CN111110848B

CN111110848B - Application of PIWIL4 as target of medicine for activating HIV-1 latent infection

Info

Publication number: CN111110848B
Application number: CN201911128819.5A
Authority: CN
Inventors: 张辉; 张峻崧; 何章平
Original assignee: National Sun Yat Sen University
Current assignee: National Sun Yat Sen University
Priority date: 2019-11-18
Filing date: 2019-11-18
Publication date: 2021-02-23
Anticipated expiration: 2039-11-18
Also published as: CN111110848A

Abstract

The invention discloses an application of PIWIL4 as a target of a medicine for activating HIV-1 latent infection. The invention finds a new target to develop a new treatment scheme for activating latent HIV-1 infection. The novel target is PIWIL4, peripheral blood CD4 derived from HIV-1 infected patients⁺The knock-down of PIWIL4 in T lymphocytes enabled the activation of replication competent HIV-1 virus. After the knock-down of a new target PIWIL4, the application of HIV-1 latently infected cells to the response activation of LRAs such as SAHA, JQ1, prostratin or Decitabine can be remarkably promoted.

Description

Application of PIWIL4 as target of medicine for activating HIV-1 latent infection

Technical Field

The invention relates to the technical field of treatment of HIV-1 virus, in particular to application of PIWIL4 as a target of a medicine for activating HIV-1 latent infection.

Background

Human immunodeficiency virus type I (HIV-1) is the causative agent of acquired immunodeficiency syndrome (AIDS). Although combined antiretroviral therapy (cART) can effectively inhibit the replication of HIV-1 in a virus-infected patient, the cART cannot eliminate virus reservoirs which are formed and stably exist in the latent HIV-1 infection process, so that the aim of radically treating diseases cannot be achieved. The viral reservoir is a long-term existence of HIV-1 integrated into the host cell genome and forming a stable provirus, and once cART is stopped, viremia can be formed again in a short time by viral replication in a patient, so that the patient needs to take medicines for a lifetime.

The HIV-1 infection is hardly cured by the current treatment means, and the concept of 'functionally curing AIDS' is realized by using the 'Shock and kill' treatment means. That is, under the action of latent-converting agent (LRA), HIV-1 provirus integrated on host chromosome is converted from transcriptional silence to transcriptional activity and re-expresses virus-associated antigen, and then HIV-1 virus storage is cleared through endogenous and exogenous mediated killing action, and cART is always maintained in the process so as to prevent new infection establishment and virus storage expansion.

However, data from clinical trials conducted with existing LRAs show that this strategy is not effective in reducing reservoir size. The clinical test results indicate that continuous efforts in two directions are needed, one is to improve the capability of the immune system to recognize and eliminate HIV-1 antigen specific immune response, and the other important problem to be solved urgently is how to effectively activate HIV-1 latent infection.

At present, the development of drugs aiming at new targets is imminent, and more importantly, the future development direction should be the development of multi-target drugs, or the development of drugs aiming at new paths or new targets can be combined with the current mature LRAs to show good co-activation effect.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides the application of PIWIL4 as a target of a medicine for activating HIV-1 latent infection.

The first purpose of the invention is to provide the application of either PIWIL4 gene or PIWIL4 protein as a target of drugs for activating HIV-1 latent infection.

The second purpose of the invention is to provide the application of the inhibitor of either PIWIL4 gene or PIWIL4 protein in preparing the medicine for promoting the response activation of HIV-1 virus latent infected cells to latent activators.

A third object of the present invention is to provide the use of an inhibitor of either PIWIL4 gene or PIWIL4 protein as an enhancer of latent activators.

The fourth purpose of the invention is to provide the application of either PIWIL4 gene or PIWIL4 protein as a target for screening drugs for activating HIV-1 virus latent infection.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the PIWI proteins belong to a subfamily of the AGO protein family, and are homologous to the Drosophila (Drosophila melanogaster) PIWI proteins. Members of the PIWI protein family each contain two conserved functional domains: (P-element induced nucleic acids PIWI-AGO-Zwille) PAZ structural domain which is positioned at the N end of the protein sequence and is responsible for combining piRNA to play corresponding functions, and PIWI structural domain which is positioned at the C end of the protein sequence and has double-strand specific RNAase endonuclease activity. The human genome shares 4 PIWI protein expressions, specifically named PIWI like RNA mediated gene cloning (PIWIL) protein. The accession numbers of PIWIL4 above NCBI are: 143689.

