CN111117979A

CN111117979A - Transaminase mutant, enzyme preparation, recombinant vector, recombinant cell and preparation method and application thereof

Info

Publication number: CN111117979A
Application number: CN202010036428.7A
Authority: CN
Inventors: 张丽星; 张艺凡; 郭天杰; 马富强; 杨广宇
Original assignee: Suzhou Institute of Biomedical Engineering and Technology of CAS
Current assignee: Suzhou Institute of Biomedical Engineering and Technology of CAS
Priority date: 2020-01-14
Filing date: 2020-01-14
Publication date: 2020-05-08
Anticipated expiration: 2040-01-14
Also published as: CN111117979B

Abstract

The invention relates to a transaminase mutant, an enzyme preparation, a recombinant vector, a recombinant cell, a preparation method and application thereof. The amino acid sequence of the transaminase mutant is obtained by mutating the amino acid sequence of wild-type transaminase, the amino acid sequence of the wild-type transaminase is shown as SEQ ID No.1, and the mutated amino acid position comprises at least one of 226 th amino acid position, 281 th amino acid position, 312 th amino acid position and 406 th amino acid position. The transaminase mutant has high enzyme activity.

Description

Transaminase mutant, enzyme preparation, recombinant vector, recombinant cell and preparation method and application thereof

Technical Field

The invention relates to the technical field of biology, in particular to a transaminase mutant, an enzyme preparation, a recombinant vector, a recombinant cell, a preparation method and an application thereof.

Background

Transaminases (TA, EC 2.6.1X), also known as aminotransferases (Aminotranferases), are pyridoxal phosphate-5' -phophate (PLP) dependent enzymes that catalyze the reversible transfer reaction of an amino group between a keto acid and an amino acid, are ubiquitous in nature and play a critical role in nitrogen metabolism, depending on the substrates and products in the catalytic reaction, transaminases can be divided into α -transaminases that catalyze only α -amino and α -keto acids and ω -transaminases that can catalyze amino acids with remote carboxylic acid groups.

Disclosure of Invention

Based on this, there is a need for transaminase mutants with higher enzyme activity.

In addition, also provides application of the transaminase mutant, an enzyme preparation, a recombinant vector, a recombinant cell and a preparation method thereof.

An amino acid sequence of the transaminase mutant is obtained by mutating an amino acid sequence of a wild-type transaminase, the amino acid sequence of the wild-type transaminase is shown as SEQ ID No.1, and the mutated amino acid position comprises at least one of amino acid position 226, amino acid position 281, amino acid position 312 and amino acid position 406.

The research has carried out a great deal of research on the transaminase, and the unexpected discovery shows that at least one of the 226 th amino acid site, the 281 th amino acid site, the 312 th amino acid site and the 406 th amino acid site in the amino acid sequence of the wild-type transaminase shown in SEQ ID No.1 is mutated, and the obtained transaminase mutant has higher enzyme activity. The experiment proves that the specific activity of the transaminase mutant is 10.4U/mg-31.8U/mg, and the transaminase mutant has high enzyme activity.

In one embodiment, the mutation pattern comprises at least one of the following mutation patterns: T226R, a281S, I312D and R406C.

In one embodiment, the coding sequence of the wild-type transaminase is shown in SEQ ID No. 2.

An enzyme preparation comprising the transaminase mutant described above.

A recombinant vector comprising the coding sequence of the transaminase mutant described above.

A recombinant cell comprising the coding sequence of the transaminase mutant described above.

The preparation method of the recombinant cell comprises the following steps:

carrying out error-prone PCR amplification on the coding sequence of the wild transaminase, carrying out enzyme digestion, and connecting the amplified coding sequence to an empty vector to obtain a transaminase mutation library plasmid;

respectively transforming the transaminase mutation library plasmids into host cells to obtain transformed cells; and

and (3) carrying out high-throughput screening on the transformed cells by adopting an IVC-FACS method to obtain the recombinant cells.

In one embodiment, in the step of performing error-prone PCR amplification on the coding sequence of the wild-type transaminase, the error-prone PCR amplification is performed by using primer pairs with sequences shown as SEQ ID No. 3-SEQ ID No. 4.

In one embodiment, the step of error-prone PCR amplification of the coding sequence of the wild-type transaminase further comprises the following steps: and adopting a primer pair with the sequence shown as SEQ ID No. 3-SEQ ID No.4 to amplify the coding sequence of the wild transaminase by PCR.

The use of the above transaminase mutant, the above enzyme preparation, the above recombinant vector or the above recombinant cell in the preparation of a medicament or a detection reagent.

Drawings

FIG. 1 is a schematic diagram of the structure of a protein crystal model of a wild-type transaminase.

Detailed Description

In order to make the aforementioned objects, features and advantages of the present invention comprehensible, embodiments accompanied with examples are described in detail below. In the following description, numerous specific details are set forth in order to provide a thorough understanding of the present invention. This invention may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein, but rather should be construed as broadly as the present invention is capable of modification in various respects, all without departing from the spirit and scope of the present invention.

The transaminase mutant of one embodiment has high enzyme activity, and can be used for preparing chiral amine so as to be used for preparing a medicament or a detection reagent. Among them, the drugs are, for example, medicines (e.g., sitagliptin) and pesticides (e.g., glufosinate). The detection reagent can be used for clinical detection or pathological diagnosis. The detection reagent is, for example, an ELISA kit.

Specifically, the amino acid sequence of the transaminase mutant is obtained by mutation of the amino acid sequence of a wild-type transaminase, the amino acid sequence of the wild-type transaminase is shown as SEQ ID No.1, and the mutated amino acid position comprises at least one of the amino acid position 226, the amino acid position 281, the amino acid position 312 and the amino acid position 406.

The research has carried out a great deal of research on the transaminase, and the unexpected discovery shows that at least one of the 226 th amino acid site, the 281 th amino acid site, the 312 th amino acid site and the 406 th amino acid site in the amino acid sequence of the wild-type transaminase shown in SEQ ID No.1 is mutated, and the obtained transaminase mutant has higher enzyme activity.

