CN111118064A

CN111118064A - Animal model for dysspermia and preparation method and application thereof

Info

Publication number: CN111118064A
Application number: CN201911346372.9A
Authority: CN
Inventors: 赵杰; 单嘉杰; 王键; 于才勇; 方莲; 曹倚慧
Original assignee: South China University of Technology SCUT
Current assignee: South China University of Technology SCUT
Priority date: 2019-12-24
Filing date: 2019-12-24
Publication date: 2020-05-08
Anticipated expiration: 2039-12-24
Also published as: CN111118064B

Abstract

The invention provides a spermatogenesis deficiency animal model and a preparation method and application thereof. The invention discovers that the over-expression of PD-L1 has an interference effect on the process of spermatogenesis and maturation for the first time, and provides that PD-L1 can be used as a target for treating spermatogenesis deficiency diseases. Meanwhile, a construction method of a spermatogenesis deficiency animal model is provided, the animal model is obtained by over-expressing PD-L1; the construction method only changes the expression of the PD-L1 gene, and does not directly influence the expression of other genes of the animal model and influence other phenotype changes of the animal model; meanwhile, the method has good repeatability, is simple and feasible, can specifically and efficiently enhance the expression of the PD-L1 gene, and the constructed animal model is stable. The invention provides important animal basis, experimental materials and new ideas for related scientific research and clinical diagnosis and treatment of spermatogenesis dysfunction, and has important value and significance for clinical treatment of infertility.

Description

Animal model for dysspermia and preparation method and application thereof

Technical Field

The invention belongs to the technical field of medical engineering, and particularly relates to a spermatogenesis deficiency animal model and a preparation method and application thereof.

Background

At present, two main techniques are used for constructing mice with spermatogenesis deficiency: firstly, inducing the animal model of the spermatogenesis dysfunction mainly by feeding or injecting medicines, hormones and other methods; however, the induced animal model is easily unstable and the experimental repeatability is poor due to a lot of external interference factors, for example, the factors such as the batch of experimental animals and the stability of chemical reagents. Secondly, the most of the genes of a certain transcription factor are knocked out to form a gene-deficient animal model, such as Sox30^-/-A mouse model, wherein a transcription factor gene knockout mouse model is formed by interfering a certain transcription factor(s); however, since the transcription factor generally involves the expression regulation of a plurality of genes, the expression of a plurality of genes regulated by the transcription factor is changed, and the phenotypes of the constructed animal models are diversified, the phenotype generated by the transcription factor gene knockout mouse model may not be merely the spermatogenesis deficiency, and more negative effects are accompanied.

Therefore, how to construct and obtain a spermatogenesis deficiency animal model with definite phenotype and stable model by a method which is simple and easy to implement and good in repeatability has important significance for discovery of pathogenic genes of animal spermatogenesis and maturation inhibition and research of pathogenic mechanisms and clinical treatment of male infertility.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides the application of PD-L1 as a target point in screening or preparing a medicament for treating spermatogenesis deficiency diseases.

The invention also aims to provide a construction method of the animal model of the spermatogenesis deficiency.

It is yet another object of the present invention to provide an animal model of dysspermia.

The invention further aims to provide application of the animal model for the spermatogenesis deficiency.

The purpose of the invention is realized by the following technical scheme:

the application of PD-L1 (programmed death ligand-1) as a target point in screening or preparing a medicament for treating spermatogenesis deficiency diseases; the inventor firstly discovers that the over-expression of PD-L1 has interference effect on the process of spermatogenesis and maturation.

A construction method of a spermatogenesis deficiency animal model is obtained by over-expressing PD-L1 in an animal body.

The specific operation of the construction method of the animal model with the spermatogenesis deficiency is preferably as follows: constructing a recombinant expression vector containing a PD-L1 gene coding region sequence, injecting the expression vector into animal cells to over-express PD-L1 and performing embryo transplantation, thereby obtaining the animal model of the spermatogenesis deficiency.

The expression vector is preferably a mammalian cell expression vector; more preferably a pCAGGS vector.

The injection is preferably a prokaryotic injection.

The animal cell is preferably a fertilized egg.

The animal is preferably a murine animal.

The specific operation steps of constructing the recombinant expression vector containing the PD-L1 gene coding region sequence are preferably as follows:

(1) amplifying a DNA fragment of a PD-L1 coding region, carrying out TA cloning by using a pMD18-T vector to obtain pMD18-PD-L1, carrying out enzyme digestion by using EcoRI and Xho I to obtain a PD-L1 DNA fragment, filling in by using T4DNA Polymerase, and then recovering to obtain a DNA fragment of a PD-L1 coding region;

(2) after cutting the pCAGGS vector by EcoR I enzyme, filling in by T4 Polymerase to obtain a linearized pCAGGS vector;

(3) and (3) connecting the DNA fragment of the PD-L1 coding region obtained in the step (1) with the linearized pCAGGS vector obtained in the step (2) to construct the recombinant expression vector containing the PD-L1 gene coding region sequence.

The primer for amplifying the DNA fragment of the PD-L1 coding region in the step (1) is preferably:

an upstream primer: CGACTCGAGATGAGGATATTTGC, respectively;

a downstream primer: CAGGAATTCTTACGTCTCCTCGA are provided.

The DNA fragment of the PD-L1 coding region in the step (1) can also be connected with a fluorescent protein gene.

The fluorescent protein gene is preferably EGFP gene.

A spermatogenesis disorder animal model is prepared by the construction method of the spermatogenesis disorder animal model.

The application of the animal model of the spermatogenesis dysfunction in the research of the spermatogenesis dysfunction disease or the screening of the drug of the spermatogenesis dysfunction disease.