the invention utilizes a protein immunoblotting experiment to detect the peripheral CD4 of the PIWIL4 protein in the resting and activated states⁺Expression in T lymphocytes, human peripheral blood CD4 in resting and activated states of PIWIL4 was found⁺T lymphocytes are expressed; the wild type HIV-1 virus is found in activated peripheral CD4 by siRNA interference experiment⁺Replication in T lymphocytes is affected by expression of endogenous PIWIL4, HIV-1 replication is enhanced after PIWIL4 is knocked down; the regulation of the activity of the HIV-15' LTR promoter by PIWIL4 was verified using TZM-bl (integrated HIV-1LTR activity assay) cell system, and it was found that PIWIL4 specifically inhibits the HIV-1 promoterActivity; shRNA interference experiments realized by lentivirus infection show that PIWIL4 can cause the expression of GFP driven by an HIV-1 promoter to be increased after being knocked down, and prove that the PIWIL4 can activate latent HIV-1 after being knocked down, and simultaneously show that the PIWIL4 can remarkably promote the response activation of HIV-1 latency on LRAs such as Vorinostat (SAHA), JQ1, prostratin or Decitabine, and the function of the PIWIL4 in maintaining the HIV-1 latent infection state of HIV-1 infected Jurkat cells; the change of the capability of various PIWIL4 truncated mutants to act on a specific region of HIV-15 'LTR is compared by using a chromatin immunoprecipitation-quantitative PCR (ChIP-qPCR) experiment, and firstly, the acting region of PIWIL4 on HIV-15' LTR is found to be between Nucleosome 1(Nucleosome, Nuc 1) and Nuc 2; and through a series of experiments on TZM-bl, it is found that the PAZ domain is necessary for PIWIL4 to enter the nucleus and act on HIV-15' LTR to play an inhibition function; through protein co-immunoprecipitation and chromatin co-immunoprecipitation-quantitative PCR experiments, PIWIL4 was found to recruit a series of epigenetic inhibitory modifiers to act on HIV-15' LTR and mediate the formation of epigenetic modification (H3K9me2/3) of inhibitory H3K9 in the region; constructing a cell line stably expressing the PIWIL4 with HA tags by infecting Jurkat latency (J-lat)10.6 cells with lentivirus, enriching proteins interacting with HA-PIWIL4 by an HA tag antibody co-immunoprecipitation method, and proving that histone deacetylase (HDAC 4) is a binding protein of PIWIL4 by mass spectrometry identification and co-immunoprecipitation experiments; further, through ChIP-qPCR and shRNA interference experiments, HDAC4 is found to act on HIV-15' LTR through the mediation of PIWIL4 and participate in the regulation of HIV-1 latent infection; finally, the determination of CD4 in peripheral blood from HIV-1 infected patients was performed using siRNA interference experiments and viral growth experiments (VOA)⁺Knockdown of PIWIL4 in T lymphocytes activated replication competent HIV-1 virus (FIG. 1).

CD4 in HIV-1 infection⁺In T lymphocytes, PIWIL4 was able to form corresponding inhibitory epigenetic modifications in the HIV-15' LTR promoter region and promote the formation of heterochromatin in this region by recruiting H3K9 inhibitory modifiers including SETDB1 and HP1 α/β/γ and HDAC4, ultimately leading toTranscription of the HIV-15' LTR promoter is inhibited and the latent infection state of HIV-1 is maintained.

The invention therefore claims the following:

the application of either PIWIL4 gene or PIWIL4 protein as a target of a medicament for activating HIV-1 latent infection.

Preferably, the PIWIL4 protein acts on the HIV-15' LTR by recruiting histone H3K9 inhibitory modification proteins to inhibit HIV-1 viral replication.

Preferably, the activity of the PAZ domain is essential for the PIWIL4 protein to act on the HIV-15' LTR and inhibit HIV-1 viral replication.

Use of an inhibitor of either the PIWIL4 gene or the PIWIL4 protein in the manufacture of a medicament for promoting activation of a response of a latently infected cell of the HIV-1 virus to a latently activating agent.

Use of an inhibitor of either PIWIL4 gene or PIWIL4 protein as an enhancer of latent activators.

The use of

claim

4 or 5, wherein the latent reverse transcriptase is one or more of SAHA, JQ1, prostratin, or Decitabine.

The application of any one of PIWIL4 gene or PIWIL4 protein as a target for screening drugs for activating HIV-1 virus latent infection.