Wherein the amino acid sequence shown as SEQ ID No.1 is the amino acid sequence of wild-type transaminase WP _ 0532423951.1. The wild-type transaminase is an aspartate transaminase family enzyme (aspartate aminotransferase family protein) secreted by Achromobacter sp.DMS1, can tolerate a temperature range of 55-95 ℃, and has relatively good thermal stability.

Specifically, the sequence shown as SEQ ID No.1 is: MSAAKLPDLSHLWMPFTANRQFKANPRLLASAKGMYYTSFDGRQILDGTAGLWCVNAGHCREEIVSAIASQAGVMDYAPGFQLGHPLAFEAATAVAGLMPQGLDRVFFTNSGSESVDTALKIALAYHRARGEAQRTRLIGRERGYHGVGFGGISVGGISPNRKTFSGALLPAVDHLPHTHSLEHNAFTRGQPEWGAHLADELERIIALHDASTIAAVIVEPMAGSTGVLVPPKGYLEKLREITARHGILLIFDEVITAYGRLGEATAAAYFGVTPDLITMAKGVSNAAVPAGAVAVRREVHDAIVNGPQGGIEFFHGYTYSAHPLAAAAVLATLDIYRREDLFARARKLSAPFEEAAHSLKGAPHVIDVRNIGLVAGIELSPREGAPGARAAEAFQKCFDTGLMVRYTGDILAVSPPLIVDENQIGQIFEGIGKVLKEVA are provided.

Further, the mode of mutation includes at least one of the following modes of mutation: T226R, a281S, I312D and R406C. Wherein T226R represents the substitution of threonine at position 226 with arginine in the amino acid sequence shown in SEQ ID No. 1. A281S shows that alanine at position 281 is replaced by serine in the amino acid sequence shown in SEQ ID No. 1. I312D shows that isoleucine at position 312 is replaced by aspartic acid in the amino acid sequence shown in SEQ ID No. 1. R406C shows the amino acid sequence shown as SEQ ID No.1 in which the arginine at position 406 is replaced by cysteine. The transaminase mutant obtained by the arrangement has higher enzyme activity.

In a specific example, the amino acid sequence of the transaminase mutant is derived from the mutation of threonine to arginine at position 226 of the amino acid sequence shown in SEQ ID No. 1.

In a specific example, the amino acid sequence of the transaminase mutant is obtained by mutating alanine at position 281 to serine in the amino acid sequence shown in SEQ ID No. 1.

In a specific example, the amino acid sequence of the transaminase mutant is obtained by mutating isoleucine to aspartate at position 312 in the amino acid sequence shown in SEQ ID No. 1.

In a specific example, the amino acid sequence of the transaminase mutant is obtained by mutating arginine at position 406 to cysteine in the amino acid sequence shown in SEQ ID No. 1.

In a specific example, the amino acid sequence of the transaminase mutant is derived from the amino acid sequence shown in SEQ ID No.1 in which threonine at position 226 is mutated to arginine and alanine at position 281 is mutated to serine.

In a specific example, the amino acid sequence of the transaminase mutant is derived from the amino acid sequence shown in SEQ ID No.1 in which threonine at position 226 is mutated to arginine and arginine at position 406 is mutated to cysteine.

In a specific example, the amino acid sequence of the transaminase mutant is derived from the amino acid sequence shown in SEQ ID No.1 in which isoleucine at position 312 is mutated to aspartic acid and arginine at position 406 is mutated to cysteine.

In a specific example, the amino acid sequence of the transaminase mutant is derived from the amino acid sequence shown in SEQ ID No.1 in which threonine at position 226 is mutated to arginine, alanine at position 281 is mutated to serine, and isoleucine at position 312 is mutated to aspartic acid.

In one embodiment, the coding sequence for the wild-type transaminase is shown in SEQ ID No. 2. Specifically, the sequence shown as SEQ ID No.2 is: ATGTCTGCTGCTAAACTGCCGGACCTGTCTCACCTGTGGATGCCGTTCACCGCTAACCGTCAGTTCAAAGCTAACCCGCGTCTGCTGGCTTCTGCTAAAGGTATGTACTACACCTCTTTCGACGGTCGTCAGATCCTGGACGGTACCGCTGGTCTGTGGTGCGTTAACGCTGGTCACTGCCGTGAAGAAATCGTTTCTGCTATCGCTTCTCAGGCTGGTGTTATGGACTACGCTCCGGGTTTCCAGCTGGGTCACCCGCTGGCTTTCGAAGCTGCTACCGCTGTTGCTGGTCTGATGCCGCAGGGTCTGGACCGTGTTTTCTTCACCAACTCTGGTTCTGAATCTGTTGACACCGCTCTGAAAATCGCTCTGGCTTACCACCGTGCTCGTGGTGAAGCTCAGCGTACCCGTCTGATCGGTCGTGAACGTGGTTACCACGGTGTTGGTTTCGGTGGTATCTCTGTTGGTGGTATCTCTCCGAACCGTAAAACCTTCTCTGGTGCTCTGCTGCCGGCTGTTGACCACCTGCCGCACACCCACTCTCTGGAACACAACGCTTTCACCCGTGGTCAGCCGGAATGGGGTGCTCACCTGGCTGACGAACTGGAACGTATCATCGCTCTGCACGACGCTTCTACCATCGCTGCTGTTATCGTTGAACCGATGGCTGGTTCTACCGGTGTTCTGGTTCCGCCGAAAGGTTACCTGGAAAAACTGCGTGAAATCACCGCTCGTCACGGTATCCTGCTGATCTTCGACGAAGTTATCACCGCTTACGGTCGTCTGGGTGAAGCTACCGCTGCTGCTTACTTCGGTGTTACCCCGGACCTGATCACCATGGCTAAAGGTGTTTCTAACGCTGCTGTTCCGGCTGGTGCTGTTGCTGTTCGTCGTGAAGTTCACGACGCTATCGTTAACGGTCCGCAGGGTGGTATCGAATTCTTCCACGGTTACACCTACTCTGCTCACCCGCTGGCTGCTGCTGCTGTTCTGGCTACCCTGGACATCTACCGTCGTGAAGACCTGTTCGCTCGTGCTCGTAAACTGTCTGCTCCGTTCGAAGAAGCTGCTCACTCTCTGAAAGGTGCTCCGCACGTTATCGACGTTCGTAACATCGGTCTGGTTGCTGGTATCGAACTGTCTCCGCGTGAAGGTGCTCCGGGTGCTCGTGCTGCTGAAGCTTTCCAGAAATGCTTCGACACCGGTCTGATGGTTCGTTACACCGGTGACATCCTGGCTGTTTCTCCGCCGCTGATCGTTGACGAAAACCAGATCGGTCAGATCTTCGAAGGTATCGGTAAAGTTCTGAAAGAAGTTGCT are provided.