A medicament for treating spermatogenesis dysfunction, wherein the medicament takes PD-L1 as a target.

The invention adopts the way of fertilized egg pronucleus injection and pseudopregnant mouse embryo transplantation to obtain transgenic mice, the culture observation lasts for up to 190 days, the mice are killed respectively at different culture durations, testis and epididymis tissues are picked up for observation and measurement, the main detection aspect comprises the steps of observing the shape and size of fluorescent tissues, measuring the tissue weight, staining tissue section cells, immunohistochemistry and immunofluorescence staining under a mirror, and screening the successfully constructed spermatogenesis failure model. Mainly shows that the testis shows strong green fluorescence, and the weight and the size are obviously lower than those of the wild type testis; the weight difference of epididymis is not obvious, but the immunofluorescence fluorescence staining of tissue sections of epididymis shows strong green fluorescence, and cell staining shows that no obvious cast-off cells (mostly round spermatids) exist in the epididymis of the transgenic PD-L1 type mouse.

Compared with the prior art, the invention has the following advantages and effects:

(1) the invention discovers for the first time that the over-expression of PD-L1 has an interference effect on the sperm maturation process, so that the spermatogenesis dysfunction of male mice is caused, a new treatment target point is provided for the spermatogenesis dysfunction and the infertility diseases, and the treatment of the spermatogenesis dysfunction and the infertility diseases is hopefully realized through the regulation and control of PD-L1.

(2) The invention successfully establishes a spermatogenesis deficiency animal model by using PD-L1 overexpression, performs the prokaryotic injection of the fertilized egg on the constructed vector, and establishes a PD-L1 transgenic animal. The construction method of the invention can induce and produce the animal model with spermatogenesis deficiency only by changing the expression of one gene, only increases the expression of the PD-L1 gene, does not directly influence the expression of other genes of the animal model, and does not influence other phenotype changes of the animal model; meanwhile, the constructed animal model is stable. The construction method of the invention is greatly different from the traditional gene knockout model in the aspects of method and use, develops a new idea for researching animal spermatogenesis barrier and infertility, can not only make up for the instability of a chemical method induced animal model, but also reduce the influence of multiple phenotypes and the like generated by interfering a certain transcription factor.

(3) The expression vector used in the animal model construction method is convenient and easy to obtain, the vector construction method is simple and feasible, and the expression of the PD-L1 gene can be specifically and efficiently enhanced; the animal model shows that the barrier is generated in the process of generating sperms, the constructed animal model of the barrier generated by the sperms is stable, and a foundation is provided for discovery of pathogenic genes of barrier generation and maturation of the sperms of animals and research of pathogenic mechanisms.

(4) The animal model efficiently and stably constructed by PD-L1 overexpression is innovated, important animal basis and experimental materials are provided for related scientific experiments and clinical diagnosis and treatment of spermatogenesis disorder, the animal model can be used for deeply researching molecular mechanism of disorder in spermatogenesis and maturation process, the animal model is provided for clinical treatment of male infertility, and theoretical basis is provided for clinical treatment of infertility.

Drawings

FIG. 1 is a schematic view showing the preparation of a boat in example 2.

FIG. 2 is a schematic representation of the embryo handling in example 2.

FIG. 3 is a diagram showing the results of gel electrophoresis of the gene fragment in example 2.

FIG. 4 is a graph of comparative analysis of testis and epididymis weights of wild type mice (WT) and PD-L1 transgenic mice (Tg).

FIG. 5 is a photograph of testis and seminal tubules of wild type mouse (WT) and PD-L1 transgenic group mouse (Tg).

FIG. 6 is a graph of cryo-sectioned immunohistochemistry results (200X) for testis and tubules of wild type mice (WT) and PD-L1 transgenic group mice (Tg).

FIG. 7 is a graph showing immunofluorescence staining of cryo-sections of wild-type and transgenic groups of seminiferous tubules and epididymis.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

The experimental animal materials included male C57BL/6(B6) mice, female B6 mice and female ICR mice (purchased from Shanghai Spiker laboratories). The experimental animals were housed in the animal house of the medical college of university of southern China.

The experimental materials referred to in the examples are as follows

1. Main instrument

TABLE 1

2. Reagent, consumable material and strain

TABLE 2

EXAMPLE 1 construction of transgenic vectors

1. Amplification of PD-L1 coding region DNA fragment

1.1 primers

Forward primer：CGACTCGAGATGAGGATATTTGC

Reverse primer：CAGGAATTCTTACGTCTCCTCGA

1.2PCR amplification of the PD-L1 fragment

Spleen tissues and RNA were extracted from mice (female B6 mice), and the full length of cDNA encoding the PD-L1 coding region was obtained by RT-PCR using the RT-PCR system as follows:

TABLE 3

The reaction conditions were as follows: 15min at 37 ℃, 5s at 85 ℃ and 4 DEG C

The obtained cDNA was subjected to PCR using the designed primers to obtain a target gene PD-L1 target fragment, and the reaction system was as follows:

TABLE 4

The reaction conditions were as follows:

the obtained PCR product was subjected to nucleic acid electrophoresis, and the nucleic acid electrophoresis gel was prepared by dissolving 0.25g of agarose in 25mL of 1 XTAE solution, dissolving at high temperature in a microwave oven, adding 2.5. mu.L of EB reagent, pouring into a mold, and standing at room temperature for 1 hour. The fragments were mixed with 6 Xelectrophoresis loading buffer at a ratio of 1:5 and electrophoresed at 120V for 20 min.

