CN111154658B - Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative - Google Patents

Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative Download PDF

Info

Publication number
CN111154658B
CN111154658B CN202010032262.1A CN202010032262A CN111154658B CN 111154658 B CN111154658 B CN 111154658B CN 202010032262 A CN202010032262 A CN 202010032262A CN 111154658 B CN111154658 B CN 111154658B
Authority
CN
China
Prior art keywords
novel
heteroterpene
derivative
compound
ethyl acetate
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202010032262.1A
Other languages
Chinese (zh)
Other versions
CN111154658A (en
Inventor
崔辉
唐渝茜
赵钟祥
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou University of Traditional Chinese Medicine
Original Assignee
Guangzhou University of Traditional Chinese Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Guangzhou University of Traditional Chinese Medicine filed Critical Guangzhou University of Traditional Chinese Medicine
Priority to CN202010032262.1A priority Critical patent/CN111154658B/en
Publication of CN111154658A publication Critical patent/CN111154658A/en
Application granted granted Critical
Publication of CN111154658B publication Critical patent/CN111154658B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00—Microorganisms ; Processes using microorganisms
    • C12R2001/645—Fungi ; Processes using fungi
    • C12R2001/66—Aspergillus
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/14—Fungi; Culture media therefor
    • C12N1/145—Fungal isolates
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
    • C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
    • C07D493/06—Peri-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D493/00—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system
    • C07D493/02—Heterocyclic compounds containing oxygen atoms as the only ring hetero atoms in the condensed system in which the condensed system contains two hetero rings
    • C07D493/10—Spiro-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07J—STEROIDS
    • C07J73/00—Steroids in which the cyclopenta[a]hydrophenanthrene skeleton has been modified by substitution of one or two carbon atoms by hetero atoms
    • C07J73/001—Steroids in which the cyclopenta[a]hydrophenanthrene skeleton has been modified by substitution of one or two carbon atoms by hetero atoms by one hetero atom
    • C07J73/003—Steroids in which the cyclopenta[a]hydrophenanthrene skeleton has been modified by substitution of one or two carbon atoms by hetero atoms by one hetero atom by oxygen as hetero atom
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07J—STEROIDS
    • C07J73/00—Steroids in which the cyclopenta[a]hydrophenanthrene skeleton has been modified by substitution of one or two carbon atoms by hetero atoms
    • C07J73/008—Steroids in which the cyclopenta[a]hydrophenanthrene skeleton has been modified by substitution of one or two carbon atoms by hetero atoms by two hetero atoms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/02—Oxygen as only ring hetero atoms
    • C12P17/06—Oxygen as only ring hetero atoms containing a six-membered hetero ring, e.g. fluorescein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/181—Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Medicinal Chemistry (AREA)
  • Mycology (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Botany (AREA)
  • Virology (AREA)
  • Diabetes (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Obesity (AREA)
  • Biomedical Technology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention discloses a marine fungus, a novel skeleton heteroterpene derivative prepared from the marine fungus, and a preparation method and application of the novel skeleton heteroterpene derivative. The marine fungus Aspergillus terreus GZU-31-1 is preserved in Guangdong province microorganism strain collection center in 2019, 12 and 17 days, and the preservation number is GDMCC No: 60789, 6 novel skeleton hetero-terpene derivatives are separated from the fermentation liquor, the structure is novel, and simultaneously the activity of reducing triglyceride is remarkable, especially the compound 1-5, when the concentration is 2 μ M and 5 μ M, the content of triglyceride in the cell is remarkably reduced, especially the compound 1, the lipid-lowering activity of the compound 1 under the concentration of 5 μ M is even better than that of positive control berberine under the same concentration; the compound has great application value in the aspect of reducing blood fat, and can be prepared into a blood fat reducing medicament for application.