It should be noted that, since the same amino acid can be determined by several different codons, the same amino acid can correspond to different coding sequences. Thus, in the present application, the amino acid sequence shown in SEQ ID No.1 can be encoded by a coding sequence having a codon-synonymous mutation obtained by substituting 1 or several nucleotides in the coding sequence shown in SEQ ID No.2, in addition to the coding sequence shown in SEQ ID No. 2. The amino acid sequence shown in SEQ ID No.1 of the present application can be obtained by those skilled in the art according to the amino acid sequence shown in SEQ ID No.1 disclosed in the present application, a cDNA cloning and site-directed mutagenesis method or other suitable methods according to the existing molecular biology techniques, and thus, the coding sequence of the amino acid sequence shown in SEQ ID No.1 is not limited to the coding sequence shown in SEQ ID No. 2. It is also included in the scope of the present invention if the encoded protein has no significant functional difference from the amino acid sequence shown in SEQ ID No.1 of the present application.

In addition, due to polymorphism and variation of protein coding sequences, naturally occurring proteins may have genetic mutations, in which bases are deleted, substituted or added, or amino acids are deleted, inserted, substituted or otherwise varied in the coding sequences, resulting in deletion, substitution or addition of one or more amino acids in the amino acid sequence of the protein. Thus, there are some proteins that are substantially equivalent to the non-mutated proteins in terms of their physiological and biological activities. These polypeptides or proteins which differ structurally from the corresponding protein, but which do not differ significantly in function from the protein, are referred to as functionally equivalent variants.

Functionally equivalent variants are also suitable for polypeptides made by introducing such variations into the amino acid sequence of a protein by altering one or more codons by artificial means such as deletions, insertions, and mutations. Although this allows more variant variants to be obtained, the resulting variants are functionally equivalent variants provided that their physiological activity is substantially equivalent to that of the original non-variant protein.

In general, functionally equivalent variants are homologous to the coding sequence, and thus polypeptides or proteins resulting from at least one alteration (e.g., a deletion, insertion or substitution of one or more bases in the coding sequence of the protein or a deletion, insertion or substitution of one or more amino acids in the amino acid sequence of the protein) generally have a functionally equivalent activity to the protein in question, and are therefore included within the scope of this application if the encoded protein does not differ significantly in function from the transaminase mutants of this application.

In one example, the substrate for the transaminase mutant comprises the α -amino group and the α -keto acid, wherein the α -amino group is the α -amino group of the α -amino acid α -amino acid can be, for example, glycine, alanine, valine, leucine, isoleucine, methionine (methionine), phenylalanine, proline, tryptophan, serine, tyrosine, cysteine, methionine, asparagine, glutamine, threonine, aspartic acid, glutamic acid, lysine, arginine, or histidine α -keto acid is the α -keto acid having a carbon skeleton of amino acids α -keto acid can be, for example, pyruvic acid.

In one embodiment, the substrate of action of the transaminase mutant comprises an amino acid with a distal carboxylic acid group. Wherein the amino acid with a distal carboxylic acid group is glutamic acid or aspartic acid.

The improvement of the enzyme activity can accelerate the enzyme reaction rate and reduce the dosage of the enzyme. The improvement of the thermal stability of the enzyme is beneficial to reducing the reaction condition and saving the production cost. Some studies can improve the thermal stability of the enzyme to some extent by means of tolerance optimization and the like, but the activity of the obtained enzyme is low. Some studies can improve the activity of the enzyme to some extent by mutagenesis and other methods, but the obtained enzyme is easy to inactivate at higher temperature and has poor thermal stability. The optimum temperature of the transaminase mutant is 55 ℃, and the transaminase mutant has higher thermal stability and higher enzyme activity.

Experiments prove that the transaminase mutant can catalyze α -amino and α -keto acid, can catalyze amino acid with remote carboxylic acid group, has higher substrate specificity, can be designed according to requirements to obtain S-type chiral amine or R-type chiral amine, has higher stereoselectivity, has the optimal temperature of 55 ℃, has higher thermal stability, has higher chiral amine synthesis efficiency, and has very good industrial application prospect.

An enzyme preparation of an embodiment, comprising a transaminase mutant of an embodiment described above.

Wherein the enzyme preparation is soluble protein or immobilized enzyme.

The enzyme preparation comprises the transaminase mutant of the embodiment, has high enzyme activity, and can be used for preparing chiral amine so as to be used for preparing medicines or detection reagents. Among them, the drugs are, for example, medicines (e.g., sitagliptin) and pesticides (e.g., glufosinate). The detection reagent can be used for clinical detection or pathological diagnosis. The detection reagent is, for example, an ELISA kit.

The recombinant vector of an embodiment includes the coding sequence of the transaminase mutant of the above-described embodiments.

In one embodiment, the recombinant vector is a recombinant expression vector or a recombinant cloning vector.

In one embodiment, the recombinant vector contains a purification tag. And the purification label is arranged, so that the separation and purification of the active peptide are facilitated. Further, the purification tag is a His tag, a GST tag, or a SUMO tag. It should be noted that the purification tag is not limited to the above-mentioned purification tags, and other common purification tags can also be used as the purification tag of the recombinant vector.