And (3) cutting and recycling the strips displayed after electrophoresis, and specifically comprising the following steps:

(1) column equilibration step: 500. mu.L of the equilibration solution BL was added to the adsorption column CA2 (the adsorption column was placed in the collection tube), centrifuged at 12,000rpm for 1min, the waste solution in the collection tube was decanted, and the adsorption column was replaced in the collection tube.

(2) A single band of the target DNA was cut out of the agarose gel (excess was removed as much as possible) and placed in a clean centrifuge tube and weighed.

(3) To the gel block was added an equal volume of solution PN (if the gel weighed 0.1g, the volume was considered to be 100. mu.L, 100. mu.L of PN solution was added), and the gel block was left in a 50 ℃ water bath with the centrifuge tube gently turned upside down to ensure adequate dissolution of the gel block. If the undissolved lumps of gum remain, the mixture can be kept standing for a few minutes or some sol solution can be added again until the lumps of gum are completely dissolved (if the volumes of the lumps of gum are too large, the lumps of gum can be cut into pieces in advance).

(4) Adding the solution obtained in the previous step into an adsorption column CA2 (the adsorption column is placed into a collection tube), standing at room temperature for 2min, centrifuging at 12,000rpm for 60s, pouring off the waste liquid in the collection tube, and placing adsorption column CA2 into the collection tube.

(5) Adding 600 μ L of rinsing solution PW (added with anhydrous ethanol) into adsorption column CA2, standing at room temperature for 3min, centrifuging at 12,000rpm for 60s, pouring off waste liquid in the collection tube, and placing adsorption column CA2 into the collection tube. And repeating the steps once.

(6) The adsorption column CA2 was returned to the collection tube and centrifuged at 12,000rpm for 2min to remove the rinse as much as possible. The adsorption column CA2 was left at room temperature for several minutes and was thoroughly dried.

(7) Placing the adsorption column CA2 in a clean centrifuge tube, suspending 60 μ L of elution buffer EB in the middle of the adsorption membrane, and standing at room temperature for 2 min. The DNA solution was collected by centrifugation at 12,000rpm for 2 min.

(8) The concentration of the PD-L1 fragment was determined and stored in a freezer at-20 ℃.

The obtained PD-L1 band has the size of about 870bp, and the target gene is recovered.

2. Construction of fragments for ligation vectors

2.1TA cloning ligation of fragments of interest

The obtained PD-L1 sequence was ligated to the vector pMD18-T by TA cloning to obtain pMD 18-PD-L1. The specific experimental steps are as follows:

(1) the following DNA solutions were prepared in a microcentrifuge tube in a total volume of 5. mu.L.

TABLE 5

(2) Add 5. mu.L (equal volume) of Solution I.

(3) The reaction was carried out at 16 ℃ for 30 min.

(4) The total amount (10. mu.L) was added to 50. mu.L of DH5a competent cells and placed on ice for 30 min.

(5) After heat shock at 42 ℃ for 90s, it was placed in ice for 2 min.

(6) 1mL of LB medium was added, and the mixture was cultured at 37 ℃ for 60min with shaking at 200 rpm.

(7) To an LB agar plate containing Amp (100. mu.g/mL), 40. mu.L of X-Gal stock solution (20mg/mL) and 5. mu.L of IPTG (0.84mol/L) were added dropwise, respectively, and then the LB medium containing the bacterial solution was plated.

(8) Culturing on the culture medium to form a single colony. Blue and white colonies were counted.

(9) Selecting white colony, adding 1mL LB liquid culture medium, oscillating and culturing at 37 deg.C and 200rpm for 60min, extracting 500 μ L bacterial liquid, and storing at-80 deg.C.

(10) The bacterial suspension 100. mu.L with the correct sequencing result was selected and amplified in 10mL LB liquid medium containing ampicillin at 37 ℃ and 200rpm for 6h with shaking.

(11) 1.5mL of the bacterial solution was centrifuged at 12,000rpm for 1min, and the supernatant was discarded.

(12) The bacterial pellet was suspended evenly by adding 250. mu.L of buffer S1 to which RNaseA had been added.

(13) Adding 250 mu L of Buffer S2, gently and fully turning the mixture up and down for 4-6 times, and uniformly mixing the mixture to fully crack the thalli until a transparent solution is formed. This step should not be carried out for more than 5 min.

(14) Adding 350 mu L of Buffer S3, mixing gently and fully turning up and down for 6-8 times, and centrifuging at 12,000rpm for 10 min.

(15) The centrifuged supernatant from step (14) was aspirated and transferred to a preparation tube (placed in a 2mL centrifuge tube), centrifuged at 12,000rpm for 1min, and the filtrate was discarded.

(16) The tube was placed back into the centrifuge tube, 500. mu.L of Buffer W1 was added, and the mixture was centrifuged at 12,000rpm for 1min, and the filtrate was discarded.

(17) Placing the prepared tube back into a centrifuge tube, adding 700 mu L of Buffer W2, centrifuging at 12,000rpm for 1min, and removing the filtrate; the washing was carried out in the same manner once again with 700. mu.L of Buffer W2. The filtrate was discarded.

(18) The preparation tube was placed back into a 2mL centrifuge tube and centrifuged at 12,000rpm for 1 min.

(19) The preparation tube is moved into a new 1.5mL centrifuge tube (provided in a kit), 60-80 μ L of Eluent or deionized water is added to the center of the preparation tube membrane, and the mixture is kept standing for 1min at room temperature. Centrifuge at 12,000rpm for 1 min.

(20) Storing at-80 deg.C.