Compared with the prior art, the invention has the following beneficial effects:

the invention finds a new target to develop a new treatment scheme for activating latent HIV-1 infection. The novel target is PIWIL4, peripheral blood CD4 derived from HIV-1 infected patients⁺The knock-down of PIWIL4 in T lymphocytes enabled the activation of replication competent HIV-1 virus. After the knock-down of a new target PIWIL4, the application of HIV-1 latently infected cells to the response activation of LRAs such as SAHA, JQ1, prostratin or Decitabine can be remarkably promoted.

Drawings

FIG. 1 is a schematic diagram of the ability of PIWIL4 to form corresponding inhibitory epigenetic modifications in the HIV-15 'LTR promoter region and promote the formation of heterochromatin in this region by recruiting H3K9 inhibitory modifiers including SETDB1 and HP1 α/β/γ and HDAC4, ultimately leading to transcriptional repression of the HIV-15' LTR promoter and maintenance of the latent infection state of HIV-1.

FIG. 2 shows PIWIL4 in resting and activated peripheral blood CD4⁺Detection of expression in T lymphocytes.

FIG. 3 shows the enhancement of HIV-1 replication following knockdown of PIWIL 4.

FIG. 4 shows that PIWIL4 specifically inhibited HIV-1 promoter activity.

FIG. 5 shows that PIWIL4, when knocked down, activates the latent viral reservoirs in the J-lat cell line, and also significantly promotes HIV-1 latency-responsive activation of LRAs such as Vorinostat (SAHA), JQ1, prostratin or Decitabine; a: j-lat10.6 cells; b: j-lat 8.4 cells. P < 0.05; p < 0.01; p < 0.001.

FIG. 6 is a PAZ domain mediated action of PIWIL4 on the region between Nuc-1 and Nuc-2 on the HIV-15' LTR; a: the results of ChIP-qPCR assay showed that PIWIL4 acts on the 5' LTR region of HIV-1 genome in DNA of J-lat10.6 cells; b: PIWIL4 acts on the region between Nuc-1 and Nuc-2 on the HIV-15' LTR in the DNA of J-lat10.6 cells; c: the PAZ domain mediates the action of PIWIL4 on the region between Nuc-1 and Nuc-2 on the HIV-15' LTR. P < 0.05; p < 0.01; p < 0.001.

FIG. 7 shows the results of ChIP-qPCR experiments indicating that PIWIL4 can recruit histone H3K9 inhibitory modification protein to act on HIV-15' LTR and mediate the formation of epigenetic modification of this region inhibitory H3K 9; a: PIWIL4 recruits histone H3K9 inhibitory modification proteins to act on the HIV-15' LTR; b: PIWIL4 mediated the formation of epigenetic modifications of inhibitory H3K9 in this region. P < 0.05; p < 0.01; p < 0.001.

FIG. 8 shows that HDAC4 can act on HIV-15' LTR via PIWIL 4; a: HDAC4 interacts with PIWIL 4; b: PIWIL4 recruited HDAC4 to act on the HIV-15' LTR. P < 0.05; p < 0.01; p < 0.001.

FIG. 9 is a drawing of peripheral blood CD4 from HIV-1 infected patients⁺The reduction of PIWIL4 in T lymphocytes can activate HIV-1 virus with replication ability; a: PIWIL4 knockdown increased CD4⁺T lymphocytesThe amount of endogenous viral RNA; b: PIWIL4 knockdown increased the amount of HIV-1 virions secreted in the supernatant; c: PIWIL4 knockdown activated HIV-1 virions had infectious activity. P<0.001。

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1 PIWIL4 peripheral blood CD4⁺Expression in T lymphocytes

First, experiment method

The collected patient whole blood samples were diluted with room temperature PBS or 0.9% NaC1 solution, and 20mL of whole blood samples were diluted to 50 mL. Each 25mL of the cell suspension was overlaid on 20mL of Ficoll (density 1.077g/mL), and the contiguous liquid surface was carefully not disrupted, and centrifuged at 450g for 25 minutes at 20 ℃. After centrifugation, the intermediate layer mononuclear cells were carefully aspirated, washed 3 times with 1 XPBS (containing heparin 0.5U/mL), centrifuged for the first time at 4 ℃ at 450g for 10 minutes, followed by centrifugation at 220g for 8 minutes. Resuspend the isolated PBMC to 10 with PBS⁸Cells/ml. Adding CD4 enrichment cocktail antibody, and using the amount of BD bead negative selection CD4⁺Instructions for the T lymphocyte kit were performed.