Description

Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative
Technical Field
The invention relates to the technical field of medical compounds, in particular to a marine fungus, a novel skeleton heteroterpene derivative prepared from the marine fungus, and a preparation method and application of the novel skeleton heteroterpene derivative.
Background
Cardiovascular diseases are one of the diseases with high mortality rate of human beings, the number of deaths caused by cardiovascular diseases is about 1700 thousands each year, and the annual morbidity and mortality rate tend to rise year by year along with the improvement of living standard of people. Hyperlipidemia is one of the important factors inducing cardiovascular diseases, and the most direct harm of hyperlipidemia is atherosclerosis, coronary heart disease, obesity, diabetes and other diseases. Triglyceride is an important index parameter of hyperlipidemia, and the level of triglyceride can directly reflect the degree of hyperlipidemia. At present, lipid-lowering drugs which are commonly used clinically mainly comprise statins, fibrates and nicotinic acid, and particularly statins are widely applied. However, the long-term use of these drugs and the related research results show that the adverse reactions such as rhabdomyolysis, liver and kidney injury and the like bring serious pain to patients. Therefore, in order to solve the adverse reaction caused by the drugs, the search for novel lipid-lowering drugs is an urgent need for research.
Aspergillus terreus is an important species in Aspergillus, and secondary metabolites thereof are mainly butralin lactones, diterpenes, terpenoids, alkaloids and the like. As early as 1987, the first HMG-CoA reductase inhibitor lipid-lowering drug lovastatin, which was approved by the FDA and marketed by the American Merck company, was highly favored by patients due to its potent cholesterol-lowering effect. Among them, lovastatin is a representative structure of diterpenoid derivatives, and is derived from the secondary metabolite of the fungus Aspergillus terreus. In view of the fact that the fungus Aspergillus terreus has the characteristics of sustainability, environmental friendliness, large-scale preparation, abundant and diverse metabolites and the like, the fungus Aspergillus terreus is always an important source for drug screening. Therefore, the novel hypolipidemic component and other active components are searched from the secondary metabolite of Aspergillus terreus, and the potential is great.
Disclosure of Invention
The invention aims to provide a marine fungus strain. The marine fungus Aspergillus terreus GZU-31-1 is separated from coastal dorsal litterse bodies, and a novel skeleton diterpenoid derivative with a novel structure can be separated from fermentation liquor of the coastal litterse bodies; the compound can reduce the generation of triglyceride, has significant effect on reducing blood fat and has great market prospect in preparing lipid-lowering medicaments.
The second purpose of the invention is to provide the application of the marine fungus in preparing novel skeleton heteroterpene derivatives.
A third object of the present invention is to provide novel skeletal heteroterpene derivatives produced by fermentation of said marine fungi.
The fourth object of the present invention is to provide the isolation method of the hetero terpene derivatives having a novel skeleton.
The fifth purpose of the invention is to provide the application of the novel skeleton heteroterpene derivative from the marine fungi.
The above object of the present invention is achieved by the following scheme:
a marine fungus Aspergillus terreus GZU-31-1 is deposited in Guangdong province microorganism culture collection center in 2019 at 12 and 17 months, and the deposit number is GDMCC No: 60789.
the invention also protects the application of the marine fungus Aspergillus terreus GZU-31-1 in preparing lipid-lowering medicines.
Preferably, the marine fungus Aspergillus terreus GZU-31-1 is used for preparing the heteroterpene derivatives.
Also within the scope of the present invention is a novel backbone heteroterpene derivative represented by one of the following structural formulae:
Figure BDA0002364757990000021
the invention also provides a preparation method of the novel skeleton heteroterpene derivative, and the novel skeleton heteroterpene derivative is separated from the compound with the preservation number of GDMCC No: 60789A fermentation broth of Aspergillus terreus GZU-31-1.
Preferably, the isolation process of the novel skeletal diterpene derivative is:
s1, carrying out amplification culture on marine fungus Aspergillus terreus GZU-31-1, extracting the obtained thalli with methanol to obtain an extracting solution, concentrating, and extracting with ethyl acetate to obtain an ethyl acetate crude extract;
s2, separating and purifying the ethyl acetate crude extract by normal phase silica gel chromatography, performing gradient elution on the ethyl acetate crude extract with a mobile phase of petroleum ether/ethyl acetate, and collecting fractions with a ratio of the petroleum ether/ethyl acetate of 10: 90-50: 50; concentrating, separating with silica gel column chromatography with mobile phase of dichloromethane/methanol to obtain fraction F1, fraction F2, compound 1 and compound 5;
s3, separating the fraction F1 through a gel chromatography LH-20 column, wherein the mobile phase is chloroform/methanol, and obtaining compounds 2 and 6;
fraction F2 was separated by HPLC reverse phase chromatography on MeOH/H as the mobile phase2O, collecting the fraction with the retention time of 23.1 min absorption peak, namely compound 3; the fraction having the absorption peak with the retention time of 25.0 minutes was collected as compound 4.
Preferably, in step S1, the specific process of the expanding culture is:
s11, fungal seed culture: inoculating Aspergillus terreus GZU-31-1 to a slant culture medium, and culturing to obtain a seed solution;
s12, fungus fermentation culture: inoculating the cultured seed liquid into a solid rice culture medium, standing at 28-35 ℃ for 1-2 months, and fermenting.
Preferably, in step S11, the formula of the slant culture medium is: 0.3 percent of glucose, 0.1 percent of yeast extract, 0.1 to 0.5 percent of peptone, 1.5 to 2.5 percent of agar, 1.5 to 4 percent of sodium chloride and the balance of water to 100 percent.
Preferably, the culture temperature of the step S11 is 28-35 ℃, and the culture time is 4-10 days; more preferably, the cultivation temperature is 30 ℃ and the cultivation time is 6 days.
Preferably, in step S12, the solid rice culture medium is prepared from rice and seawater in a mass ratio of 1: 1-2; the temperature is 28-35 ℃, and the time is 1-2 months. The seawater can be normal seawater.
Preferably, in step S12, the temperature for the scale-up culture is 35 ℃ and the culture time is 2 months.
Preferably, in step S2, during the normal phase silica gel chromatographic separation and purification process, the ratio of the mobile phase petroleum ether/ethyl acetate is 10:90, 20:80, 30:70, 40:60, 50:50, 60:40 and 70:30 in sequence.
Preferably, in step S2, the ratio of mobile phase dichloromethane/methanol is 100: 1.
Preferably, in step S3, the ratio of chloroform/methanol in the mobile phase during the separation by gel chromatography LH-20 column is 1: 1.
Preferably, in step S3, the HPLC reverse phase chromatographic column separation is performed by using ZORBA SB-C18 column (250X 9.4mm,5 μm, Agilent), mobile phase MeOH/H2The volume ratio of O was 45:55, and the flow rate was 1.0 mL/min.
The invention also protects the application of the novel skeleton heteroterpene derivative in preparing lipid-lowering medicaments.
Preferably, the use of the novel backbone heteroterpene derivatives for the manufacture of a medicament for lowering triglycerides.
Compared with the prior art, the invention has the following beneficial effects:
the marine fungus Aspergillus terreus GZU-31-1 is separated from coastal dorsal litterse trunks and is preserved in Guangdong province microorganism strain preservation center in 2019, 12 and 17 days, and the preservation number is GDMCC No: 60789, respectively;