In one embodiment, the recombinant vector comprises a genetic engineering vector, the nucleotide encoding the transaminase mutant is inserted into the genetic engineering vector, and further, the genetic engineering vector is a pET-32a vector, a pET28a vector, a pGEX-6P-1 vector, a pPIC-9K vector or a pPIC-Z α vector.

The recombinant vector can better preserve the nucleotide for coding the transaminase mutant, is favorable for the expression of the transaminase mutant, and can be applied to the preparation of chiral amine.

A recombinant cell comprising the coding sequence of the transaminase mutant of the embodiments described above.

In one embodiment, the recombinant cell is a cell that has been cloned with a coding sequence encoding the transaminase mutant described above.

In one embodiment, the recombinant cell is a cell expressing a coding sequence encoding the transaminase mutant described above.

In one embodiment, the recombinant cell comprises a recipient cell. The coding sequence encoding the above transaminase mutant or the above recombinant vector is located in the recipient cell.

Further, the recipient cell is Escherichia coli 10G, Escherichia coli DH5 α, Escherichia coli Top10, Escherichia coli E.coli BL21(DE3), Streptomyces, Bacillus subtilis, Aspergillus, Pichia pastoris GS115 or Pichia pastoris SMD 1168.

The recipient cell is not limited to the above-mentioned recipient cell, and other common recipient cells may also function as the recipient cell of the recombinant cell.

The recombinant cell can clone or express the transaminase mutant, so that the transaminase mutant can be prepared on a large scale, and the transaminase mutant with higher purity can be obtained by directionally expressing the transaminase mutant by the recombinant cell, so that the application of the transaminase mutant is facilitated, and therefore, the recombinant cell can be used for preparing chiral amine and can be used for preparing medicines or detection reagents. Among them, the drugs are, for example, medicines (e.g., sitagliptin) and pesticides (e.g., glufosinate). The detection reagent can be used for clinical detection or pathological diagnosis. The detection reagent is, for example, an ELISA kit.

The method for producing a recombinant cell according to the above embodiment includes steps S110 to S130 of:

s110, carrying out error-prone PCR amplification on the coding sequence of the wild transaminase of the embodiment, carrying out enzyme digestion, and connecting to an empty vector to obtain a transaminase mutation library plasmid.

Wherein, in the step of carrying out error-prone PCR amplification on the coding sequence of the wild-type transaminase of the embodiment, a primer pair with the sequence shown as SEQ ID No. 3-SEQ ID No.4 is adopted for carrying out error-prone PCR amplification. Specifically, the sequence shown as SEQ ID No.3 is: 5' -TACCAGACGACGAcatTTTGACGGCCTGG-3', wherein the underlined bases are recognition sites for restriction enzyme Nde I. The sequence shown as SEQ ID No.4 is: 5' -CTTCCATAGCCAAggatccTTCAAGACTTTCTTCAACGA-3', wherein the underlined bases are the recognition sites for the restriction enzyme BamH III.

Wherein, the reaction system of the error-prone PCR is as follows: 0.05U/. mu.L of DreamTaq^TM250 μ M dATP, 250 μ M dGTP, 1050 μ M dCTP, 1050 μ M dTTP, 0.4 μ M primer with sequence shown in SEQ ID No.3, 0.4 μ M primer with sequence shown in SEQ ID No.4, 0.2ng/μ L empty vector, and 0.3 mM-0.9 mM magnesium chloride.

Wherein, the reaction conditions of the error-prone PCR are as follows: 95 ℃, 3min, 1 cycle; 95 deg.C, 10s, 55 deg.C, 35s, 72 deg.C, 1min, 30 cycles; 72 ℃, 6min, 1 cycle.

Wherein the empty vector is pET-28a plasmid. The empty vector is not limited to the pET-28a plasmid, and may be any other empty vector commonly used in the art, for example, a pUC18 plasmid or a pUC19 plasmid.

In one embodiment, the error-prone PCR amplification step of the coding sequence of the amino acid sequence shown in SEQ ID No.1 of the above embodiment is preceded by the following steps: the coding sequence of the amino acid sequence shown as SEQ ID No.1 is amplified by PCR by adopting a primer pair shown as SEQ ID No. 3-SEQ ID No. 4. This arrangement facilitates enrichment of the coding sequence of the amino acid sequence shown in SEQ ID No.1 to facilitate construction of transaminase mutant library plasmids by error-prone PCR amplification.

Wherein, the specific description of the primer pair shown as SEQ ID No. 3-SEQ ID No.4 is detailed above, and is not repeated here.

Wherein, the reaction conditions of the PCR are as follows: at 98 ℃, 3min, 1 cycle; 30 cycles of 98 deg.C, 10sec, 55 deg.C, 10sec, 72 deg.C, 15 sec; 72 ℃, 5min, 1 cycle.

And S120, respectively transforming the transaminase mutation library plasmids into host cells to obtain transformed cells.

Wherein the host cell is Escherichia coli. The Escherichia coli expression system has the advantages of clear genetic background, high expression level of target genes, short culture period, strong pollution resistance and the like, and is an important tool in molecular biology research and the industrialized development process of biotechnology. Further, the host cell is e.coli BL21(DE 3). The host cell is not limited to the above-mentioned cells, and may be other host cells commonly used in the art.

Wherein the transformation mode is electric transformation. The transformation method is not limited to electrotransformation, and other transformation methods commonly used in the art may be used.

S130, carrying out high-throughput screening on the transformed cells by adopting an IVC-FACS method to obtain recombinant cells.

Directed evolution is a powerful tool for molecular engineering of enzymes to improve their properties in various ways. The principle is to simulate the natural evolution principle, artificially construct a gene mutation library of target protein in a laboratory, and then select out mutants which accord with expected properties by utilizing a screening means. However, because the positive rate in the mutation library is low, the conventional screening method based on the micro-porous plate or the substrate plate is time-consuming and labor-consuming due to low flux, and cannot obtain good effect in the directed evolution screening. According to the research, an ultrahigh-flux screening method based on an in vitro compartmentalization-fluorescence activated cell sorting (IVC-FACS) technology is established, so that the enzyme mutants can be efficiently and quickly screened, the screening flux can reach one million per hour, the high-flux screening method can be used for high-flux screening of a transaminase random mutation library, and the positive mutants with improved activity can be obtained in a short time.