The cells obtained by magnetic bead sorting are collected by centrifugation at 350g for 5 minutes at room temperature and then frozen, or are resuspended in an appropriate amount of RPMI1640 complete medium, and the cells are treated with anti-CD3 (1. mu.g ml)^-1)，anti-CD28(1μg ml^-1) And a cytokine IL-2(10ng/ml), culturing for 48-72 hours, then collecting the cells after freezing and the cells before freezing, re-suspending the cells by using a lysis solution containing PMSF and cocktail, and cracking for 60 minutes on ice. Vortex for 10 seconds every ten minutes. 12000g,4 ℃, 10 minutes of centrifugation. The supernatant was aspirated, and 5 × loading buffer was added in proportion, followed by shaking and heating at 100 ℃ for 10 minutes. SDS-PAGE protein electrophoresis gels were prepared at 10% concentration. Taking samples with proper volume, sequentially loading the samples at 60V, 30 minutes and 120V,and 55 minutes. After electrophoresis, proteins were transferred from the PAGE gel to NC membrane by wet transfer at 60V for 2 hours. The NC membrane was blocked with 5% skim milk powder TBS solution for 1 hour at room temperature. The residual milk on the membrane was washed with TBS solution and incubated primary antibody at 4 ℃ overnight. The membrane was washed three times with 0.1% TBS-T and incubated with fluorescent secondary antibody in the dark for 1 hour at room temperature. The membrane was washed three times with 0.1% TBS-T and swept with an Odyssey two-color infrared laser imaging system.

Second, experimental results

Detection of PIWIL4 in resting and activated peripheral blood CD4 by immunoblotting⁺Stable expression in T lymphocytes (figure 2).

Example 2 Effect of knockdown of PIWIL4 on HIV-1 replication

First, experiment method

(I), HIV-1 Virus infection experiment:

CD4⁺after T lymphocytes were activated, siRNA designed and synthesized by leber bio, guangzhou was transfected using Lipofectamine RNAi MAX transfection reagent for RNA interference experiments. 200pmol siRNA and 10. mu.l transfection reagent were incubated with 100. mu.l Opti-MEM, and after standing at room temperature for 5 minutes, the two were mixed, and then allowed to stand for 15 to 20 minutes, and added to 1ml of cultured CD4⁺T lymphocyte (2X 10)⁶/ml) in wells of a 24-well plate and mixed by beating. HIV-1 virus infection can be carried out 12-24 hours after cell transfection. Cells were infected with 5ng of P24 amount of virus per ml, incubated in an incubator for 6h, and the cells were harvested, the old medium removed, and washed 3 times with PBS. The culture was carried out in RPMI1640 medium supplemented with IL-2(10 ng/ml). Half of the original volume was taken from the culture supernatant at 6 hours (day 0), 3 days, 6 days, and 9 days after infection, respectively. After harvest, new medium for IL-2(10ng/ml) was added to the original volume. Cell culture supernatants were tested using the P24 test kit.

(II) packaging the virus:

non-HIV-1 wild-type viruses were concentrated using PEG6000 using calcium phosphate precipitation. The concrete steps are as follows:

1. using 1.5-2 x 10⁶HEK293T cells were plated on 10 cm dishes and cultured at 37 ℃ for 24 hours to reach a cell density of 60Transfection was performed after% to 90%.

2. Adding wild type virus plasmid or virus envelope plasmid, helper plasmid and virus skeleton plasmid not more than 30 μ g into 1.5 ml centrifuge tube, adding 50 μ l of 2.5M filter sterilized CaCl₂Adding water to supplement 500 microliters, fully blowing and uniformly mixing, dropwise adding an isovolumetric 2 XHeBS solution, violently and uniformly mixing, standing for more than 5 minutes, adding the mixture into a 10 cm culture dish, culturing at 37 ℃ for 9-12 hours, replacing a fresh culture medium, transfecting for 48 hours, collecting a supernatant, filtering by using a 0.45 mu m filter, then putting into a 15ml centrifuge tube, and immediately using the wild type virus or storing at-80 ℃ after subpackaging.

3. 2 ml of 50% PEG6000 and 1.25 ml of 4M NaCl were added to 6.75 ml of the culture supernatant. The mixture was inverted and left at 4 ℃ for at least 12 hours.

4. The mixture was centrifuged at 3100g and 4 ℃ for 30 minutes to completely remove all supernatant, and fresh medium was added in an appropriate volume to resuspend the virus for immediate use or for split charging and storage at-80 ℃.