6 novel skeleton heteroterpene derivatives can be separated from the fermentation liquor of the marine fungus Aspergillus terreus GZU-31-1, have novel structures, and simultaneously have the activity of remarkably reducing triglyceride, especially the compounds 1-5, when the concentration of the derivatives is 2 mu M and 5 mu M, the content of triglyceride in cells is remarkably reduced, especially the compound 1 has the lipid-lowering activity at the concentration of 5 mu M and is even better than that of positive control berberine at the same concentration; the compound has great application value in the aspect of reducing blood fat, and can be prepared into a blood fat reducing medicament for application.
Drawings
FIG. 1 shows the effect of compounds on the triglyceride content of cells.
Figure 2 is the safety results of the compounds against cells.
Detailed Description
The present invention is further described in detail below with reference to specific examples, which are provided for illustration only and are not intended to limit the scope of the present invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.
EXAMPLE 1 obtaining of the Marine fungus Aspergillus terreus GZU-31-1
1. Separation of the strains: the inventor group is obtained by separating and purifying the body of Kadsura longipedunculata in Xuweng coast of Zhanjiang province, and separating to obtain a strain of marine fungus Aspergillus terreus GZU-31-1.
The specific separation process is as follows: washing Onchidium struma with clear water, sterilizing the surface with 1% sodium hypochlorite water solution for 30 s, and taking out. Then sterilized with 75% alcohol for 30 seconds, and then washed with clean water. The slices are placed on a Bengal red culture medium for culture and growth until a single colony grows.
2. Identification of strains
Aspergillus terreus GZU-31-1 strain appears as a yellow filamentous fungal colony on PDA medium.
And (3) molecular identification:
the fungus was identified by DNA amplification and sequencing of the ITS region of the fungus, step specific references (Nature protocols,2010,5, 480-: extracting DNA by adopting a DNeasy Plant Mini Kit according to the steps of the instruction, carrying out PCR amplification by taking ITS as a primer, and sequencing the amplified product, wherein the sequence is as follows: ccttccgtaggtgaacctgcggaaggatcattaccgagtgcgggtctttatggcccaacctcccacccgtgactattgtaccttgttgcttcggcgggcccgccagcgtttgctggccgccggggggcgactcgcccccgggcccgtgcccgccggagaccccaacatgaaccctgttctgaaagcttgcagtctgagtgtgattctttgcaatcagttaaaactttcaacaatggatctcttggttccggcatcgatgaagaacgcagcgaaatgcgataactaatgtgaattgcagaattcagtgaatcatcgagtctttgaacgcacattgcgccccctggtattccggggggcatgcctgtccgagcgtcattgctgccctcaagcccggcttgtgtgttgggccctcgtcccccggctcccgggggacgggcccgaaaggcagcggcggcaccgcgtccggtcctcgagcgtatggggcttcgtcttccgctccgtaggcccggccggcgcccgccgacgcatttatttgcaacttgttttttttccaggttgacctcggatcaggtagggatacccgctgaacttaagcatatcaataagcggaggaa are provided.
The sequenced sequence was subjected to similarity search using BLAST database, and compared to 100% with the Aspergillus terreus fungal sequence, the fungus was identified as the marine fungus Aspergillus terreus GZU-31-1.
The strain is preserved in Guangdong province microorganism culture collection center (GDMCC) in 2019, 12 months and 17 days, and the preservation number is GDMCC No: 60789.
example 2 isolation of the Compounds
A novel skeleton hetero-terpenoid derivative is separated from fermentation liquor of Aspergillus terreus GZU-31-1, and the specific method comprises the following steps:
(1) seed culture of the fungus Aspergillus terreus GZU-31-1: the culture medium comprises the following components in percentage by weight: 0.3 percent of glucose, 0.1 percent of yeast extract, 0.5 percent of peptone, 2.5 percent of agar, 3 percent of sodium chloride and 98 percent of water; preparing a test tube inclined plane, selecting a strain, inoculating the strain into the inclined plane, and culturing for 6 days at 30 ℃;
(2) fermentation culture of the fungus Aspergillus terreus GZU-31-1: utilizing a solid rice fermentation medium: rice: 1, sea water: 1 (mass ratio); inoculating the strain in the seed into a fermentation culture medium, and standing at room temperature of 35 ℃ for 2 months;