The recombinant cell prepared by the preparation method of the recombinant cell can clone or express the transaminase mutant, so that the transaminase mutant can be prepared on a large scale, and the transaminase mutant can be directionally expressed by the recombinant cell, so that the transaminase mutant with higher purity can be obtained, and the recombinant cell has better thermal stability and is beneficial to the application of the transaminase mutant.

The research shows that the prior transaminase with higher thermal stability is mainly from deep sea or hot spring environment, has fewer natural strains and is difficult to obtain, and the culture conditions are harsher, so that the transaminase is difficult to obtain by fermentation by simply utilizing the original strain. Furthermore, the wild-type strain has extremely low enzyme expression level and is difficult to purify, so that the wild-type strain is difficult to directly apply to industrial production or causes extremely high industrial production cost. The research adopts the mode cells, can obtain the cells with simple culture conditions, short culture period and the expression quantity of the transaminase mutant by means of genetic engineering, and can easily purify the transaminase mutant by adding tags such as His, thereby obtaining the transaminase mutant with higher purity.

The following are specific examples.

Reagents and instruments used in the examples are all conventional in the art and are not specifically described. The experimental procedures, in which specific conditions are not indicated in the examples, are usually carried out according to conventional conditions, such as those described in the literature, in books, or as recommended by the manufacturer of the kits. The reagents used in the examples are all commercially available.

In the following examples, each primer was synthesized by Biotechnology (Shanghai) Ltd. T4DNA ligase was purchased from NewEngland Biolabs; PrimeSTAR Max Premix Hi Fidelity enzyme available from Takara; the pET28a plasmid was purchased from Novagen; dreamcaq DNA polymerase and all restriction enzymes were purchased from Thermo; the DNA gel recovery kit and the small plasmid extraction kit are purchased from Tiangen Biotechnology (Beijing) Ltd.

Example 1

Cloning of the coding sequence for the wild transaminase WP-0532423951.1

The coding sequence of wild-type transaminase WP _0532423951.1 was codon optimized using E.coli as host, synthesized by Biotechnology engineering (Shanghai) Inc., and the coding sequence of wild-type transaminase was PCR amplified using the primer sets shown in SEQ ID Nos. 3-4 using PrimeSTAR Max polymerase from Takara. The reaction conditions of PCR were: at 98 ℃, 3min, 1 cycle; 30 cycles of 98 deg.C, 10sec, 55 deg.C, 10sec, 72 deg.C, 15 sec; 72 ℃, 5min, 1 cycle. Wherein the amino acid sequence of the wild-type transaminase WP _0532423951.1 is shown as SEQ ID No. 1; the nucleotide sequence of the wild-type transaminase is shown in SEQ ID No. 2.

After the reaction is finished, agarose gel electrophoresis with the mass percentage content of 1.2% is used for detecting the PCR product, a 1.0kb band is obtained, and the length accords with an expected result. The target fragment was recovered and purified according to the instructions of the DNA gel recovery kit. The recovered fragment and the pET28a plasmid were double-digested with restriction endonucleases Nde I and BamH III, and then ligated with T4DNA ligase, and the ligation product was transformed into E.coli BL21(DE3) competent cells, spread on LB plates containing kanamycin (40ug/mL) and cultured for 10 hours. And (3) selecting positive strains, extracting positive cloning plasmids by using a small plasmid extraction kit, and sequencing. The sequencing detection result shows that the cloned transaminase WP _0532423951.1 gene has correct sequence and is correctly ligated into pET28a, and the recombinant plasmid is named pET28a-WP _ 0532423951.1. Positive strains were stored in glycerol.

Example 2

Expression, purification and activity determination of wild transaminase WP-0532423951.1

The engineering bacteria containing pET28a-WP _0532423951.1 recombinant plasmid in the glycerin pipe is inoculated into a 4mL LB culture medium test tube containing 100ug/mL kanamycin according to the volume ratio of 1%, and cultured for 11h at 37 ℃ and 220 rpm. Transferring 4mL of the cultured bacterial solution to 1L of LB liquid medium containing 50ug/mL of kanamycin, shaking at 220rpm at 37 ℃ for about 2.5 hours to make OD₆₀₀Reaching about 0.8, adding 0.1mM IPTG inducer, and performing induced culture at 25 deg.C and 200rpm for 12 h. And (3) carrying out solid-liquid separation on the escherichia coli suspension obtained after the induction is finished, carrying out centrifugal bacterium collection, carrying out heavy suspension on the bacterium liquid, crushing, centrifuging again, and carrying out one-step Ni-NTA affinity chromatography on the supernatant to obtain the wild transaminase with the purity of more than 90%. The specific activity of the wild transaminase WP-0532423951.1 was determined to be 8.2U/mg. Among these, the reference Arch Biochem Biophys.2000,373(1):182-92 measures the specific activity of transaminases.

Example 3

Construction of a Large-Capacity random mutation library of transaminases

A mutation library of the wild transaminase WP _0532423951.1 is constructed by a continuous error-prone PCR (ep-PCR) method, and the mutation rate of the wild transaminase WP _0532423951.1 is adjusted by adjusting the concentration of magnesium ions in a PCR system. Specifically, the coding sequence for wild transaminase WP-0532423951.1 of example 1 was usedError-prone PCR amplification was performed. The error-prone PCR reaction system is as follows: 0.05U/. mu.L of DreamTaq^TM(purchased from Takara corporation), 250. mu.M dATP, 250. mu.M dGTP, 1050. mu.M dCTP, 1050. mu.M dTTP, 0.4. mu.M primer with a sequence shown in SEQ ID No.3, 0.4. mu.M primer with a sequence shown in SEQ ID No.4, 0.2ng/μ L empty vector, 0.3 mM-0.9 mM magnesium chloride (i.e., the concentration of magnesium chloride in the PCR system is a value of 0.3 mM-0.9 mM, and the mutation rate of wild transaminase WP-0532423951.1 is adjusted by magnesium chloride of different concentrations); the total volume of each tube was 25. mu.L, and the empty vector was pET-28a plasmid. The error-prone PCR reaction conditions were: 95 ℃, 3min, 1 cycle; 95 deg.C, 10s, 55 deg.C, 30s, 72 deg.C, 1min, 30 cycles; 72 ℃, 5min, 1 cycle.