2.2 joining of target fragment to EGFP Gene fragment

In order to facilitate observation of phenomena in the subsequent experimental process, an EGFP gene connection target gene segment can be obtained from pIRES2-EGFP plasmid, and the segment is constructed by adopting a double enzyme digestion method. The specific experimental steps are as follows:

(1) selecting restriction enzymes Xho I + EcoRI to cut pMD18-PD-L1 and pIRES 2-EGFP. The plasmids were digested separately using the following system: EcoRI 1. mu.L, XhoI 1. mu.L, 10 XH Buffer 2. mu.L, DNA not more than 1. mu.g, sterile water up to 20. mu.L. The reaction conditions were as follows: react at 37 ℃ for 3.5 h.

(2) Connecting the enzyme-digested PD-L1 and pIRES2-EGFP to obtain a vector pPD-L1-IRES2-EGFP of 20 mu L in total, wherein the reaction system is as follows: 250ng of PD-L1 fragment after enzyme digestion, 50ng of pIRES2-EGFP plasmid vector after enzyme digestion, and the same volume of ligationMax. The reaction conditions were as follows: the reaction was carried out at 16 ℃ for 30 min.

(3) The total amount (20. mu.L) was added to 50. mu.L of DH5a competent cells and placed on ice for 30 min.

(4) After heat shock at 42 ℃ for 90s, it was placed in ice for 2 min.

(5) 1mL of LB medium was added, and the mixture was cultured at 37 ℃ for 60min with shaking at 200 rpm.

(6) Culturing on LB agar plate culture medium containing X-Gal, IPTG and Amp to form single colony. Blue and white colonies were counted.

(7) Selecting white colony, adding 1mL LB liquid culture medium, oscillating and culturing at 37 deg.C and 200rpm for 60min, extracting 500 μ L bacterial liquid, and storing at-80 deg.C.

(8) The bacterial suspension 100. mu.L having the correct sequencing result was selected and amplified in 10mL of LB liquid medium (100. mu.g/mL) containing ampicillin at 37 ℃ for 6 hours by shaking culture at 200 rpm.

(9) 1.5mL of the bacterial solution was centrifuged at 12,000rpm for 1min, and the supernatant was discarded.

The following steps were performed according to the procedures of the plasmid miniprep kit for Axygen:

(10) adding 250 mu L of Buffer S1 added with RNaseA to evenly suspend the bacterial sediment; adding 250 mu L of Buffer S2, gently and fully turning the mixture up and down for 4-6 times, and uniformly mixing the mixture to fully crack the thalli until a transparent solution is formed. This step should not be carried out for more than 5 min.

(11) Adding 350 mu L of Buffer S3, mixing gently and fully turning up and down for 6-8 times, and centrifuging at 12,000rpm for 10 min.

(12) The centrifuged supernatant from step (11) was aspirated and transferred to a preparation tube (placed in a 2mL centrifuge tube), centrifuged at 12,000rpm for 1min, and the filtrate was discarded.

(13) The tube was placed back into the centrifuge tube, 500. mu.L of Buffer W1 was added, and the mixture was centrifuged at 12,000rpm for 1min, and the filtrate was discarded.

(14) Placing the prepared tube back into a centrifuge tube, adding 700 mu L of Buffer W2, centrifuging at 12,000rpm for 1min, and removing the filtrate; the washing was carried out in the same manner once again with 700. mu.L of Buffer W2. The filtrate was discarded.

(15) The preparation tube was placed back into a 2mL centrifuge tube and centrifuged at 12,000rpm for 1 min.

(16) The preparation tube is moved into a new 1.5mL centrifuge tube (provided in a kit), 60-80 μ L of Eluent or deionized water is added to the center of the preparation tube membrane, and the mixture is kept standing for 1min at room temperature. Centrifuge at 12,000rpm for 1 min.

(17) Storing at-80 deg.C.

2.3 construction of PD-L1-IRES-EGFP fragment

(1) Selecting endonuclease Xho I + Not I to cut pPD-L1-IRES 2-EGFP. The plasmid was digested with the following system: not I1. mu.L, Xho I1. mu.L, 10 XH Buffer 2. mu.L, DNA Not more than 1. mu.g, sterile water up to 20. mu.L. The reaction conditions were as follows: react at 37 ℃ for 3.5 h.

(2) Fragment concentrations were determined using a microplate reader.

(3) The ends were blunted using T4 Polymeras, and the reaction solution was added to a microcentrifuge tube in a total volume of 9. mu.L, as follows:

overhanging terminal DNA fragment > 0.1pmol,10 XT 4DNA Polymerase Buffer 1. mu.L, 0.1% BSA 1. mu.L, 1.7mmol/L dNTP mix 1. mu.L, sterile water up to 9. mu.L.

The reaction conditions were as follows: the temperature is maintained for 5min at 70 ℃, and then the mixture is moved into a thermostatic bath at 37 ℃. mu.L of T4DNA Polymerase was added, gently mixed with a sampler, and incubated at 37 ℃ for 5 minutes. The reaction solution was placed on ice and immediately ligated to obtain PD-L1-IRES-EGFP fragment.

3. Expression vector linearization and end filling

3.1pCAGGS expression plasmid restriction enzyme

(1) The plasmid pCAGGS (disclosed in Zhang Mei, Huanghaibi, Teng, etc.) is digested by selecting the endonuclease EcoRI, which is disclosed in the construction of eukaryotic expression vectors for expressing 3 foreign genes [ J ]. Chinese veterinary medical science and report for prevention, 2011,33(4): 281-. The plasmids were digested separately with the following enzymes: EcoRI 1 μ L,10 XH Buffer2 μ L, DNA less than or equal to 1 μ g, sterile water up to20 μ L. The reaction conditions were as follows: react at 37 ℃ for 3.5 h.

(2) Fragment concentrations were determined using a microplate reader.