(3) extracting the fermented thallus with methanol for 3 times, concentrating the extractive solution, and extracting the obtained concentrated extract with ethyl acetate to obtain ethyl acetate crude extract;
(4) separating the ethyl acetate crude extract by normal phase silica gel chromatography; eluting with petroleum ether/ethyl acetate according to the proportion of 10:90, 20:80, 30:70, 40:60, 50:50, 60:40 and 70:30 in sequence, collecting fractions of 10: 90-50: 50 of ethyl acetate and petroleum ether, merging the fractions, and performing spin drying to obtain 15 g of crude extract; performing silica gel column chromatography, eluting with dichloromethane/methanol at a ratio of 100:1 as mobile phase to obtain fraction F1, fraction F2, compound 1 and compound 5;
(5) wherein fraction F1 was separated by gel chromatography on LH-20 (chloroform/methanol ═ 1:1) column to give compounds 2 and 6; fraction F2 was purified by HPLC reverse phase column ZORBA SB-C18 column (250X 9.4mm,5 μm, Agilent), mobile phase conditions (MeOH/H)2O45: 55, v/v, flow rate 1.0mL/min), and an absorption peak (compound 3) at a retention time of 23.1 minutes and an absorption peak (compound 4) at 25.0 minutes were collected to obtain compounds 1 to 6.
Structural analysis of the Compound of example 3
The following experimental data were obtained by performing structural testing and analysis on the new compounds 1 to 6:
novel compound 1: c28H32O10，HRESI-MS：527.1912[M-H]-(cald for C28H31O10 527.1917)。
Novel compound 2: c28H32O10，HRESI-MS：527.1913[M-H]-(cald for C28H31O10 527.1917)。
Novel compound 3: c28H32O10，HRESI-MS：527.1914[M-H]-(cald for C28H31O10 527.1917)。
Novel compound 4: c28H34O10，HRESI-MS：529.2056[M-H]-(cald for C28H33O10 529.2073)。
Novel compound 5: c28H34O11，HRESI-MS：545.2022[M-H]-(cald for C28H33O11 545.2022)。
Novel compound 6: c28H32O11，HRESI-MS：543.1932[M-H]-(cald for C28H31O11 543.1932)。
The structural formulas and nuclear magnetic data of compounds 1-6 are shown below:
Figure BDA0002364757990000061
TABLE 1 NMR data (CDCl) of Compounds 1-33，400MHz/100MHz,ppm)
Figure BDA0002364757990000062
Figure BDA0002364757990000071
TABLE 2 NMR data (CDCl) of Compounds 4-63,400MHz/100MHz,ppm)
Figure BDA0002364757990000072
Figure BDA0002364757990000081
EXAMPLE 4 lipid-lowering cell screening model and toxicity Studies of Compounds 1-6
1. Cell culture
3T3-L1 preadipocytes were cultured in complete medium (DMEM medium supplemented with 10% fetal bovine serum, 100U/mL penicillin, 100. mu.g/mL streptomycin) at 37 ℃ with 5% CO by volume2Cultured in an incubator.
2. Adipocyte differentiation
Differentiation of preadipocytes 3T3-L1 by the following steps:
(1) cells were plated in 48-well plates, cultured in complete medium to complete contact (day 0), and the medium was changed to differentiation medium I (complete medium supplemented with 2. mu.g/mL insulin, 100ng/mL dexamethasone, 0.5mM 3-isobutyl-1-methylxanthine and 10ng/mL biotin) for induced differentiation for 3 days. The blank control group was still cultured using complete medium.
(2) On day 3, the culture was continued for 3 days by changing to differentiation medium II (complete medium supplemented with 2. mu.g/mL of insulin). The blank control group was still cultured using complete medium.
(3) On day 6, cells were harvested for subsequent analysis.
The test compound is prepared into 10mM mother solution by DMSO, and is diluted into working solution with different concentrations during testing. To correct for the effect of the mother liquor solvent DMSO, the blank was supplemented with 0.1% DMSO.
3. Triglyceride testing
Treated 3T3-L1 cells, ice PBS (0.2M NaCl, 10mM Na)2HPO4，3mM KCl，2mM KH2PO4pH 7.4) was washed twice,cells were disrupted by sonication, and the content of triglyceride in the cell disruption solution was measured using a triglyceride kit. The results are expressed as a percentage of triglyceride content in the blank cells (i.e. triglyceride content of experimental/triglyceride content of blank x 100%). The experimental results are the average of three independent experiments. Wherein the positive control group BBR is berberine.
The results are shown in FIG. 1. Vehicle in fig. 1 is a molding set.