The amplification product obtained by error-prone PCR is subjected to agarose electrophoresis and gel cutting method purification, then Nde I and BamHI are used for double enzyme digestion, then T4 ligase is used for cloning onto pET28a plasmid, and the purified ligation system is electrically transformed into E.coli BL21(DE3) competent cells. The transformed cells were recovered, inoculated into 50mL of LB liquid medium (containing 50. mu.g/mL of kanamycin), and cultured overnight at 37 ℃. And taking the culture solution and extracting the plasmid by using a small plasmid extraction kit to obtain the mutant library plasmid. Meanwhile, the culture broth was spread on an LB agarose plate containing 20. mu.g/mL of kanamycin and cultured at 37 ℃ for 12 hours, and the library capacity of mutant library plasmids was calculated to be about 100 ten thousand. Several clones were tested for mutation rate using methods conventional in the art and found that at a magnesium ion concentration of 0.7mM, a mutation rate of approximately an average of 2 variant amino acid residues per gene was obtained. The plasmid of the mutant library is transformed into a host BL21(DE3), and subjected to LB liquid culture, induction and expression to obtain BL21(DE3) cells expressing the transaminase mutant library.

Example 4

IVC-FACS high throughput screening of transaminase random mutation pools

BL21(DE3) cells expressing the transaminase mutation library were encapsulated in w/o/w (water-in-oil-in-water) secondary microdroplets for enzymatic reactions.

Specifically, microdroplets were prepared using a micro membrane extruder (Avanti Polar Lipids, AL, USA), two syringes (Gastight 1001syring, 1mL, Hamilton, NV, USA) in a set and a Track-Etch polycarbonate membrane (Millipore, USA) with a pore size of 8 microns.

First, the film was set in a film extruder, and then 0.5mL of an oil phase (oil phase component: light paraffin oil containing 2.9% by volume of ABIL EM90 emulsifier) was rinsed twice with a syringe. When in emulsification, 100 mu L of an internal water phase (namely Escherichia coli BL21(DE3) -Codonplus cell suspension, wherein the OD600 is 0.6-0.8 when the cell concentration is expressed by an OD value (namely an optical density value)) and 400 mu L of an oil phase (the oil phase component is light paraffin oil containing 2.9 percent by volume of ABIL EM90 emulsifier) are sucked into the same syringe, and the mixed system is pushed into another syringe through a membrane extruder and then pushed back into the first syringe, wherein the process is called primary emulsification to generate w/o (water-in-oil) primary micro-liquid. The generated w/o primary micro-droplets are observed in real time by a microscope (50i, Nikon, Japan, 40 Xobject), and the diameters of the micro-droplets are distributed within 3-5 μm by optimizing the emulsification times.

The prepared w/o primary micro-droplets were dispersed into a secondary aqueous phase (i.e., 1 XPBS containing 1% Triton X-102 by volume, pH7.4) through a membrane with an aperture of 8 μm to form w/o/w secondary micro-droplets. The method comprises the following specific steps: a new piece of the film was placed in the film extruder and rinsed twice with 0.5mL of aqueous phase. Respectively sucking 200 mu L of w/o first-level micro-droplets and 400 mu L of secondary aqueous phase into two syringes; specifically, firstly, injecting the w/o primary micro-droplets into the secondary water phase of the second injector through a membrane extruder, and then pushing the mixed system back into the original injector through the membrane extruder to complete primary emulsification. The morphological distribution of the generated w/o/w secondary micro-droplets is observed in real time through a microscope, and the final w/o/w secondary micro-droplets have the diameter of about 10 mu m and relatively uniform size by optimizing the emulsification times. To 0.2mL of an external aqueous phase containing w/o/w secondary micro-droplets (the external aqueous phase is water, and the content of the w/o/w secondary micro-droplets is 80%), 0.02mL of a fluorogenic substrate (i.e., Amplite ADHP containing 10mM of resorufin which generates high fluorescence, available from Aladin Co., Ltd.) was added, and the mixture was incubated with shaking on a metal bath at 37 ℃ and 1000rpm for 30 minutes to perform an enzymatic reaction, with a final concentration of the fluorogenic substrate Amplite ADHP of 0.5 mM.

Using sorting type flow cytometer (BD FACSAria)^TMII) detecting a fluorescence signal of a reaction system, wherein the inner diameter of a nozzle is 100 mu m, the detection speed of a sample is 10000 drops/sec, and a liquid drop with the highest fluorescence intensity (accounting for about 0.1 percent of a liquid drop containing cells) is sorted into an empty 2mL eppendorf tube, and the positive gene is subjected to PCR amplification by taking the liquid drop as a template, wherein the PCR reaction system is as follows: 0.05U/. mu.L of DreamTaq^TM(purchased from Takara), 250. mu.M dATP, 250. mu.M dGTP, 250. mu.M dCTP, 250. mu.M dTTP, 0.4. mu.M primer having a sequence shown in SEQ ID No.3, and 0.4. mu.M primer having a sequence shown in SEQ ID No. 4. Of these, 1000 cells were sorted to a volume of about 5. mu.L. The PCR reaction conditions are as follows: 95 ℃, 3min, 1 cycle; 95 deg.C, 15s, 55 deg.C, 30s, 72 deg.C, 1min, 30 cycles; 72 ℃, 5min, 1 cycle.