3.2 the end of the digestion fragment is filled up

(1) The ends were filled in with T4 Polymerase, and the reaction solution was added to the microtitration tube in a total volume of 9. mu.L, as follows: overhanging terminal DNA fragment > 0.1pmol,10 XT 4DNA Polymerase Buffer 1. mu.L, 0.1% BSA 1. mu.L, 1.7mmol/L dNTP mix 1. mu.L, sterilized water to 9. mu.L.

(2) The reaction conditions were as follows: the temperature is maintained for 5min at 70 ℃, and then the mixture is moved into a thermostatic bath at 37 ℃. mu.L of T4DNA Polymerase was added, gently mixed with a sampler, and incubated at 37 ℃ for 5 minutes. The reaction solution was placed in ice. Ready for immediate connection.

4. Preparation of recombinant clones

4.1 preparation of competent cells

The permeability of the competent cells is increased through treatment, so that the exogenous genes or vectors can conveniently enter the competent cells.

(1) Extracting 25 mu L of DH5 α strain, uniformly inoculating the strain on LB solid culture medium without antibiotics, and culturing for 16-20 h at 37 ℃.

(2) And (3) picking a single colony from the cultured plate by the sterilized gun head, transferring the single colony into an LB liquid culture medium containing 15mL, and shaking the bacteria at 37 ℃ and 200rpm for 10-12 h.

(3) Standing on ice for 10 min.

(4) Centrifuge at 6000rpm for 10min at 4 ℃, discard the supernatant and invert the tube for 1min to drain the last traces of culture.

(5) With pre-cooled 0.1mol/L CaCl₂Solution (80mmol/L MgCl)₂，20mmol/L CaCl₂) Resuspend the cell pellet at a ratio of 2.5:1 and let stand on ice for 30 min.

(6) Centrifuge at 6000rpm for 10min at 4 ℃, discard the supernatant and invert the tube for 1min to drain the last traces of culture.

(7) With 2mL of precooled 0.1mol/L CaCl₂Resuspend each cell pellet and let stand on ice for 10 min.

(8) Adding 2mL of 30% glycerol, mixing, packaging into 100 μ L tubes, and storing at-80 deg.C.

4.2PCR product ligation linearized expression vector

And (3) connecting the PD-L1-IRES-EGFP fragment recovered in the step 2.3 to the linearized pCAGGS plasmid to obtain a transgenic vector pCAG-PD-L1.

The enzyme linked system (10. mu.L system) was as follows:

TABLE 6

Finally adding enzyme, repeatedly blowing and sucking by a gun, mixing uniformly, and violently shaking.

Overnight at 16 ℃ (water is added to the lower layer of the heat-preservation lunch box, ice is added to the upper layer, the enzyme connecting body is put on the water, and the lunch box is tightly covered).

4.3 transformation

(1) From the-80 ℃ refrigerator, 200 u L competent cell suspension, at room temperature to thaw, thawing immediately after ice.

(2) Adding the plasmid DNA solution obtained in the step 4.2 (the content is not more than 50ng, the volume is not more than 10 mu L), gently shaking, and standing on ice for 30 minutes.

(3) And (3) performing heat shock at 42 ℃ for 90 seconds, and quickly placing on ice to cool for 3-5 minutes after heat shock.

(4) To the tube add 1mL LB liquid medium (without Amp)) After mixing, the mixture is cultured for 1 hour at 37 ℃ with shaking to restore the normal growth state of the bacteria and express the resistance gene (Amp) coded by the plasmid^r)。

(5) Centrifuging the bacterial liquid at 25 ℃ and 3000rpm for 5min, discarding 900 mu L of supernatant, shaking up, coating 100 mu L of the supernatant on a screening plate containing Amp, standing for half an hour with the front side upward, inverting the culture dish after the bacterial liquid is completely absorbed by the culture medium, and culturing at 37 ℃ for 16-24 hours.

Control 1-the DNA solution was replaced with the same volume of sterile double distilled water, and the other operations were the same as above. This group should normally have no colonies present on the LB plates containing the Amp.

Control 2, 10ng of the enzyme-cleaved purified product was used in place of the DNA solution, and the other operations were the same as above. This group should normally show no more than 50 colonies on the Amp-containing LB plates.

5. Positive clone identification

Sequencing: according to the number of colonies of the negative control (i.e., the control group 1 and the control group 2 in the step 4.3), 5 to 10 colonies from the positive colonies are respectively added into 1mL of LB liquid medium, shaken for 5 hours, and 500. mu.L of the mixture is taken out and sent to the test.

Carrying out PCR of bacterial liquid, preparing a PCR system (10 mu L): the colony is used as a template for amplification, and the single clone is selected to be evenly blown in 20 mu L of sterile double distilled water to prepare bacterial liquid.

TABLE 7

And (4) selecting positive bacteria liquid after agarose gel electrophoresis detection.

The PCR conditions were as follows:

TABLE 8

Example 2

The vector pCAG-PD-L1 obtained in example 1 was digested with SalI and AvrII, and the large DNA fragment was recovered using the endotoxin-free Gel Extraction Kit QIA quick Gel Extraction Kit (Qiagen)The fragments are ready for use. Establishment of transgenic mice PD-L1 by prokaryotic injection^ves。

Establishment of transgenic animals by sperm-egg prokaryotic injection was carried out according to the method established by Nagy et al (Nagy A, Gertsenstein M, Vintersten K. manipulating the Mouse Embryo: A Laboratory Manual [ M ].3 rd. New York: Cold Spring Harbor Laboratory Press,2003:221- & 256.).