4. Cytotoxicity screening
(1) The chemical name of MTT is 3- (4, 5-dimethylthiazole-2) -2, 5-diphenyl tetrazole bromide salt determined by an MTT method, and the commercial name is as follows: thiazole blue. The detection principle is as follows: the live and dead cells differ in that the presence of succinate dehydrogenase in the mitochondria in live cells reduces exogenous MTT to the water-insoluble blue crystalline formazan. Dimethyl sulfoxide (DMSO) can solubilize the formazan deposited within the cells, whose absorbance, measured at 490 or 540nm wavelength depending on the intervening and positive control groups to which the compound was added, can indirectly reflect the number of cells surviving.
(2) The method comprises the following specific steps: HEK 293T cells were cultured in DMEM medium containing 10% serum and placed in 5% CO2The temperature was set at 37 ℃. After the cells had stabilized after one generation of culture, they were plated in 96-well plates at a concentration of 2X 104cells/well, attached for 24 hours. The compound mother liquor is dissolved in DMSO and diluted by DMEM medium, and the DMSO concentration is ensured not to be higher than 0.1%. Samples at concentrations of 10. mu.M and 5. mu.M were applied to 96-well plates (200. mu.L). After 24 hours incubation, 20. mu.L of MTT solution (2.5mg/mL in PBS) was added to each well and incubation was continued for 4 hours, the incubation was terminated and the supernatant carefully aspirated, 100. mu.L of DMSO was added to each well and shaken for 10min to dissolve the crystals sufficiently. The 490nm wavelength absorption was detected by a microplate reader and the results recorded. The inhibition rate was calculated by the following formula: inhibition ratio (%) [ (A)Experiment of–ABlank space)/(AControl–ABlank space)]X 100%, wherein A is the absorbance OD value of the sample.
The results are shown in FIG. 2.
As can be seen from FIG. 2, the compounds 1 to 6 of the present invention are not toxic to 3T3-L1 cells; in combination with the results shown in FIG. 1, it can be seen that compounds 1-6 have significant effect of reducing the content of triglyceride in cells, especially compounds 1-5, when the concentration is 2 μ M and 5 μ M, the content of triglyceride in cells is significantly reduced, especially compound 1, which has better lipid-lowering activity at 5 μ M concentration than the positive control berberine at the same concentration; therefore, the compound has great application value in the aspect of reducing blood fat, and can be prepared into a blood fat reducing medicament for application.
It should be finally noted that the above examples are only intended to illustrate the technical solutions of the present invention, and not to limit the scope of the present invention, and that other variations and modifications based on the above description and thought may be made by those skilled in the art, and that all embodiments need not be exhaustive. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention should be included in the protection scope of the claims of the present invention.
Sequence listing
<110> Guangzhou college of traditional Chinese medicine (Guangzhou institute of traditional Chinese medicine)
<120> a strain of marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative
<160> 1
<170> SIPOSequenceListing 1.0
<210> 2
<211> 614
<212> DNA
<213> Aspergillus fungus (Aspergillus terreus GZU-31-1)
<400> 2
ccttccgtag gtgaacctgc ggaaggatca ttaccgagtg cgggtcttta tggcccaacc 60
tcccacccgt gactattgta ccttgttgct tcggcgggcc cgccagcgtt tgctggccgc 120
cggggggcga ctcgcccccg ggcccgtgcc cgccggagac cccaacatga accctgttct 180
gaaagcttgc agtctgagtg tgattctttg caatcagtta aaactttcaa caatggatct 240
cttggttccg gcatcgatga agaacgcagc gaaatgcgat aactaatgtg aattgcagaa 300
ttcagtgaat catcgagtct ttgaacgcac attgcgcccc ctggtattcc ggggggcatg 360
cctgtccgag cgtcattgct gccctcaagc ccggcttgtg tgttgggccc tcgtcccccg 420
gctcccgggg gacgggcccg aaaggcagcg gcggcaccgc gtccggtcct cgagcgtatg 480
gggcttcgtc ttccgctccg taggcccggc cggcgcccgc cgacgcattt atttgcaact 540
tgtttttttt ccaggttgac ctcggatcag gtagggatac ccgctgaact taagcatatc 600
aataagcgga ggaa 614