The PCR product was recloned into pET-28a (+) plasmid and after plate culture, the resulting monoclonal was picked into 96-well plates containing 200. mu.L LB medium at 37 ℃ and 400 rpm; when the cell OD600 reached 0.6-0.8, 1.0mM IPTG was added and induction was carried out at 25 ℃ for 20 hours. After induction, cells were collected by centrifugation at 3000rpm for 30min, and the supernatant was discarded. And (3) carrying out freeze thawing and lysis on cells at 800bar and 4 ℃ by using a high-pressure homogenizer, adding 200 mu L of PBS into the lysate obtained after lysis, mixing uniformly, centrifuging at 3000rpm for 30min, and taking the supernatant to obtain a crude enzyme solution. mu.L of the crude enzyme solution was reacted with 10. mu.L of acetonitrile solution of 4-nitrophenylbutyrate (4-nitrophenylbutyrate concentration: 10mM, available from Sigma) and 180. mu.L of PBS in a new 96-well plate at 37 ℃ for 5min, and after the reaction, the enzyme activities of the different clones were detected with a spectrophotometer at a wavelength of 405 nm. And (3) selecting transaminase mutants with activity higher than that of wild transaminase, sequencing, culturing and expressing the positive mutants in a large amount, and purifying by using nickel column affinity chromatography to obtain the eight transaminase mutants shown in the table 1.

A protein crystal model of the wild-type transaminase WP-0532423951.1 was constructed by Swiss-model software, as shown in FIG. 1. In FIG. 1, the structures outlined by the dashed boxes are the following four mutation sites of wild-type transaminase: amino acid position 226, amino acid position 281, amino acid position 312 and amino acid position 406.

And measuring the enzyme activities of the eight transaminase mutants and the wild transaminase WP-0532423951.1, and calculating the ratio of the enzyme activity of the transaminase mutants to the enzyme activity of the wild transaminase. The reference Arch Biochem Biophys.2000,373(1):182-92 was used to determine the specific activity of the transaminases. The results are shown in Table 1. In Table 1, the fold is the fold of the enzyme activity of the transaminase mutant relative to the enzyme activity of the wild-type transaminase, "T226R/A281S" indicates the simultaneous existence of two mutations of T226R and A281S, "T226R/R406C" indicates the simultaneous existence of two mutations of T226R and R406C, "I312D/R406C" indicates the simultaneous existence of two mutations of I312D and R406C, and "T226R/A281S/I312D" indicates the simultaneous existence of three mutations of T226R, A281S and I312D.

TABLE 1 enzymatic Activity of wild-type transaminases and transaminase mutants

Through screening, the eight transaminase mutants in the table 1 are obtained, the specific activities of the eight transaminase mutants are 10.4-31.8U/mg and are 1.26-3.88 times of the specific activities of wild type transaminase mutants, and the result shows that the transaminase mutants in the embodiment have high enzyme activity.

The optimum temperatures of eight transaminase mutants of T226R, A281S, I312D, R406C, T226R/A281S, T226R/R406C, I312D/R406C, T226R/A281S/I312D and wild transaminase WP _0532423951.1 were determined by methods conventional in the art.

Through determination, the optimal temperatures of the eight transaminase mutants and the wild transaminase WP _0532423951.1 are both 55 ℃, which shows that the eight transaminase mutants have thermal stability equivalent to that of the wild transaminase WP _0532423951.1, and further shows that the eight transaminase mutants have higher enzyme activity and higher thermal stability.

In conclusion, the transaminase mutant has high enzyme activity, can catalyze α -amino and α -keto acid, can catalyze amino acid with a remote carboxylic acid group, has high substrate specificity and high stereoselectivity, has the optimal temperature of 55 ℃, high thermal stability and high chiral amine synthesis efficiency, can be used for preparing medicines or detection reagents, and has an industrial application prospect.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> institute of biomedical engineering technology of Suzhou, China academy of sciences

<120> transaminase mutant, enzyme preparation, recombinant vector, recombinant cell, preparation method and application thereof

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>440

<212>PRT

<213> Artificial Sequence (Artificial Sequence)