Reagent consumable

(1) Surgical instruments: ophthalmic forceps (toothed or toothless), micro forceps (pair), ophthalmic scissors, suture line, suture needle, tissue clamp, injection needle (GD-1, narishige) self-made and fixed needle (made in China) self-made

(2) The instrument comprises the following steps: olympus inverted microscope, Eppendorf operating arm, P-87 needle drawing instrument and MF-900 needle breaking instrument

(3) Reagent

M16 (cat # M7167), M2 (cat # M7292), mineral oil (cat # M5310), hyaluronidase (cat # H3506) (500IU/mL deluted in M2), and Avermen (cat # T48402) were purchased from Sigma.

Injection buffer (from Millipore, cat # MR-095-F), Microloader (from Eppendorf NO.5242956.003)

(4) Donor and recipient mice

Male C57BL/6(B6) mice, female B6 mice, female ICR mice (purchased from shanghai slyke laboratory animal center), and TgPD-L1 male mice.

Ligation of male mouse

(1) C57BL/6(B6) male mice were anesthetized (1.25% Avertine, i.p.).

(2) The abdomen is supine, the hair of the mouse at the operation position is cut off, and the lower abdomen is disinfected by 70% alcohol.

(3) The skin and muscle layers were cut open and the incision was about 1cm long. The suture line is penetrated into the opening of the wall of the single side body, so that the muscle layer can be conveniently found in the later stage.

(4) Ligation of vas deferens: the fat pad was grasped with blunt forceps and the testis, epididymis and vas deferens were pulled out gently.

(5) Identifying vas deferens: the vas deferens connects the epididymis and penis. Vas deferens is rich in longitudinally distributed blood vessels, and is freed from surrounding tissue with scissors or forceps. The vas deferens is clamped by forceps to form a ring, another blunt forceps is heated by an alcohol lamp until the ring turns red, and the red hot forceps are used for clamping the vas deferens ring to separate from the vas deferens and form two closed ends. The two burnt ends are separated and the whole organ is returned to the abdominal cavity with blunt forceps.

(6) Repeating the above steps to cut off the vas deferens at the other side.

(7) The muscle layer and skin incision were sutured.

(8) Monitoring after an operation: the mice are monitored until complete resuscitation and euthanasia should be given if significant pain, restlessness or postoperative reaction is observed. Mice should be observed daily for infection or other problems within one week after resuscitation and, once found, should be euthanized.

Three, pronucleus injection

1. Hormone dispensing method

PMSG (pregnant mare serum gonadotropin) is prepared by dissolving PMSG lyophilized powder in 0.9% NaCl sterile normal saline with concentration of 50IU/mL, and subpackaging into 1.5mL EP tubes (each tube can be subpackaged with 5 or 10 mice) according to the amount required by the experiment, wherein the dose of each mouse is 0.1mL (5 IU). Can be stored at-20 deg.C for at least one month.

HCG (human chorionic gonadotropin) lyophilized powder is dissolved in 0.9% NaCl sterile physiological saline with concentration of 50IU/mL, and is subpackaged into 1.5mL EP tubes according to the amount required by the experiment (each tube can be subpackaged with the amount of 5 or 10 mice), and the dose of each mouse is 0.1mL (5 IU). Can be stored at-20 deg.C for at least one month.

(2) Superovulation procedure

TABLE 9

Monday

Zhou Di

Wednesday

Week four

ZhouWu for treating viral hepatitis

Saturday wine

Sunday day

PMSG

HCG

Suppository detection/injection

PMSG

HCG

Suppository detection/injection

PMSG

HCG

Embolectomy/injectionShooting device

PMSG

HCG

Suppository detection/injection

2. Isolation of oocytes

(1) Three days afternoon before the experiment: b6 female mice 3-4 weeks old are injected intraperitoneally and PMSG 5 IU/mouse.

(2) Afternoon of the day before the experiment: PMSG injection for 46-48 hours, intraperitoneal injection, HCG 5 IU/mouse.

(3) The superovulated female mouse is put into a single-seed mouse cage with 1 mouse per cage.

(4) An estrus ICR female mouse is picked out and put into a ligation male mouse cage according to the proportion of 1 cage and 2 mice.

(5) On the day of injection: the suppository is checked, and the record of whether the suppository is found/not found is registered on the ligation male squirrel cage plate. Multiple M16 microdroplets were prepared in petri dishes, covered with mineral oil, and placed in CO₂And balancing in the incubator.

(6) Preparing a 35mm culture dish, and placing M2 liquid drops in the culture dish for storing and taking out the oviduct; a60 mm petri dish was prepared for digestion and washing of the fertilized eggs.

(7) Taking off cervical vertebra to kill fertilized ovum for mouse, wetting back with 70% alcohol, lifting skin with tweezers near tail end, cutting out a transverse incision with scissors, clamping skin at incision with tweezers, peeling off to head side, exposing muscle at back side waist, clamping fat pile on ovary with tweezers, dragging it out of body, clamping uterus with tweezers, cutting off ovary with scissors (paying attention to not cutting fallopian tube), cutting off uterine horn, and placing the broken fallopian tube into M2 liquid drop prepared in advance.

(8) The ampulla of the fallopian tube is torn by the ophthalmological forceps, the fertilized egg is extruded out of the tube, and if the fertilized egg does not flow out, the fallopian tube can be slightly extruded by the forceps.

(9) The hyaluronidase is digested for a few minutes until the granulosa cells are substantially shed, and if necessary, the droplets are blown several times, and the eggs are washed when the granulosa cells are completely shed. But do not leave cumulus cell-free embryos in hyaluronic acid for too long, as this is detrimental to the embryos.

(10) The fertilized egg is transferred to a new M2 solution by oral control.

