E220A mutant) plasmid and jetPRIME 2. mu.l per well at cell densities around 80%. At the same time, transfection empty load (vector) served as a negative control.

(2) After 20h of transfection, the cells were stimulated with TNF α (10ng/ml) for 5, 10, 15 minutes, collected in cell lysate (25mM HEPES 7.4,150mM NaCl, 1% Triton X-100, Cocktail), lysed on ice for 15 minutes, and centrifuged at 12000rpm for 15 minutes at 4 ℃ to collect the cell supernatant for Western blot detection.

(3) The level of I kappa B α of different treated samples in the experiment shows the activation condition of NF-kappa B, Tubulin as a common internal reference antibody shows the consistency of the protein loading amount of each sample, Flag shows the expression level of CtEC in cells, and the experiment result shows that the degradation of cell I kappa B α of plasmid transfected with CtEC is effectively inhibited (figure 10).

The ubiquitin-proteasome system plays an important role in protein degradation, GFP^uThe method is a method for detecting whether the system is inhibited, and whether the system functions normally can be judged through the signal intensity of GFP. The specific experiment is as follows:

(1) the experiment adopts a stable transgenic cell line mCherry-P2A-GFP^u293A cells (see Guo et al, 2011, doi. org/10.1073/pnas.1113170108 for preparation), which normally have GFP^uWill be constantly degraded by the ubiquitin-proteasome system, showing a weak fluorescent signal. However, when the ubiquitin-proteasome system is dysfunctional, accumulation of green fluorescence signal is observedThe expression level of GFP detected by Western blot can show that GFP is^uThe degree of accumulation of (c).

(2) HEK293T cells were plated in 12-well plates and transfected with 1. mu.g of PRK5-Myc-Flag-CtEC WT/E220A plasmid and 2. mu.l of the transfection reagent jetPRIME per well at cell densities around 80%. Transfection of a null load (vector) was used as a negative control, and MG132 was added to the cell culture medium at a concentration of 5 μ M as a positive control, a commonly used protease inhibitor.

(3) After 20h of transfection, cells were collected in cell lysate (25mM HEPES 7.4,150mM NaCl, 1% TritonX-100, Cocktail), lysed on ice for 15 min, and centrifuged at 12000rpm at 4 ℃ for 15 min to collect cell supernatants for Western blot assay.

(4) The levels of GFP of the different treated samples in this experiment showed the level of accumulation of green fluorescence; tubulin as a common internal reference antibody showed consistency in the amount of protein loaded per sample; the anti-Flag immune color development shows the expression level of CtEC in cells. Experimental results show that the cells of the plasmid of the CtEC WT are transfected with GFP^uSignificant accumulation was produced (figure 11).

Both experiments described above demonstrate that effector protein CteC can inhibit the ubiquitin pathway. It was found that the capacity of the modified Ub to transfer from E1 to E2 was reduced and the efficiency of in vitro polyubiquitin chain synthesis was reduced. Has a serious influence on intracellular ubiquitin-mediated signaling pathways.

Example 4

The ADP ribosyltransferase is confirmed to be a family through sequence alignment analysis and in vitro biochemical experiments, and exists in various bacteria.

Homologous proteins were found to exist in CtEC by Blast analysis at NCBI, from Burkholderia ubonensis and Corallococcus respectively, where the effector proteins of these two bacteria are named CHBU (NCBI, ACCESSION: KVO09808) and CHCS (NCBI, ACCESSION: WP-121752092) respectively (FIG. 4). The two proteins were purified in the same manner as in example 1. Among them, CHBU has high homology with CtEC and also has conserved "RSEmotif", while CHCS and CtEC have homology of only 24%, and only two conserved sites of "RE" and lack serine. However, in vitro biochemical experiments show that both CHBU and CHCS can modify the T66 residue of Ub, the active site is also E (glutamic acid residue), and the modification effect on ubiquitin-like protein molecules SUMO and NEDD8 is not existed (FIG. 12 and FIG. 13). Wherein the active glutamic acid residue of CHBU is at position 205 and the active glutamic acid residue of CHCS is at position 211. Notably, the coral cocci have inhibitory effects on various fungi, and do not belong to pathogenic bacteria of humans. Further elucidating the broad spectrum of proteins of the present invention, studies on their function will be of greater significance.

Sequence listing

<110> Zhejiang university

<120> a method for modifying ubiquitin and inhibiting ubiquitination pathway

<141>2020-01-20

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>32

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>1

gataggatcc atgctatttt tcaccggtct gc 32

<210>2

<211>31

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

gatactcgag ttagaccgac gccaactcct g 31

<210>3

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

gtggagccga ccgcggccaa aatctgc 27

<210>4

<211>27

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

gcagattttg gccgcggtcg gctccac 27

Claims (3)

1. A method for modifying ubiquitin and inhibiting ubiquitination pathway is characterized in that a recombinant eukaryotic expression vector containing effector protein genes of conditional pathogenic bacteria is introduced into target eukaryotic cells, so that ubiquitin in the target eukaryotic cells is singly ADP ribosylated, and ubiquitination pathway is inhibited.

2. The method of claim 1, wherein the effector proteins of the opportunistic pathogen are CtEC protein of Chromobacterium violacea (Chromobacterium violacea), CHBU (NCBI, ACCESSION: KVO09808) protein of Burkholderia ubonensis (Burkholderia ubonensis), and CHCS (NCBI, ACCESSION: WP-121752092) protein of Corallococcus (Corallococcus).

3. The method according to claim 1, wherein the ubiquitin is ubiquitin molecule (Ub), and the threonine residue at position 66 of ubiquitin molecule (Ub) is mono ADP ribosylated.

Images