<400>1

Met Ser Ala Ala Lys Leu Pro Asp Leu Ser His Leu Trp Met Pro Phe

1 5 10 15

Thr Ala Asn Arg Gln Phe Lys Ala Asn Pro Arg Leu Leu Ala Ser Ala

20 25 30

Lys Gly Met Tyr Tyr Thr Ser Phe Asp Gly Arg Gln Ile Leu Asp Gly

35 40 45

Thr Ala Gly Leu Trp Cys Val Asn Ala Gly His Cys Arg Glu Glu Ile

50 55 60

Val Ser Ala Ile Ala Ser Gln Ala Gly Val Met Asp Tyr Ala Pro Gly

65 70 75 80

Phe Gln Leu Gly His Pro Leu Ala Phe Glu Ala Ala Thr Ala Val Ala

85 90 95

Gly Leu Met Pro Gln Gly Leu Asp Arg Val Phe Phe Thr Asn Ser Gly

100 105 110

Ser Glu Ser Val Asp Thr Ala Leu Lys Ile Ala Leu Ala Tyr His Arg

115 120 125

Ala Arg Gly Glu Ala Gln Arg Thr Arg Leu Ile Gly Arg Glu Arg Gly

130 135 140

Tyr His Gly Val Gly Phe Gly Gly Ile Ser Val Gly Gly Ile Ser Pro

145 150 155 160

Asn Arg Lys Thr Phe Ser Gly Ala Leu Leu Pro Ala Val Asp His Leu

165 170 175

Pro His Thr His Ser Leu Glu His Asn Ala Phe Thr Arg Gly Gln Pro

180 185 190

Glu Trp Gly Ala His Leu Ala Asp Glu Leu Glu Arg Ile Ile Ala Leu

195 200 205

His Asp Ala Ser Thr Ile Ala Ala Val Ile Val Glu Pro Met Ala Gly

210 215 220

Ser Thr Gly Val Leu Val Pro Pro Lys Gly Tyr Leu Glu Lys Leu Arg

225 230 235 240

Glu Ile Thr Ala Arg His Gly Ile Leu Leu Ile Phe Asp Glu Val Ile

245 250 255

Thr Ala Tyr Gly Arg Leu Gly Glu Ala Thr Ala Ala Ala Tyr Phe Gly

260 265 270

Val Thr Pro Asp Leu Ile Thr Met Ala Lys Gly Val Ser Asn Ala Ala

275280 285

Val Pro Ala Gly Ala Val Ala Val Arg Arg Glu Val His Asp Ala Ile

290 295 300

Val Asn Gly Pro Gln Gly Gly Ile Glu Phe Phe His Gly Tyr Thr Tyr

305 310 315 320

Ser Ala His Pro Leu Ala Ala Ala Ala Val Leu Ala Thr Leu Asp Ile

325 330 335

Tyr Arg Arg Glu Asp Leu Phe Ala Arg Ala Arg Lys Leu Ser Ala Pro

340 345 350

Phe Glu Glu Ala Ala His Ser Leu Lys Gly Ala Pro His Val Ile Asp

355 360 365

Val Arg Asn Ile Gly Leu Val Ala Gly Ile Glu Leu Ser Pro Arg Glu

370 375 380

Gly Ala Pro Gly Ala Arg Ala Ala Glu Ala Phe Gln Lys Cys Phe Asp

385 390 395 400

Thr Gly Leu Met Val Arg Tyr Thr Gly Asp Ile Leu Ala Val Ser Pro

405 410 415

Pro Leu Ile Val Asp Glu Asn Gln Ile Gly Gln Ile Phe Glu Gly Ile

420 425 430

Gly Lys Val Leu Lys Glu Val Ala

435 440

<210>2

<211>1320

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>2

atgtctgctg ctaaactgcc ggacctgtct cacctgtgga tgccgttcac cgctaaccgt 60

cagttcaaag ctaacccgcg tctgctggct tctgctaaag gtatgtacta cacctctttc 120

gacggtcgtc agatcctgga cggtaccgct ggtctgtggt gcgttaacgc tggtcactgc 180

cgtgaagaaa tcgtttctgc tatcgcttct caggctggtg ttatggacta cgctccgggt 240

ttccagctgg gtcacccgct ggctttcgaa gctgctaccg ctgttgctgg tctgatgccg 300

cagggtctgg accgtgtttt cttcaccaac tctggttctg aatctgttga caccgctctg 360

aaaatcgctc tggcttacca ccgtgctcgt ggtgaagctc agcgtacccg tctgatcggt 420

cgtgaacgtg gttaccacgg tgttggtttc ggtggtatct ctgttggtgg tatctctccg 480

aaccgtaaaa ccttctctgg tgctctgctg ccggctgttg accacctgcc gcacacccac 540

tctctggaac acaacgcttt cacccgtggt cagccggaat ggggtgctca cctggctgac 600

gaactggaac gtatcatcgc tctgcacgac gcttctacca tcgctgctgt tatcgttgaa 660

ccgatggctg gttctaccgg tgttctggtt ccgccgaaag gttacctgga aaaactgcgt 720

gaaatcaccg ctcgtcacgg tatcctgctg atcttcgacg aagttatcac cgcttacggt 780

cgtctgggtg aagctaccgc tgctgcttac ttcggtgtta ccccggacct gatcaccatg 840

gctaaaggtg tttctaacgc tgctgttccg gctggtgctg ttgctgttcg tcgtgaagtt 900

cacgacgcta tcgttaacgg tccgcagggt ggtatcgaat tcttccacgg ttacacctac 960

tctgctcacc cgctggctgc tgctgctgtt ctggctaccc tggacatcta ccgtcgtgaa 1020

gacctgttcg ctcgtgctcg taaactgtct gctccgttcg aagaagctgc tcactctctg 1080

aaaggtgctc cgcacgttat cgacgttcgt aacatcggtc tggttgctgg tatcgaactg 1140

tctccgcgtg aaggtgctcc gggtgctcgt gctgctgaag ctttccagaa atgcttcgac 1200

accggtctga tggttcgtta caccggtgac atcctggctg tttctccgcc gctgatcgtt 1260

gacgaaaacc agatcggtca gatcttcgaa ggtatcggta aagttctgaa agaagttgct 1320

<210>3

<211>29

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

taccagacga cgacattttg acggcctgg 29

<210>4

<211>39

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

cttccatagc caaggatcct tcaagacttt cttcaacga 39

Claims

1. A transaminase mutant, characterized in that the amino acid sequence of the transaminase mutant is obtained by mutation of the amino acid sequence of a wild-type transaminase, the amino acid sequence of the wild-type transaminase is shown in SEQ ID No.1, and the mutated amino acid positions include at least one of the amino acid position 226, the amino acid position 281, the amino acid position 312 and the amino acid position 406.

2. The transaminase mutant according to claim 1, characterized in that the way of mutation comprises at least one of the following ways of mutation: T226R, a281S, I312D and R406C.

3. The transaminase mutant of any one of claims 1 to 2, characterized in that the coding sequence of the wild-type transaminase is shown in SEQ ID No. 2.

4. An enzyme preparation comprising the transaminase mutant of any one of claims 1 to 3.

5. A recombinant vector comprising the coding sequence of the transaminase mutant of any one of claims 1 to 3.

6. A recombinant cell comprising the coding sequence of the transaminase mutant of any one of claims 1 to 3.

7. The method for producing a recombinant cell according to claim 6, comprising the steps of:

8. The method for preparing recombinant cells according to claim 7, wherein the step of error-prone PCR amplification of the coding sequence of the wild-type transaminase is performed by using a primer pair having the sequences shown in SEQ ID No.3 to SEQ ID No. 4.

9. The method for producing recombinant cells according to any one of claims 7 to 8, wherein the step of error-prone PCR amplification of the coding sequence of the wild-type transaminase is preceded by the following steps: and adopting a primer pair with the sequence shown as SEQ ID No. 3-SEQ ID No.4 to amplify the coding sequence of the wild transaminase by PCR.

10. Use of the transaminase mutant of any one of claims 1 to 3, the enzyme preparation of claim 4, the recombinant vector of claim 5 or the recombinant cell of claim 6 for the preparation of a medicament or a test reagent.