3. Prokaryotic injection

And drawing the prokaryotic injection needle and the fixed needle by using a P-87 instrument, wherein the tips of the injection needle and the fixed needle are bent to form an inclination angle of 20-30 degrees on the instrument. Fixing the fixed needle on the operating arm; the boat was made as shown in FIG. 1 by making a strip of M2 having a width of about 2mm and covered with mineral oil. The linearized vector pCAG-PD-L1 was inserted into a syringe needle using a microsyringe, avoiding the formation of air bubbles at the tip. Portions of the embryos were washed several times with M2 microdroplets and transferred to injection dishes (FIG. 2), the dishes were placed on an inverted microscope, and the stage was moved until the embryos were visible under the field of view. The needle is carefully lowered below the liquid level, and after viewing the needle in the field, it is positioned close to the embryo injection needle in the same way. The injection needle collides with the fixed needle to generate a tiny fracture. The ovum is sucked by a fixed needle, and the position of the ovum is adjusted by slightly pulling the injection needle, so that the pronucleus can be clearly seen and the needle point and the pronucleus can be clearly positioned on the same focal plane. The injection tube is inserted into the pronucleus, DNA is injected by pressing the Inject key, the pronucleus is rapidly withdrawn after obvious swelling of the pronucleus, and too much DNA can dissolve the embryo. The ovum is pushed downwards by the injection needle and a new ovum is sucked for injection, and the process is repeated until all the ovum is injected. After injection, embryos were transferred to M16 petri dishes and placed in an incubator for culture. This was repeated until all of the eggs were injected.

4. Embryo transfer

Embryos after injection are suitably cultured to recover the embryos, and dead embryos are discarded. Transplanting by using a pseudopregnant female mouse with 0.5 day thrombus; if the number of the pseudopregnant mice is not enough, the pseudopregnant female mice (0.25dpc) with embolus in the morning and afternoon can be used as a receptor, and the embryos can be cultured to the next day and then transplanted to 2-cells. Abamectin is injected into the abdominal cavity for anesthesia. Transferring the embryos into M2 liquid drops, cleaning for several times, sucking a small bubble in a transfer tube, sucking a small amount of culture solution, sucking 20-30 embryos and a small amount of culture solution next to a bubble, and sucking a small bubble and a small amount of culture solution. The abdominal cavity is opened, the forceps are used for clamping fat mass on the ovary in the body, the ovary, the oviduct and the uterus are broken and pulled out of the body, the oviduct and the ampulla thereof are found under a body microscope, the forceps of the ophthalmology are used for fixing the oviduct, and a sharp needle head is used for puncturing a small opening before the ampulla is expanded. Then the transplantation tube is inserted into the opening for about 5mm, the embryo and the liquid are slightly blown out until all three bubbles enter the oviduct, and then the transplantation tube is pulled out. The uterine tube is returned. The muscle and skin were sutured separately with silk. The mice that had undergone the transplantation procedure were returned to the cage, and the cage was placed on a hot table and incubated (37 ℃) until the mice recovered.

In the experiment, 5 superovulation mice are fertilized to obtain 52 eggs, wherein 40 fertilized eggs are injected successfully, 35 fertilized eggs are returned to a pseudopregnant mouse, and 30 transgenic mice are obtained; the modeling method has high repeatability. RNA of testis tissues of 6 transgenic male mice (lanes 1-6) and common male C57BL/6(B6) mice (lanes 7-8) was extracted by Trizol, and the construction of PD-L1 transgenic mice was confirmed by RT-PCR (FIG. 3).

Example 3

The biological traits of the transgenic mice constructed in example 2 and the B6 mice were measured: the body length, body weight and size of spleen and thymus were measured in both transgenic and wild type mice using electron day and millimeter ruler.

The transgenic mice and wild mice are bred in an SPF animal laboratory, at least 3 transgenic mice and wild mice are bred in each place of 40d, 60d, 70d, 90d, 100d, 120d, 140d, 160d and 190d in sequence, tissues of testis and epididymis are immediately taken, and after photographing and weighing, the average weight of the tissues of testis and epididymis of the two types of mice is calculated. Then, the testis and the epididymis are immediately taken and sliced respectively, and cell staining and immunohistochemical experiments are carried out.

The specific operation of immunohistochemistry is as follows:

immunohistochemistry detected PD-L1 expression in surrounding tissues: a wild mouse and a frozen epididymis section of a transgenic mouse are incubated for 30min by PBS containing 0.3 percent TritonX-100, then rat anti-mouse PD-L1-IgG (purchased from Serotech) is added according to the proportion of 1:100, the mixture is incubated for 18h at room temperature, the mixture is washed for 3 times by 0.1mol/L PBS, TxRed-labeled donkey anti-mouse-IgG (purchased from Jackson immunoResach) is added according to the proportion of 1:800, the mixture is incubated for 2h at room temperature, the mixture is washed for 3 times by the PBS, 4', 6-diamidino-2-phenylindole DAPI (1:5000) is added, the mixture is incubated for 15min at room temperature, and the mixture is washed for 3 times by the PBS, and then glycerol is encapsulated.

As shown in fig. 4, it was found by observation of wild type mice and PD-L1 transgenic for 190 days that the transgenic testis and epididymis weights were significantly lower than the wild type.

As shown in FIGS. 4 and 5, the wild-type mice and the PD-L1 transgenic mice are observed for 190 days, and the weight of the testis of the wild-type mice is gradually higher than that of the transgenic PD-L1 mice from 40 days, and the weight of the wild-type mice and the transgenic PD-L1 mice is significantly different (P < 0.05). From day 70, the weight of epididymis of wild type mice was gradually higher than that of transgenic PD-L1 type mice, and there was a significant difference in weight between the two (P < 0.05). From a general observation that the testis size of the wild type mice is larger than that of the transgenic PD-L1 type mice, epididymis differences are not obvious.

As shown in FIG. 6, the epididymis tissue section was cyto-stained, and it was observed that there was a large number of exfoliated cells, mostly round sperm cells, in the epididymis of the wild type mouse. The transgenic PD-L1 type mouse has no obvious desquamated cells in the epididymis.

As shown in figure 7, immunofluorescence staining of epididymis cryosections of transgenic PD-L1 type and wild type mice shows that the surfaces of seminiferous tubules and epididymis columnar epithelial cells of the transgenic PD-L1 type mice highly express PD-L1, while the expression levels of PD-L1 on the surfaces of the seminiferous tubules and epididymis columnar epithelial cells of the wild type mice are not obvious, and the two are different obviously.

And (4) conclusion: the above results indicate that PD-L1 can affect the shedding of sperm cells in seminiferous tubules, and in transgenic PD-L1 type mice, the high expression of PD-L1 of supporting cells and sperm cells is an important factor for the sterility expression of the mice.

Through the steps, a PD-L1 overexpression transgenic mouse is constructed and verified, and the construction of a spermatogenesis deficiency mouse model is obtained.

For a passage PD-L1 transgenic mouse model, a first established PD-L1 transgenic male mouse is selected to mate with a wild female mouse, and the offspring of the male mouse with the birth has reproductive capacity but shows the negative PD-L1 or positive PD-L1 and weak positive testicular EGFP; selecting a first established PD-L1 transgenic male mouse to mate with a wild type female mouse, wherein the male mouse has no fertility, the size and weight of the testis of the mouse are obviously smaller than those of the wild type mouse, and the testis of the mouse simultaneously shows strong green fluorescence, and the immunofluorescence staining of a tissue slice and the cell staining show strong green fluorescence; the first established PD-L1 transgenic female mouse is selected to mate with a wild male mouse, the offspring of the male mouse with fertility is represented as the male mouse with no reproductive capacity, and the observation conditions of the tissues of testis and epididymis are the same as the first established male mouse with no fertility. The high expression of PD-L1 in testis and epididymis tissues is highly correlated with the spermatogenesis deficiency of male mice, the PD-L1 transgenic male mice have the spermatogenesis deficiency phenotype, and the phenotypic change caused by the gene change has stable inheritance.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<110> university of southern China's science

<120> animal model of spermatogenesis dysfunction, preparation method and application thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> PD-L1 coding region amplification upstream primer

<400>1

cgactcgaga tgaggatatt tgc 23

<210>2

<211>23

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<220>

<223> PD-L1 coding region amplification downstream primer

<400>2

caggaattct tacgtctcct cga 23

Claims

The application of PD-L1 as a target point in screening or preparing a medicament for treating spermatogenesis deficiency diseases.
2. A method for constructing an animal model of spermatogenesis deficiency, which is characterized in that:

the animal model of spermatogenesis deficiency is obtained by overexpressing PD-L1 in animals.
3. The method for constructing an animal model of spermatogenesis deficiency according to claim 2, wherein the animal model of spermatogenesis deficiency is constructed by the following steps:

constructing a recombinant expression vector containing a PD-L1 gene coding region sequence, injecting the recombinant expression vector into animal cells to over-express PD-L1 and performing embryo transplantation, thereby obtaining the animal model of the spermatogenesis deficiency.
4. The method of constructing an animal model of spermatogenesis deficiency according to claim 3, wherein:

the expression vector is a mammalian cell expression vector;

the expression vector contains fluorescent protein genes.
5. The method of constructing an animal model of spermatogenesis deficiency according to claim 4, wherein:

the injection is prokaryotic injection;

the expression vector is a pCAGGS vector;

the fluorescent protein gene is an EGFP gene.
6. The method for constructing an animal model with spermatogenesis deficiency as claimed in claim 3, wherein the steps of constructing the recombinant expression vector containing the PD-L1 gene coding region sequence are as follows:

(1) amplifying a DNA fragment of a PD-L1 coding region, carrying out TA cloning by using a pMD18-T vector to obtain pMD18-PD-L1, carrying out enzyme digestion by using EcoRI and Xho I to obtain a PD-L1 DNA fragment, filling in by using T4DNA Polymerase, and then recovering to obtain a DNA fragment of a PD-L1 coding region;

(2) after cutting the pCAGGS vector by EcoR I enzyme, filling in by T4 Polymerase to obtain a linearized pCAGGS vector;

(3) and (3) connecting the DNA fragment of the PD-L1 coding region obtained in the step (1) with the linearized pCAGGS vector obtained in the step (2) to construct the recombinant expression vector containing the PD-L1 gene coding region.
7. The method of constructing an animal model of spermatogenesis deficiency according to claim 6, wherein:

the animal cell is a fertilized egg;

the animal is a murine animal;

the primers for amplifying the DNA fragment of the PD-L1 coding region in the step (1) are as follows:

an upstream primer: CGACTCGAGATGAGGATATTTGC, respectively;

a downstream primer: CAGGAATTCTTACGTCTCCTCGA are provided.
8. An animal model of dysspermia characterized by:

the animal model of spermatogenesis deficiency as claimed in any one of claims 2 to 7.
9. Use of the animal model of spermatogenesis deficiency according to claim 8 for the study of spermatogenesis deficiency diseases or for screening of drugs for spermatogenesis deficiency diseases.
10. A medicament for the treatment of spermatogenesis disorders, wherein:

the medicine takes PD-L1 as a target spot.