Claims (8)

1. A novel backbone heteroterpene derivative, wherein said derivative is represented by one of the following structural formulae:
Figure FDA0003319364300000011
2. use of the marine fungus Aspergillus terreus GZU-31-1 for the preparation of a novel skeletal diterpene derivative according to claim 1, wherein the marine fungus Aspergillus terreus GZU-31-1 is deposited at 2019, 12 and 17 days in Guangdong province with the deposit number GDMCC No: 60789.
3. the process for the preparation of the novel skeletal diterpene derivatives of claim 1, wherein the novel skeletal diterpene derivatives are isolated from the plant with the accession number GDMCC No: 60789A fermentation broth of Aspergillus terreus GZU-31-1.
4. The process for the preparation of the novel skeletal diterpene derivatives according to claim 3, wherein the isolation of the novel skeletal diterpene derivatives is carried out by:
s1, carrying out amplification culture on marine fungus Aspergillus terreus GZU-31-1, extracting the obtained thalli with methanol to obtain an extracting solution, concentrating, and extracting with ethyl acetate to obtain an ethyl acetate crude extract;
s2, separating and purifying the ethyl acetate crude extract by normal phase silica gel chromatography, performing gradient elution on the ethyl acetate crude extract with a mobile phase of petroleum ether/ethyl acetate, and collecting fractions with a ratio of the petroleum ether/ethyl acetate of 10: 90-50: 50; concentrating, separating with silica gel column chromatography with mobile phase of dichloromethane/methanol to obtain fraction F1, fraction F2, compound 1 and compound 5;
s3, separating the fraction F1 through a gel chromatography LH-20 column, wherein the mobile phase is chloroform/methanol, and obtaining compounds 2 and 6;
fraction F2 was separated by HPLC reverse phase chromatography on MeOH/H as the mobile phase2O, collecting the fraction with the retention time of 23.1 min absorption peak, namely compound 3; collecting the fraction with the retention time of 25.0 min absorption peak to obtain compound 4;
Figure FDA0003319364300000021
5. the method for preparing a novel skeletal terpenoid derivative according to claim 4, wherein in step S1, the expanded culture is performed by using a solid rice culture medium prepared from rice and seawater in a mass ratio of 1: 1-2; the temperature is 28-35 ℃, and the time is 1-2 months.
6. The method for preparing novel skeletal diterpene derivatives according to claim 4, wherein in step S2, the ratio of petroleum ether/ethyl acetate in mobile phase is 10:90, 20:80, 30:70, 40:60, 50:50, 60:40 and 70:30 in sequence during the normal phase silica gel chromatography separation and purification process.
7. The application of the novel skeleton heteroterpene derivative in preparing the lipid-lowering medicine is characterized in that the novel skeleton heteroterpene derivative is shown as one of the following structural formulas:
Figure FDA0003319364300000031
8. use according to claim 7, wherein the novel backbone heteroterpene derivatives are used in the manufacture of a triglyceride lowering medicament.
CN202010032262.1A 2020-01-13 2020-01-13 Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative Active CN111154658B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010032262.1A CN111154658B (en) 2020-01-13 2020-01-13 Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010032262.1A CN111154658B (en) 2020-01-13 2020-01-13 Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative

Publications (2)

Publication Number Publication Date
CN111154658A CN111154658A (en) 2020-05-15
CN111154658B true CN111154658B (en) 2021-11-26

Family

ID=70562916

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010032262.1A Active CN111154658B (en) 2020-01-13 2020-01-13 Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative

Country Status (1)

Country Link
CN (1) CN111154658B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN111407764B (en) * 2020-03-27 2021-09-10 广州中医药大学(广州中医药研究院) Application of heteroterpene derivative in preparation of medicine for resisting non-alcoholic steatohepatitis and hepatic fibrosis
CN112646729B (en) * 2020-11-26 2022-06-10 中山大学 Sea squirt-derived fungus and application thereof
CN113121557B (en) * 2021-03-01 2022-06-17 广州中医药大学(广州中医药研究院) Marine fungus-derived heterpene compound and application thereof in preparation of anti-inflammatory drugs
CN113173969B (en) * 2021-03-01 2022-06-17 广州中医药大学(广州中医药研究院) Marine fungus-derived heteroterpene compound and application thereof in preparation of anti-hepatic fibrosis drugs

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR100573632B1 (en) * 2003-10-30 2006-04-24 한국생명공학연구원 A novel compound inhibiting acetylcholine esterase produced by Aspergillus terreus Fb501
US8383128B2 (en) * 2008-03-07 2013-02-26 Indian Institute Of Science Method of protecting plant(s) and a process thereof
CN108277164B (en) * 2017-12-28 2019-08-20 中山大学 A kind of indene derivatives derived from endophytic fungi in Excoecaria agallocha and its application in preparing anti-inflammatory drugs
CN111139188B (en) * 2020-01-08 2021-11-26 广州中医药大学(广州中医药研究院) Novel skeleton heteroterpene derivative derived from marine fungi and application of novel skeleton heteroterpene derivative in preparation of anti-inflammatory drugs

Also Published As

Publication number Publication date
CN111154658A (en) 2020-05-15

Similar Documents

Publication Publication Date Title
CN111154658B (en) Marine fungus, novel skeleton heteroterpene derivative prepared from marine fungus, and preparation method and application of novel skeleton heteroterpene derivative
CN111139188B (en) Novel skeleton heteroterpene derivative derived from marine fungi and application of novel skeleton heteroterpene derivative in preparation of anti-inflammatory drugs
CN113121557B (en) Marine fungus-derived heterpene compound and application thereof in preparation of anti-inflammatory drugs
CN111321095B (en) Butenolide dimer with alpha-glucosidase inhibition effect and application thereof
CN112028964B (en) Betulinic acid derivative and preparation method and application thereof
CN110117546B (en) Naphthoquinone compound derived from marine fungi and anti-inflammatory application thereof
CN111407764B (en) Application of heteroterpene derivative in preparation of medicine for resisting non-alcoholic steatohepatitis and hepatic fibrosis
CN113173969B (en) Marine fungus-derived heteroterpene compound and application thereof in preparation of anti-hepatic fibrosis drugs
CN105274152B (en) Curcumin biotransformation method, product and application
CN110698441B (en) 2-methyl-4- (1-glycerol) -furan compounds and preparation method and application thereof
CN112961783A (en) Plant endophytic fungus and application thereof in preparation of spironolactone derivative
CN108441427B (en) Arthriospora fungi and pyridone alkaloid compound produced by same
CN113004237A (en) Spiro compound and preparation method and application thereof
CN110092794A (en) The method and application of chaetomium globosum QY-1 separation and Extraction chaetomium globosum A
CN111235042A (en) Butenolide dimer with COX-2 inhibition and antioxidation effects and application thereof
CN111233694A (en) Linear polyketone compound with blood fat reducing effect and preparation method and application thereof
CN110368389A (en) The preparation method and applications and Claritin of phenolic compound
CN115385878B (en) Natural active compound moenofuran and preparation method and application thereof
CN104447475B (en) Preparation method and application of penicillenol D1 derived from penicillium citrinum
CN115894180B (en) Method for separating mycotoxin from metabolite of black spot bacteria of ginseng
CN114009452B (en) Application of fermentation broth of alternaria alternata JTF001 in inhibition of germination of seeds of orobanum cucurbitacearum
CN107935819B (en) Polyoxy-substituted cyclohexene derivative and application thereof
JPS6084220A (en) Antitumor agent containing phizoxin which is metabolite of plant pathogenic germ phizopus chinensis
CN112778262B (en) Plant-derived quassin and preparation method and application thereof
CN115584330A (en) Nocardiopsis, compound Novofuran and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant