CN111154676B

CN111154676B - Lactobacillus rhamnosus exopolysaccharide, preparation method thereof and bacteria used thereby

Info

Publication number: CN111154676B
Application number: CN202010028764.7A
Authority: CN
Inventors: 顾青; 周涛; 周佳敏; 郦萍; 朱宇竹; 周青青
Original assignee: Zhejiang Gongshang University
Current assignee: Zhejiang Gongshang University
Priority date: 2020-01-11
Filing date: 2020-01-11
Publication date: 2021-08-24
Anticipated expiration: 2040-01-11
Also published as: CN111154676A

Abstract

The invention discloses Lactobacillus rhamnosus (Lactobacillus rhamnosus) ZFM231, which has a preservation number of: CCTCC NO: M2019883. The strain is cultured in an M RS culture medium with glucose as a carbon source, and four different extracellular polysaccharide components of EPS-0M, EPS-0.1M, EPS-0.3M and EPS-0.5M are obtained after the cultured crude polysaccharide is separated and purified by DEAE-52 column chromatography and Sephadex G-100 gel column. The lactobacillus rhamnosus exopolysaccharide and the four components thereof have stronger antioxidant capacity; the four components have obvious lipase inhibition activity and stronger effect of reducing cholesterol and triglyceride. Experiments for constructing an in-vitro fermentation model of the intestinal microorganisms show that all the components have better regulation effect on the intestinal flora.

Description

Lactobacillus rhamnosus exopolysaccharide, preparation method thereof and bacteria used thereby

Technical Field

The invention relates to the technical field of polysaccharides in microbiology, in particular to a microbial exopolysaccharide, and especially relates to preparation and application of multiple components of an exopolysaccharide derived from lactobacillus rhamnosus.

Background

The probiotics is active microorganisms capable of improving the intestinal microecological balance of a host and regulating the microecological imbalance, and the Exopolysaccharide (EPS) is a macromolecular water-soluble compound consisting of monosaccharide repeating units which are secreted outside cells by most bacteria, a few yeasts and filamentous fungi in the growth and metabolism processes and are not branched or have branched structures, and is a product adapting to the environment.

The lactobacillus rhamnosus is one of the most important probiotics separated from intestinal tracts of healthy human bodies, and has the characteristics of high intestinal adhesion rate, strong colonization ability, capability of promoting cell division and the like. Research shows that the lactobacillus rhamnosus exopolysaccharide has various biological activities of resisting oxidation, reducing serum cholesterol, reducing blood fat, improving intestinal microecological balance, enhancing immunity and the like, but the research is mostly about crude polysaccharide, and the analysis of different polysaccharide components is not clearly reported.

Disclosure of Invention

The invention aims to solve the technical problem of providing lactobacillus rhamnosus exopolysaccharide, a preparation method thereof and bacteria used by the same.

In order to solve the above technical problems, the present invention provides a lactobacillus rhamnosus (lactobacillus rhamnosus) strain: is Lactobacillus rhamnosus (Lactobacillus rhamnosus) ZFM231 with a preservation number of: CCTCC NO: M2019883.

The invention also provides a Lactobacillus rhamnosus exopolysaccharide which is obtained by fermenting Lactobacillus rhamnosus (Lactobacillus rhamnosus) ZFM231 with CCTCC NO: M2019883.

The invention also provides a preparation method of the lactobacillus rhamnosus exopolysaccharide, which comprises the following steps:

1) inoculating Lactobacillus rhamnosus (Lactobacillus rhamnous) ZFM231 into an M RS liquid culture medium according to the inoculation amount of 1% (volume ratio), and performing constant-temperature culture and fermentation at the temperature of 37 +/-0.5 ℃ for 12-48 h (preferably 24 h); obtaining a fermentation culture solution;

2) centrifuging the fermentation culture solution, collecting supernatant, and removing protein (removing protein by trichloroacetic acid (TCA) method) to obtain protein-removed supernatant;

3) extracting polysaccharide from the supernatant without protein by water extraction and alcohol precipitation to obtain a crude polysaccharide solution (Lactobacillus rhamnous ZJM231 crude polysaccharide solution);

4) and dialyzing the crude polysaccharide solution (3500Da), concentrating, and freeze-drying to obtain the extracellular polysaccharide EPS of lactobacillus rhamnosus.

The improvement of the preparation method of the lactobacillus rhamnosus exopolysaccharide comprises the following steps:

the method for removing the protein in the step 2) comprises the following steps: adding trichloroacetic acid (TCA) aqueous solution into the supernatant (supernatant fermentation liquor) obtained by centrifugation to enable the trichloroacetic acid final concentration to be (4 +/-0.5) g/100ml, and standing for 10-14 h at 3-5 ℃; centrifuging to remove precipitate (denatured protein precipitate) to obtain protein-removed supernatant;

description of the drawings: the concentration of trichloroacetic acid (TCA) in a TCA aqueous solution is about 70-90 g/100 ml;

the water extraction and alcohol precipitation method in the step 3) comprises the following steps: concentrating the supernatant without protein (about 50 ℃ rotary evaporation) to 20-30% of the original volume, then adding cold ethanol with the volume 4.5-5.5 times of that of the concentrated solution and at 3-5 ℃ for 10-14 h, centrifuging, drying the precipitate obtained by centrifuging until the ethanol is volatilized, and adding sterile water (with the volume amount of about 1/5 of the concentrated solution) for redissolution to obtain a crude polysaccharide solution;

the step 4) is as follows: dialyzing the crude polysaccharide solution in deionized water for 70-74 h by using a 3500Da dialysis bag, and changing the deionized water every 2 h; and concentrating the dialyzate, and freeze-drying to obtain the lactobacillus rhamnosus exopolysaccharide EPS.

The preparation method of the lactobacillus rhamnosus exopolysaccharide is further improved as follows:

the step 1) is as follows: culturing at 37 deg.C for 24 hr, and fermenting to obtain fermentation culture solution.

As a further improvement of the preparation method of the lactobacillus rhamnosus exopolysaccharide, the obtained lactobacillus rhamnosus exopolysaccharide EPS is separated and purified, and the following steps are sequentially carried out:

roughly separating a DEAE Cellulose-52 chromatographic column:

dissolving lactobacillus rhamnosus exopolysaccharide EPS in deionized water according to a feed-liquid ratio of 300 mg/5-8 ml, centrifuging, and taking supernatant;

loading the supernatant to a DEAE Cellulose-52 chromatographic column, and sequentially eluting with deionized water and NaCl solutions with the concentrations of 0.1mol/L, 0.3mol/L, 0.5mol/L and 0.7mol/L as eluents at the flow rate of 1 mL/min;

respectively collecting the eluents corresponding to the 4 eluents, namely deionized water and NaCl solutions with the concentrations of 0.1mol/L, 0.3mol/L and 0.5mol/L, respectively, dialyzing (3500Da), concentrating, and freeze-drying to respectively obtain four kinds of primarily purified polysaccharides (EPS-0, EPS-0.1, EPS-0.3 and EPS-0.5);

purifying by a Sephadex G-100 gel chromatographic column:

respectively carrying out the following operations on four kinds of primarily purified polysaccharides obtained in the step I:

dissolving the primarily purified polysaccharide in deionized water according to a feed-liquid ratio of 250 mg/4.8-5.2 ml, centrifuging, and taking supernatant;

passing the supernatant through a 0.45 μm filter membrane, loading into a Sephadex G-100 gel chromatographic column, eluting with deionized water as eluent at flow rate of 0.25mL/min to obtain eluate;

the resulting eluate was concentrated and freeze-dried to obtain the corresponding purified polysaccharide fractions (i.e., EPS-0M, EPS-0.1M, EPS-0.3M and EPS-0.5M).

Note: a Sephadex G-100 gel chromatographic column is adopted, the specification of the chromatographic column is 60cm multiplied by phi 1.6cm, and the effective volume of the column is 50cm multiplied by phi 1.6 cm.

The lactobacillus rhamnosus is obtained by screening fresh milk, and the code is ZFM 231. The strain belongs to the subspecies of lactobacillus rhamnosus through 16S rDNA sequence identification.

The preservation information is as follows:

the preservation name is: lactobacillus rhamnosus ZFM231, deposited unit: china center for type culture Collection, collection address: wuhan university in Wuhan, China, CCTCC NO: M2019883, preservation time 2019, 11 months and 1 day.

The strain of the invention is applied to grapesThe extracellular polysaccharide yield can reach 220mg/L after being cultured in an M RS culture medium with sugar as a carbon source for 24 hours. Separating and purifying the cultured crude polysaccharide with DEAE-52 column chromatography and Sephadex G-100 gel column to obtain four different extracellular polysaccharide components EPS-0M, EPS-0.1M, EPS-0.3M and EPS-0.5M with molecular weights of 1.40 × 10⁴,1.01×10⁴,1.42×10⁴And 2.47X 10⁴Da. The chemical composition and monosaccharide composition are shown in tables 1 and 2 below. In vitro experiments show that the lactobacillus rhamnosus exopolysaccharide and the four components thereof have stronger antioxidant capacity; the four components have obvious lipase inhibition activity and stronger effect of reducing cholesterol and triglyceride. Experiments for constructing an in-vitro fermentation model of the intestinal microorganisms show that all the components have better regulation effect on the intestinal flora. The biological activity shows that the lactobacillus rhamnosus exopolysaccharide and the four components thereof have wide application values in the aspects of preparing products for resisting oxidation, reducing blood fat and regulating intestinal flora.

In-vitro antioxidant experiments show that the lactobacillus rhamnosus Exopolysaccharide (EPS) and the four components have strong antioxidant capacity (reducing power, DPPH free radical scavenging capacity, hydroxyl free radical scavenging capacity, superoxide anion free radical scavenging capacity and metal ion chelating capacity).

In vitro high cholesterol cell model experiments show that the lactobacillus rhamnosus exopolysaccharide EPS and the four components have the activity of reducing the intracellular cholesterol concentration. The cell model is HepG2 cell.

An experiment for constructing an in-vitro fermentation model of the intestinal microorganisms shows that the lactobacillus rhamnosus exopolysaccharide EPS and the four components can be well degraded and utilized by the intestinal microorganisms, and the intestinal flora can be well regulated in terms of gas production. The intestinal microorganism in-vitro fermentation model is human excrement suspension.

In conclusion, the invention provides a fermentation method for producing polysaccharide by lactobacillus rhamnosus and an extraction method for exopolysaccharide, and the exopolysaccharide is separated and purified. Carrying out chemical component analysis and structural characterization on each purified component; and the antioxidant activity, the intestinal flora regulating activity, the blood fat reducing activity and the like of the purified polysaccharide are researched, and a technical support is provided for the research and development of lactobacillus rhamnosus related food.

Drawings

The following describes embodiments of the present invention in further detail with reference to the accompanying drawings.

FIG. 1 is the elution curve of extracellular polysaccharide of Lactobacillus rhamnosus ZFM231 on DEAE-52 anion exchange column in the present invention;

FIG. 2 is the in vitro antioxidant properties of different components of Lactobacillus rhamnosus exopolysaccharide EPS;

FIG. 3 shows the inhibition rate of different components of extracellular polysaccharide EPS of Lactobacillus rhamnosus on lipase;

FIG. 4 is the effect of different components of the exopolysaccharide EPS of Lactobacillus rhamnosus on the intracellular cholesterol (upper panel) and triglyceride (lower panel) concentrations of HepG 2;

FIG. 5 shows the effect of different components of extracellular polysaccharide EPS of Lactobacillus rhamnosus on the in vitro fermentation gas production of intestinal flora;

FIG. 6 is the effect of different components of the exopolysaccharide EPS of Lactobacillus rhamnosus on short chain fatty acids;

FIG. 7 is the effect of different components of the exopolysaccharide EPS of Lactobacillus rhamnosus on the Alpha diversity index of the intestinal flora.

Detailed Description

The invention will be further described with reference to specific examples, but the scope of the invention is not limited thereto:

example 1, acquisition of a Lactobacillus rhamnosus (Lactobacillus rhamnosus) strain:

fresh milk in a new hope double-peak milk cow breeding base (Hangzhou) is cultured according to the following method: adding 1ml fresh milk into 9ml sterile water according to the ratio of 10^－1Gradient dilution of (1), gradient range of 10^－1～10^－6 Suction 10^－2、10－³、10^－4And 10^－51ml of the diluted solution was put on a plate, uniformly spread, and the prepared plate was incubated in an incubator at 37 ℃ for 48 hours. Selecting single colony on the coated plate, inoculating to MRS culture medium, and culturing for 3dAnd (3) inoculating a single colony with acid production signs to a lactic acid bacteria culture medium, observing colony morphology and microscopic morphology characteristics, researching physiological and biochemical changes, performing molecular biological identification on bacteria, and storing. Streaking a strain which is preserved in 20% glycerol at-80 ℃ on an MRS solid culture medium, and performing static culture at 37 ℃; selecting single colony in MRS liquid culture medium, static culturing at 37 deg.C, and continuously passaging twice. The fermentation product is milky white, and a large amount of sticky substances are connected around the bacterial colony; the bacterial colony is picked lightly by using a sterile inoculating loop, and obvious wiredrawing is achieved.

The strains are preserved, and the preservation information is as follows:

Example 2 extraction of exopolysaccharides from Lactobacillus rhamnosus

1. Preparation of MRS culture medium:

MRS liquid medium: 10g of tryptone, 5g of yeast extract, 20g of glucose, 5g of sodium acetate, 2g of diamine hydrogen citrate, 801 mL of tween-801, 2g of dipotassium hydrogen phosphate, 0.2g of magnesium sulfate heptahydrate, 0.05g of manganese sulfate and 10g of beef extract, adding double distilled water to a constant volume of 1L, and adjusting the pH value to 7.0. Sterilizing at high temperature (1.1 atm, 121 deg.C for 15 min).

MRS solid medium: adding agar of 1.5g/100mL on the basis of the MRS liquid culture medium; the rest are equivalent.

2. Preparation of lactobacillus rhamnosus fermentation liquor:

activating the strain: sterilizing the super clean bench by ultraviolet for 30min, taking out the Lactobacillus rhamnous ZJM231 frozen tube at-80 ℃, and unfreezing at normal temperature for later use. And slowly and uniformly pouring the MRS solid culture medium into the culture dish in the super clean bench, and closing and inverting the culture dish cover after the MRS solid culture medium is solidified. And (3) dipping the disposable sterile inoculating loop into the frozen tube liquid of the strain, activating the strain by using a plate streak culture method, and then placing the strain in a constant-temperature incubator at 37 ℃ for inversion and culturing for 24-48 h.

First-generation liquid culture: and taking out the culture dish obtained in the last step, picking a well-growing colony in 10ml of MRS liquid culture medium by using a sterile inoculating loop in a super clean bench, and placing the colony in a constant temperature incubator at 37 ℃ for 12-18 h (preferably 18 h). The plates were then stored at 4 ℃ and transferred once in 1 month to maintain their viability.

Second-generation liquid culture: taking out the lactobacillus rhamnosus culture solution with obvious thallus precipitation, inoculating the lactobacillus rhamnosus culture solution into an M RS liquid culture medium in an inoculation amount of 1% (volume%) for liquid fermentation of polysaccharide, and carrying out a constant-temperature incubator at 37 ℃ for 12-24 h (preferably 24 h); obtaining the fermentation culture solution.

3. Identification of Lactobacillus rhamnosus and sugar production

The Lactobacillus rhamnous ZJM231 activated strain was identified by 16S rDNA sequencing. After the strain is activated and cultured for 48 hours in an incubator at 37 ℃, a fermentation product on a solid culture medium of Lactobacillus rhamnosus ZJM231 is milky white, and a large amount of sticky substances are connected around the colony. The bacterial colony is picked lightly by using an aseptic inoculating loop, and the obvious wire drawing condition is shown, so that the strain has stronger sugar production capability.

4. Extraction of extracellular polysaccharide of lactobacillus rhamnosus

Protein removal by TCA method: the fermentation broth obtained in the second generation liquid culture of step 2 was centrifuged at 8000rpm at 4 ℃ for 15min, the cell pellet was discarded to collect the supernatant broth, 80% (w/v, i.e., 80g/100ml) of aqueous TCA was added to give a final concentration of 4% (w/v) of TCA (trichloroacetic acid), and the mixture was allowed to stand at 4 ℃ overnight (about 12 hours). At this time, denatured protein precipitates and is removed by centrifugation; obtaining a supernatant liquid after protein removal.

Extracting polysaccharide by a water extraction and alcohol precipitation method: concentrating the supernatant (50 deg.C evaporation temperature) to 25% of original volume, adding 5 times of cold ethanol (4 deg.C) to the concentrated solution, standing at 4 deg.C, centrifuging at 10000rpm overnight for 10min to obtain precipitate, drying at room temperature until ethanol is sufficiently volatilized, adding appropriate amount of sterile water (1/5 volume of the concentrated solution) to redissolve to obtain crude polysaccharide solution of Lactobacillus rhamnosus ZJM 231.

And (3) dialysis: the crude polysaccharide solution was dialyzed for 72h against 3500Da dialysis bag, during which deionized water was changed every 2 h. And after the dialysis is finished, concentrating the trapped fluid in the dialysis bag by rotary evaporation (at the evaporation temperature of 50 ℃) to 25% of the original volume, freezing and drying for 24h (at the freezing temperature of-60 ℃) to obtain the lactobacillus rhamnosus exopolysaccharide EPS.

The fermentation culture solution of 100ml can finally obtain 22mg of the extracellular polysaccharide EPS of the lactobacillus rhamnosus.

Respectively changing a carbon source from glucose to maltose, sucrose, lactose and fructose, namely correspondingly changing the glucose in the MRS culture medium, and keeping the dosage unchanged; the rest is equal to the fermentation culture and the polysaccharide extraction, and the final obtained result is as follows:

when the carbon source is maltose, 19.8g of the extracellular polysaccharide EPS of the lactobacillus rhamnosus can be finally obtained by 100ml of fermentation culture solution.

When the carbon source is sucrose, 20.3g of the extracellular polysaccharide EPS of lactobacillus rhamnosus can be finally obtained by 100ml of fermentation culture solution.

When the carbon source is lactose, 20.8g of the extracellular polysaccharide EPS of the lactobacillus rhamnosus can be finally obtained by 100ml of fermentation culture solution.

When the carbon source is fructose, 19.9g of extracellular polysaccharide EPS of lactobacillus rhamnosus can be finally obtained by 100ml of fermentation culture solution.

Example 3 separation and purification of Lactobacillus rhamnosus EPS and analysis of the Components

DEAE-52 column chromatography separation and purification of crude polysaccharide of lactobacillus rhamnosus EPS

(1) Pretreatment of Cellulose DEAE-52: 200g of DEAE-52 powder is put into 800mL to 1000mL of deionized water, stirred for a while by a glass rod, then kept stand until it is settled, and then the floating cellulose monomer and impurity fragments on the upper layer are removed. Stirring uniformly for many times, standing for 24h to make it fully swell, draining the deionized water, and treating the cellulose by an alkali-acid-alkali method. Soaking the filler in 800mL of 0.5M NaOH solution for 1 hour, stirring slightly, draining the water after the filler is settled, and repeatedly soaking and washing the filler with deionized water until the pH value of the solution is 7 to prevent the filler from being influenced by heat release of subsequent acid washing. Then, the above operations were repeated with 800mL of 0.5M HCl solution and 800mL of 0.5M NaOH solution respectively until the pH was neutral, and finally, the ultrasonic cleaner was degassed for 30min for further use.

(2) Column loading and balancing: a chromatographic column of 60 cm. times.2.6 cm (effective length of about 50cm) was vertically fixed on an iron support, and a small amount of deionized water was added to the lower end of the column to remove air from the column. Closing a water outlet at the lower end of the column, keeping a small amount of deionized water in the column, tightly abutting the activated cellulose filler against the wall of the column by using a glass rod for drainage, and slowly and continuously pouring the activated cellulose filler into the column to prevent bubbles from being brought in the process. And ensuring that the liquid level of the filler is always below the water level in the sedimentation process, starting a peristaltic pump to press a column bed at an elution flow rate of 3 times when the filler naturally settles until the liquid level is not changed any more, and balancing deionized water for 24 hours for later use.

(3) Loading and eluting: dissolving 300mg EPS with 7mL deionized water to prepare polysaccharide solution with proper concentration, rotating speed of 8000r/min, centrifuging for 10min, and collecting supernatant. The sample loading volume is 7mL, which is 1-5% of the effective column bed volume. Sucking off excessive water above the column bed by using a dropper, slowly dripping the polysaccharide solution on the surface of the filler, and naturally settling the polysaccharide solution into the filler. Gradient elution was carried out using deionized water, 0.1M, 0.3M, 0.5M and 0.7M NaCl solutions as eluents in this order (elution flow rate 1mL/min, 10mL per tube). And (3) drawing an elution curve of the polysaccharide, wherein the abscissa is the number of tubes, and the ordinate is the absorbance value of 490nm, and finally combining the polysaccharide components respectively.

The absorbance value (OD) of the liquid can be collected per tube₄₉₀) The volume of each eluent is about 500ml according to the completion of the elution of the eluent.

Combining the 1 st tube and the 50 th tube, putting the combined tubes into a 3500Da dialysis bag, dialyzing the combined tubes in deionized water for 48 hours, carrying out rotary evaporation at the temperature of 60 ℃ to 1/40 of the original volume, and then carrying out freeze drying at the freezing temperature of (-60 ℃ for 24 hours) to obtain EPS-0. The yield was 23.75%.

And combining the 51 st tube and the 100 th tube, putting the combined tubes into a 3500Da dialysis bag, dialyzing the combined tubes in deionized water for 48 hours, carrying out rotary evaporation at the temperature of 60 ℃ to 1/40 of the original volume, and then carrying out freeze drying at the freezing temperature of (-60 ℃ for 24 hours) to obtain EPS-0.1. The yield was 18.75%.

And (3) combining the 101 th tube and the 150 th tube, putting the tubes into a 3500Da dialysis bag, dialyzing the tubes in deionized water for 48 hours, carrying out rotary evaporation at the temperature of 60 ℃ to 1/40 of the original volume, and then carrying out freeze drying at the freezing temperature of (-60 ℃ for 24 hours) to obtain EPS-0.3. The yield was 17.5%.

And combining the 151 th tube and the 200 th tube, putting the combined tubes into a 3500Da dialysis bag, dialyzing the combined tubes in deionized water for 48 hours, carrying out rotary evaporation at the temperature of 60 ℃ to 1/40 of the original volume, and then carrying out freeze drying at the freezing temperature of (-60 ℃ for 24 hours) to obtain EPS-0.5. The yield was 25%.

The yield (%) × 100 (mass of each component/total amount of polysaccharide). The results are shown in FIG. 1.

As can be seen from FIG. 1, the elution curve has a sharp peak and a narrow peak width, which indicates that the separation effect is better after elution. 5 components can be obtained after the EPS is subjected to first-stage coarse separation by a DEAE-52 chromatographic column, and the first four components are mainly collected for subsequent activity study due to the fact that the content of the component eluted by 0.7M NaCl is too small. Wherein EPS-0 is neutral polysaccharide, and is collected, concentrated and freeze-dried; the other three components of EPS-0.1, EPS-0.3 and EPS-0.5 are acidic polysaccharides. The recovery rate after separation was 85%, and it was seen that the loss of EPS by separation was small. The ratios of the four components were compared, with EPS-0.5 being the most, EPS-0 being the second, EPS-0.3 and EPS-0.5 remaining essentially equal.

Sephadex G-100 gel column purification

(1) Pretreatment of Sephadex G-100: 10G of Sephadex G-100 gel powder was weighed out in 200mL of distilled water and soaked at room temperature for 48 hours. During the process, a glass rod is used for stirring lightly, deionized water is replaced for multiple times to enable the mixture to be fully swelled, and then the fine particles on the upper layer are poured out.

(2) Sephadex G-100 column packing and equilibration: a chromatographic column with the specification of 60cm multiplied by phi 1.6cm is vertically fixed on an iron support, and a small amount of deionized water is added at the lower end of the column to remove air in the column. Closing a water outlet at the lower end of the column, reserving a small amount of deionized water in the column, tightly abutting the activated G-100 filler against the wall of the column for drainage by using a glass rod, slowly and continuously pouring the activated G-100 filler into the column, and pouring the activated G-100 filler into the column completely once as much as possible to prevent bubbles from being generated and layering from occurring. The filler liquid level is guaranteed to be always below the water level in the sedimentation process, when the filler naturally subsides to the liquid level and no longer changes, the peristaltic pump is opened and the column bed is punched with the deionized water at the elution flow rate of 1.2 times, the equilibrium flow rate can not be too big, prevent that the bottom of the column from being compacted to influence out water, and the equilibrium is reserved for 24 h.

(3) Loading and eluting:

250mg of each EPS component (primary purified polysaccharides EPS-0, EPS-0.1, EPS-0.3 and EPS-0.5) separated by the DEAE is respectively subjected to the following operations:

dissolving with 5mL deionized water to obtain solution with appropriate concentration, rotating at 8000r/min, centrifuging for 10min, collecting supernatant, and filtering with 0.45 μm water film. Sucking off excessive water above the column bed by using a dropper, slowly dripping the filtered polysaccharide solution on the surface of the filler, and naturally settling the polysaccharide solution into the filler. Then, elution was performed with deionized water (elution flow rate 0.25mL/min, volume of deionized water 1L), 5mL per tube. And (3) drawing an elution curve of the polysaccharide, combining the eluates, concentrating (1/40 rotary evaporated to the original volume at 60 ℃) and freeze-drying (freeze-drying for 24 hours at 60 ℃), and calculating the recovery rate of the corresponding component.

Recovery (%) × 100 (mass recovered of the component/amount of the sample added to the component) × 100

The recovery rates of EPS-0M, EPS-0.1M, EPS-0.3M and EPS-0.5M were 88%, 90%, 89% and 88%, respectively.

Example 4 analysis of polysaccharide chemical composition

1. Determination of the Total sugar content

The total sugar content of extracellular polysaccharides of Lactobacillus rhamnosus ZJM231 and of the purified fractions was determined by the phenol-sulfuric acid method (Dubois, M., Gilles, K.A., Hamilton, J.K., Rebers, P.A., & Smith, F.colorimetric method for determination of sugars and related substructures. analytical Chemistry 1956,28, 350-.

2. Determination of protein content

Measured using Coomassie Brilliant blue (Bradford, M.M.A. Rapid and sensitive method for the quantification of microorganisms of protein digestion the primary of protein-dye binding, analytical Biochemistry 1976,72, 248. 254.).

3. Determination of sulfate radical content

The sulfate content is determined by the turbidity method according to the literature (Kawai, Y., Seno, N., & Anno, K.A modified method for chlorine sulfate assay. analytical Biochemistry 1969,32, 314-.

4. Determination of uronic acid content

Uronic acid content was determined using the sulfuric acid-carbazole method with glucose as standard (Bitter, t., & Muir, h.m.a modified uronic acid vector reaction. analytical Biochemistry 1962,4, 330-.

5. Determination of monosaccharide composition

Monosaccharide composition was determined by GC-MS method (Shi, M.J., Wei, X.Y., Xu, J., Chen, B.J., ZHao, D.Y., Cui, S., Zhou, T.Carboxymethylated Polysaccharides from Enteromorpha prolifera: Preparation and in Vitro antibiotic activity. food Chemistry 2017,215, 76-83.).

The total sugar, protein, sulfate, uronic acid content of each purified fraction and the monosaccharide composition results of each fraction are shown in tables 1 and 2.

TABLE 1 chemical composition of each purified fraction

TABLE 2 monosaccharide composition contents of the components

Example 5 determination of molecular weight of Each component of exopolysaccharide EPS of Lactobacillus rhamnosus

Preparing a 1mg/mL standard solution: weighing 2mg of molecular weight 6.1X 10³、9.6×10³、2.1×10⁴、4.7×10⁴、1.07×10⁵、1.94×10⁵、3.37×10⁵、6.42×10⁵Da, in pramipexole polysaccharide standard, dissolved in 20mM sodium sulfate solution and filtered at 0.22 μm. And (3) drawing a pramipexole polysaccharide standard curve by taking the retention time of the pramipexole polysaccharide standard in HPGPC as an abscissa and taking a logarithmic value of the molecular weight of the standard as an ordinate.

Preparing a 1mg/mL lactobacillus rhamnosus exopolysaccharide solution by using a sodium sulfate solution, filtering, carrying out HPGPC analysis, and substituting the corresponding peak-out time of a polysaccharide sample into a standard curve to calculate the molecular weight of EPS. The peak-off time of each component is as follows: 17.602, 17.898, 17.587 and 17.084 minutes, and substituting into the praman polysaccharide standard curve regression equation: when y is-0.4785X +12.568, the molecular weights of EPS-0M, EPS-0.1M, EPS-0.3M and EPS-0.5M were found to be 1.40X 10⁴,1.01×10⁴,1.42×10⁴And 2.47X 10⁴Da。

Experiments, pharmacodynamic tests and results of polysaccharide and each component are as follows:

in vitro antioxidant experiment

1. And (3) measuring the iron reduction capacity: and (3) determining the reducing power of the EPS and each purified component by using a potassium ferricyanide method. The measurement of the reduction power of iron is commonly used for evaluating the total oxidation resistance of a sample, and the stronger the reduction power is, the stronger the oxidation resistance activity is. Under the antioxidant action of the sample, potassium ferricyanide ([ K3Fe (CN) 6)]) Is reduced to potassium ferrocyanide ([ K4Fe (CN) 6)]) The solution was yellow. Further reacting potassium ferrocyanide with Fe3+ in ferric chloride to generate ferric ferrocyanide, wherein the solution changes from yellow to blue-green with different degrees and has strong absorption peak at 700nm, the reduction force and the absorbance value are in positive correlation, and the larger the absorbance value is, the generated Fe²⁺The more, the better the reducing power of the sample. The results are shown in FIG. 2.

DPPH clearance assay: under the condition of keeping out of the light, 1mg/mL, 2mg/mL, 3mg/mL, 4mg/mL and 5mg/mL EPS and 2mL of each of the four purified polysaccharide solutions are respectively taken out of a test tube, 2mL of 0.1mM DPPH-ethanol solution is added, the mixture is fully shaken and then reacted in a water bath at 37 ℃ for 30min, and the absorbance value at 517nm is measured and recorded as A1 group. The DPPH solution in each tube of group A1 was replaced with 2mL of ethanol, and 2mL of the polysaccharide sample solution was added to measure the absorbance value, which was designated as A2. The absorbance values for 2mL of DPPH solution and 2mL of water are reported as A0. Vc was used as a positive control, and the absorbance value was measured at 517nm, in triplicate for each experiment. The results are shown in FIG. 2.

3. Determination of hydroxyl radical scavenging capacity: by adopting a salicylic acid method, 0.5mL of EPS and purified polysaccharide solution with different concentrations is taken, 0.5mL of 9mM FeSO4 solution and 0.5mL of 9mM salicylic acid-ethanol solution are added, after shaking up, 0.5mL of 9mM H2O2 solution is added, water bath reaction is carried out at 37 ℃ for 30min, and the absorbance value measured at 510nm is recorded as A1 group. The salicylic acid-ethanol solution in group A1 was changed to ethanol, and the remaining solution was unchanged, and the measurement value was recorded as group A2. The measurement of the sample in A1 when it was replaced with water was designated A0. Absorbance values were determined at 510nm with Vc as a positive control, with each experiment done in triplicate. The results are shown in FIG. 2.

4. Superoxide anion radical scavenging capacity determination: taking 0.2mL of each sample with different concentrations, adding 1mL of Tris-HCl buffer solution, carrying out water bath at 25 ℃ for 20min, then adding 1mL of 7mM pyrogallol solution, reacting for 5min, adding 0.2mL of 10M hydrochloric acid to stop the reaction, and measuring the absorbance value at 420nm as A1. The pyrogallol solution was replaced by water and the measurement was designated A2. The sample was replaced with water and the measurement was recorded as A0. The absorbance values were determined at 420nm with Vc as a positive control, with each experiment being run in triplicate. The results are shown in FIG. 2.

5. Determination of metal ion chelating capacity: 1mL of each polysaccharide sample with different concentrations was added with 0.1mL of 2mM FeCl2 solution, 0.2mL of 5mM feloxazine solution and 3.7mL of distilled water, and subjected to water bath at 30 ℃ for 10min, and the absorbance value at 562nm was A1. The phenazine solution was replaced by water and the measurement was recorded as A2. The sample solution was replaced with water and the measurement value was designated as A0. The absorbance values were determined in triplicate for each experiment using EDTA (ethylene diamine tetraacetic acid) as a positive control at 562 nm. The results are shown in FIG. 2.

As can be seen from FIG. 2, each component showed strong antioxidant capacity, and the antioxidant capacity of EPS and each component showed obvious concentration dependence. The polysaccharide component had a maximum DPPH clearance of 86% at a concentration of 5mg/mL, and the EPS-0.5M component had a stronger hydroxyl radical scavenging ability, superoxide anion radical scavenging ability, and metal ion chelating ability than the other components.

Secondly, analyzing the activity of extracellular polysaccharide-inhibited lipase:

and (3) measuring the inhibition rate of each purified component of the lactobacillus rhamnosus EPS on the lipase activity by a phenolphthalein indicator titration method. The lipase can hydrolyze triglyceride into fatty acid, diglyceride, monoglyceride and glycerol under certain conditions, the fatty acid released by hydrolysis can be neutralized and titrated by using a standard alkali NaOH solution, a phenolphthalein indicator solution is used for indicating the reaction end point, and the enzyme activity of a sample is calculated according to the consumed alkali amount. The results are shown in FIG. 3.

As can be seen from FIG. 3, each component after the separation and purification of the extracellular polysaccharide of Lactobacillus rhamnosus has an obvious inhibition effect on lipase, and the inhibition rates of each purified polysaccharide component of 5mg/mL on lipase are 20.93%, 25.37%, 34.67% and 35.94% respectively. The polysaccharides can reduce blood lipid through inhibiting lipase.

Cell experiments with HepG2

Effect of EPS on intracellular Cholesterol concentration in HepG2 cells

(1) Cell cholesterol molding concentration

The passaged cells were trypsinized, suspended, counted and plated at a final concentration of 2X 104 cells/mL in 96-well plates at 200. mu.L per well. Culturing at 37 ℃ for 24h, and sucking out the culture medium when the adherence of the cells reaches 60-70% and the monolayer of the cells is attached to the bottom of the pore plate. Changing a serum-free culture medium containing cholesterol solution with the concentration of 20 mug/mL, acting for 24 hours at 37 ℃, and then determining the intracellular cholesterol concentration according to the kit.

(2) Therapeutic effect of different polysaccharide fractions for lowering cholesterol

Grouping experiments: control group (normal cells before molding), blank group (model cell serum-free DMEM), positive control group (1 mu g/mL Sim solution), model cell drug-free treatment group (0 mu g/mL), purified fraction (100 mu g/mL, 200 mu g/mL, 400 mu g/mL, 800 mu g/mL). The supernatant from the high cholesterol model cells was aspirated and replaced with serum-free medium supplemented with various concentrations of therapeutic agents, 5 replicates per sample per concentration. Acting for 24h, and measuring the intracellular cholesterol concentration according to the kit.

(3) Determination of total cholesterol content in cells

After the culture is finished, removing the culture medium; washing with PBS for 3 times, and discarding the supernatant; adding 100 μ L of 0.25% pancreatin, and digesting for 2-3 min; digestion was stopped by adding 100. mu.L of complete medium and the cells were suspended. All suspensions in each well were transferred to a 1.5mL centrifuge tube and the bottom of the well plate was gently tapped several times to tap all the suspension as far as possible. 1500r/min, and centrifuging for 5 min. The supernatant was discarded, washed with 1mL PBS, 1500 rpm and centrifuged for 5 min. Cells were suspended in 500. mu.L PBS, sonicated, 300w, and then the intracellular cholesterol concentration was determined according to the kit. The results are shown in FIG. 4.

Effect of EPS on intracellular triglyceride concentration of HepG2

(1) Cellular triglyceride modeling concentration

The passaged cells in the logarithmic phase of growth were trypsinized, suspended, counted and seeded at a final concentration of 2X 104/mL in 96-well plates at 200. mu.L per well. Culturing at 37 ℃ for 24h, and sucking out the culture medium when the confluence degree of the cells reaches 60-70% and a cell monolayer is attached to the bottom of the pore plate. Serum-free medium with concentration of 50% is replaced and the reaction is carried out for 24h at 37 ℃.

(2) Therapeutic effect of different polysaccharide fractions on triglyceride reduction

Grouping experiments: control group (normal cells before molding), blank group (model cell serum-free DMEM), positive control group (1 mu g/mL Sim solution), model cell drug-free treatment group (0 mu g/mL), purified fraction (100 mu g/mL, 200 mu g/mL, 400 mu g/mL, 800 mu g/mL). The HTG model cells were treated by changing serum-free medium with different concentrations of therapeutic agents, each sample was applied for 24h in 5 duplicate wells per concentration.

(3) The intracellular TG content was determined according to the kit. The results are shown in FIG. 4.

As can be seen from FIG. 4, the low concentration (100. mu.g/mL) of EPS of each purified fraction exhibited a certain effect of reducing the cholesterol concentration, and the effect gradually increased with increasing EPS concentration, with the cholesterol level significantly reduced after 400. mu.g/mL of polysaccharide had been dried. The difference between groups is obvious, the neutral polysaccharide EPS-0M has the weakest effect, and the EPS-0.5M has the best effect. The intracellular triglyceride concentration without drug treatment was almost unchanged after 24h, and the low concentration (100. mu.g/mL) of EPS-purified fraction showed a lower triglyceride-lowering effect, with the TG-lowering effect increasing with increasing EPS concentration.

Human intestinal flora experiment

1. Batch fermentation of human fecal suspensions

(1) Preparing a YCFA culture medium: 3g of tryptone, 0.25g of yeast extract, 0.1g of L-cysteine, 200 mu L of heme solution (5mg/mL of sodium hydroxide solution), 0.09g of sodium chloride, 0.009g of calcium chloride hexahydrate, 0.045g of potassium dihydrogen phosphate, 0.045g of dipotassium hydrogen phosphate, 0.009g of magnesium sulfate heptahydrate and 20 mu L of vitamin I solution. An appropriate amount of glucose and EPS are accurately weighed and are respectively added into YCFA culture media as unique carbon sources, so that the final concentration is 8.0 g/L.

(2) Preparation of 5mg/mL heme solution: preparing 1mol/mL NaOH solution; accurately weighing 5mg of heme, dissolving with 1mol/mL NaOH solution, and diluting to 1 mL. Preparation of 40mL vitamin solution: 0.002g of biotin (VH), 0.002g of cobalamin (VB12), 0.006g of p-aminobenzoic acid, 0.01g of folic acid and 0.03g of pyridoxamine (VB 6).

(3) YCFA medium plus glucose: measuring 100mL of prepared YCFA culture medium by using a measuring cylinder, adding 800mg of glucose to enable the final concentration to be 8g/L, fully dissolving, subpackaging in small sealed glass bottles, sterilizing 5mL of each bottle at 121 ℃ for 20min under high pressure, and cooling to 80 ℃ to be placed in an anaerobic workstation.

(4) YCFA medium plus EPS purification components: measuring 4 parts by using a measuring cylinder to measure 100mL of prepared YCFA culture medium, respectively adding EPS-0 and EPS-0.1M, EPS-0.3M, EPS-0.5M 800mg to each part of four 100mL culture mediums to enable the final concentration to be 8g/L, fully dissolving, subpackaging into small sealed glass bottles, sterilizing 5mL of each bottle at 121 ℃, performing high pressure sterilization for 20min, and cooling to 80 ℃ to be placed into an anaerobic workstation.

2. Fecal sample collection

Stool samples were provided from 12 volunteers, 7 males, 5 females, aged between 20 and 60 years. These volunteers were well-qualified, free of chronic disease, and had no prebiotics, antibiotics, or other medications for at least three months prior to sampling. The study in this chapter was approved by the academy of agricultural sciences in Zhejiang province.

3. Treatment of fecal samples and fecal suspension fermentation

Feces samples from 12 volunteers were weighed, and 5g of each sample was dissolved in 50mL of PBS (autoclaved, 0.1M, pH: 7) to prepare 10% (W/V) feces homogenate suspension. After the fecal strain is dissolved, filtering the fecal strain suspension by using a filter screen, subpackaging the supernatant into a 15mL centrifuge tube and putting the centrifuge tube into an anaerobic workstation for later use.

The filtered sample supernatant was placed in an anaerobic workstation, and 12 groups of fecal solutions were rapidly inoculated into YCFA medium containing glucose (Glc), YCFA medium containing EPS-0M, YCFA medium supplemented with EPS-0.1M, YCFA medium supplemented with EPS-0.3M, and YCFA medium supplemented with EPS-0.5M, respectively, and 500. mu.L (10%) of fecal suspension was inoculated per 5mL of the medium. The remaining fecal suspension was sub-packaged in 1.5mL sterile centrifuge tubes and stored at-80 ℃ for future use.

After 24h of fermentation, 0.5mL of the fermentation broth was aspirated from each tube separately using a syringe in a sterile super clean bench into 1.5mL centrifuge tubes and frozen at-80 ℃ for sample preservation. Then 1.5mL of the suspension is respectively put into a sterile centrifuge tube, 10000r/min and 5min of centrifugation are carried out, and the precipitate and the supernatant are separated. Precipitating to obtain feces and thallus, sequencing DNA, and freezing at-80 deg.C; taking 500 μ L of supernatant for short-chain fatty acid content determination, and storing at-30 deg.C; the rest supernatant was dispensed by centrifuge tube for TLC analysis and stored at-30 deg.C.

4. Determination of influence of extracellular polysaccharide on gas production

The gas production effect of the exopolysaccharide on different intestinal flora can be known through measuring the air pressure. After inoculation of the fecal suspension, the air pressure in each vial was measured and recorded as 0 hours of air pressure. After 24h of fermentation, the gas pressure in the bottle at that time was measured without venting and recorded as 24 h. The results are shown in FIG. 5.

From fig. 5, it can be seen that: after 24 hours of fermentation, the gas production rate is smaller between groups of different carbon sources and within the groups. The gas production rates of the Glc, EPS-0M, EPS-0.1M, EPS-0.3M and EPS-0.5M groups were 21.2%, 23.7%, 17.4%, 17.3%, 26.1%, respectively. The gas production in the EPS-0.1M and EPS-0.3M groups was lower than that in the Glc group, and the EPS-0.5M group was the highest and both were within the normal range. This also indicates that exopolysaccharides have a good regulating effect on the gas production rate of the intestinal flora.

5. Determination of degradation Rate of extracellular polysaccharide

Thin Layer Chromatography (TLC) was used to analyze the degradation of polysaccharides in different media.

(1) Sample application: a10 cm X5 cm TLC aluminum plate was prepared and spotted at 1cm from the plate bottom. Left and right are left and right 5mm apart, with 2 spots per sample, spaced 5mm apart. 2 mul of fermentation supernatant stored at-30 ℃ was sucked onto an aluminum plate to ensure that each sample spot was kept at the same level, and dried with hot air.

(2) Unfolding: the sample is placed in the developer on the lower side, and the developer is soaked and spread from the bottom of the plate to the top of the plate. After 8min, the TLC plates were completely soaked with the developer, carefully removed with tweezers and all the liquid blown dry with hot air.

(3) Color development: and putting the dried TLC plate into a coloring agent for fully soaking for 5s, quickly taking out the TLC plate, and blowing the TLC plate dry by hot air until the TLC plate is completely developed.

(4) Scanning: converting the degradation condition of the polysaccharide into an image by a scanner, and then quantitatively calculating the polysaccharide residual quantity and the degradation rate in each polysaccharide sample by scanning and analyzing a TLC (thin layer chromatography) spectrum.

6. Gas chromatography detection of short chain fatty acids

The method comprises the steps of performing acid treatment on fermentation liquor by using crotonic acid as a solvent, and analyzing the influence of the content of short-chain fatty acid after each purified polysaccharide component of lactobacillus rhamnosus acts on intestinal microorganisms by using a gas chromatography and taking the retention time of a chromatographic-grade short-chain fatty acid standard substance in a gas chromatography column as a reference. The results are shown in FIG. 6.

(1) Pretreatment of fermentation liquor

Collecting supernatant of fermentation liquid stored at-30 deg.C, adding 100 μ L crotonic acid into each 500 μ L fermentation liquid, mixing, and storing at-30 deg.C overnight. The sample is taken out of the crotonic acid-fermentation liquid mixed solution in advance when the sample is loaded on the next day, after the crotonic acid-fermentation liquid mixed solution is melted, the mixed solution is centrifuged for 10min at 13000rpm and 4 ℃, then the supernatant is sucked by a 1mL syringe under the super clean bench sterile environment and filtered by a 0.22 mu m water film, and the filtrate is collected in a sterile 1.5mL centrifuge tube. And then sucking 80 mu L of filtrate from each tube into a gas phase sample bottle, covering the gas phase sample bottle tightly, lightly knocking on a table top to remove bubbles, and placing the gas phase sample bottle in a gas phase instrument groove to be tested.

(2) Gas chromatography for detecting concentration of short-chain fatty acid

And GC condition parameters are as follows: a DB-FFAP type gas chromatography column (0.32 mm. times.30 m. times.0.5 um) and H were used₂Flame ionization detector for detecting crotonic acidAs an internal standard. The gas chromatography sample inlet parameters are as follows: the sample introduction amount is 1 mu L, the temperature is 250 ℃, and the carrier gas type is N₂Purge flow 3.0ml/L, pressure 54.2kPa, split ratio 8: 1. control mode of linear speed: the linear velocity was 28.1cm/s, the total flow rate was 16.1mL/min, and the column flow rate was 1.46 mL/min.

As can be seen from FIG. 6, after 24 hours of fermentation, the carbon source is decomposed and utilized by intestinal flora, the total concentration of SCFAs in the four polysaccharide group samples is 18-40 mmol/L, the highest EPS-0.5M group is contained, and each group is higher than 15mmol/L of the Glc group in the control group. The acetic and propionic acid contents are greatest at the total SCFAs ratio. The difference of the acetic acid concentration of each group is not large, the content of the EPS group is higher than that of the Glc group, the difference between groups is small, the data is stable, and the direct relation of individual differences such as age and sex to the content of SCFAs is fully demonstrated. The difference of the propionic acid content between groups is not large, the EPS group is superior to the Glc group, and the content of EPS-0M and EPS-0.5M is the highest. Notably, the concentration of butyric acid was much higher in the EPS-0.1M group and EPS-0.5M group than in the EPS-0M group, EPS-0.3M group and Glc group.

7. Effect of exopolysaccharides on the Structure of intestinal flora

Taking feces and thallus precipitate frozen at minus 80 ℃, and extracting genome DNA from the feces fermentation sample precipitate by using a mixed bacteria indication box. 16S rDNA sequencing of all samples in this chapter of experiments was undertaken by the Mergiz Biotech Ltd of Shanghai. 16S rDNA sequencing was performed using the Illumina system with 338F-806R amplification primers, ACTCCTACGGGAGGCAGCAG F-terminus sequence, GGACTACHVGGGTWTCTAAT R-terminus sequence, and 30000 minimum single sample data size. The results are shown in FIG. 7.

As can be seen from FIG. 7, the Coverage index indicates that the probability of sequence detection in each set of samples in this sequencing is high, and can represent the actual condition of the microorganism in the sample. Sobs, Chao and Ace indexes show that the abundance of Alpha diversity of each sample in the intestinal flora is high, and the samples are similar among groups. The Shannon index with EPS-0.5M as the carbon source is the largest, which indicates that the community diversity in the samples is the highest. The trend of Simpson's index is inversely related to the Shannon's index, with the minimum Simpson's index using EPS-0.5M as the carbon source, followed by EPS-0M, fully indicating the highest community diversity in each of these two groups.

From the above results, it can be seen that: the in vitro antioxidant capacity, lipase inhibition rate, cholesterol triglyceride degradation rate and the influence on intestinal flora of EPS-0.5 in neutral polysaccharide EPS-0, acidic polysaccharide EPS-0.1, EPS-0.3 and EPS-0.5 are all higher than those of other components, and the activity is relatively better.

Comparative example, currently available Lactobacillus rhamnosus (as described in table 3 below), experiments were performed according to the above-described method of the present invention, and the antioxidant activity thereof was compared with the results of Lactobacillus rhamnosus (ZFM 231) of the present invention as described in table 3 below.

TABLE 3

Finally, it is also noted that the above-mentioned lists merely illustrate a few specific embodiments of the invention. It is obvious that the invention is not limited to the above embodiments, but that many variations are possible. All modifications which can be derived or suggested by a person skilled in the art from the disclosure of the present invention are to be considered within the scope of the invention.

Sequence listing

<110> Zhejiang university of industry and commerce

<120> lactobacillus rhamnosus exopolysaccharide, preparation method and used bacteria thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

actcctacgg gaggcagcag 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ggactachvg ggtwtctaat 20

Claims

1. Lactobacillus rhamnosus (Lactobacillus rhamnosus) strain characterized by: is Lactobacillus rhamnosus (Lactobacillus rhamnosus) ZFM231 with a preservation number of: CCTCC NO: M2019883.

2. The preparation method of the lactobacillus rhamnosus exopolysaccharide is characterized by comprising the following steps:

1) inoculating Lactobacillus rhamnosus (Lactobacillus rhamnous) ZFM231 with the preservation number of CCTCC NO: M2019883 into an M RS liquid culture medium according to the inoculation amount of 1% volume ratio, and performing constant-temperature culture and fermentation at the temperature of (37 +/-0.5) DEG for 12-48 h; obtaining a fermentation culture solution;

2) centrifuging the fermentation culture solution to obtain a supernatant, and removing protein to obtain a protein-removed supernatant;

3) extracting polysaccharide from the supernatant without protein by a water extraction and alcohol precipitation method to obtain a crude polysaccharide solution;

4) and dialyzing the crude polysaccharide solution, concentrating, and freeze-drying to obtain the lactobacillus rhamnosus exopolysaccharide EPS.

3. The method for preparing the exopolysaccharide of lactobacillus rhamnosus of claim 2, which is characterized in that:

the method for removing the protein in the step 2) comprises the following steps: adding trichloroacetic acid aqueous solution into the supernatant obtained by centrifugation to enable the trichloroacetic acid final concentration to be (4 +/-0.5) g/100ml, and standing for 10-14 h at the temperature of 3-5 ℃; centrifuging to remove the precipitate to obtain a supernatant without protein;

the water extraction and alcohol precipitation method in the step 3) comprises the following steps: concentrating the supernatant without the protein to 20-30% of the original volume, adding cold ethanol with the volume 4.5-5.5 times of that of the concentrated solution and at the temperature of 3-5 ℃, standing for 10-14 h at the temperature of 3-5 ℃, centrifuging, drying the precipitate obtained by centrifuging until the ethanol is volatilized, and adding sterile water for redissolving to obtain a crude polysaccharide solution;

4. The method for preparing the exopolysaccharide of lactobacillus rhamnosus of claim 3, which is characterized in that:

5. The method for preparing the lactobacillus rhamnosus exopolysaccharide of any one of claims 2 to 4, which is characterized by comprising the following steps: separating and purifying the obtained lactobacillus rhamnosus exopolysaccharide EPS, and sequentially carrying out the following steps:

roughly separating a DEAE Cellulose-52 chromatographic column:

respectively collecting 4 eluents corresponding to deionized water and NaCl solutions with the concentrations of 0.1mol/L, 0.3mol/L and 0.5mol/L, dialyzing, concentrating, freeze-drying, and respectively obtaining four kinds of primarily purified polysaccharides, wherein the four kinds of primarily purified polysaccharides are EPS-0, EPS-0.1, EPS-0.3 and EPS-0.5;

purifying by a Sephadex G-100 gel chromatographic column:

and concentrating and freeze-drying the obtained eluent to obtain corresponding purified polysaccharide components, wherein the purified polysaccharide components are EPS-0M, EPS-0.1M, EPS-0.3M and EPS-0.5M respectively.