Second, experimental results

The results show that siRNA interferes with knockdown of activated CD4⁺Expression level of PIWIL4 in T lymphocytes (left in fig. 3); HIV-1 viral infection demonstrated that PIWIL4 inhibited viral replication of HIV-1 (FIG. 3, right).

Example 3 Effect of PIWIL4 on HIV-1

First, experiment method

TZM-bl cells were cultured in DMEM complete medium, passaged when the cell density reached about 90%, and the experimental procedure was performed in a biosafety cabinet. The old medium was removed, the cells were washed once with PBS and digested for 3 minutes at 37 ℃ with the addition of 1ml of 0.05% Trypsin/EDTA. In the case of cell shedding

Removing Trypsin/EDTA, adding a proper amount of fresh culture medium to stop digestion, blowing, falling and scattering cells by using a sterile dropper to form a cell suspension, transferring the cells into a culture dish or a culture bottle by a proper volume of 1/4-1/6, adding the fresh culture medium, shaking and uniformly mixing, and continuing to culture.

TZM-bl as 2X 10⁴The density of each well was laid down in 48 well plates. 12-24 hours later, each hole is firstly rotated30pmol siRNA was stained, 10ng of pcDNA3.1-Tat-HA was transfected after 12 hours, and TNF-. alpha. (50ng/ml) was added to the cells of the corresponding group 24 hours before harvesting. And (3) collecting samples 48 hours after plasmid transfection, removing a supernatant culture medium, washing cells twice by using PBS, adding 100 mu l of Pasive Lysis Buffer into each hole, carrying out shaking Lysis for 30 minutes at room temperature, carrying out short-time centrifugation, adding the samples into a white enzyme label plate and 10 mu l/hole, and measuring by using a prepared luciferase double-reporter reagent in a detection chemiluminescence detector.

Second, experimental results

As shown in FIG. 4, PIWIL4 specifically inhibited HIV-1 promoter activity. P < 0.01; p < 0.001.

Example 4 Effect of knocking down PIWIL4 on activation and LRAs of latent HIV-1 infection

First, experiment method

J-lat10.6 and J-lat 8.4 cell lines were constructed from Dr. eric Verdin and co-workers and were obtained from Dr. Robert F.Silicano (Department of Medicine, Johns Hopkins University School of Medicine, Baltimore, MD, USA) laboratories as a gift. The shRNA lentiviral vector is obtained by cloning a target sequence to a pLKO.1-RFP vector by utilizing forward and reverse primer synthesis, annealing pairing and T4 DNA ligase connection method. All clones were confirmed by sequencing. The primer sequence is derived from SIGMA official website (F: CCGGCCGACCATATGCAGAGACTTACTCGAGTAAGTCTCTGCATATGGTCGGTTTTTG; R: AATTCAAAAACCGACCATATGCAGAGACTTACTCGAGTAAGTCTCTGCATATGGTCGG)

J-lat10.6 and J-lat 8.4 cell lines were cultured in RPMI1640 complete medium. The PIWL 4-specific or control shRNA lentiviruses were packaged, concentrated, respectively, and infected with J-lat10.6 or J-lat 8.4 cells, respectively, as described in example 1.

Flow cytometry detection after shRNA infection is as follows: cells were centrifuged at 350g for 5 min at room temperature, and cells were harvested 4 days after the shRNA-infected concentrated virus and continued to be cultured in an incubator. Washed once with PBS. Resuspend the cells in PBS containing 2-4% paraformaldehyde, and store temporarily at 4 ℃ in the dark or directly analyze by flow cytometry. RFP + cells represent cells infected with shRNA virus, from which GFP + cell proportion and mean fluorescence intensity were analyzed on the basis. Data were collected by BD LSR II Fortessa flow cytometer and analyzed by FlowJo software (v10.0.7).

Second, experimental results

Analysis of the flow cytometric results showed that both J-lat10.6 and J-lat 8.4 cells reversed HIV-1 latency to varying degrees after PIWIL4 knockdown.

In addition, stimulation with SAHA, JQ1 or prostratin alone was continued for 24 hours in the case of knockdown PIWIL 4. Analysis of GFP by FlowJo software⁺Cell proportion and MFI of cells, demonstrating that knockdown PIWIL4 can significantly enhance the activation of the three LRAs described above for latent HIV-1 infection in J-lat10.6 and J-lat 8.4 cells.

After the PIWIL 4-knocked-down J-lat 8.4 cells were treated with the DNA cytosine methylase inhibitor Decitabine for 4 days, the examination was carried out by flow cytometry, and the result shows that the knocking-down PIWIL4 can also remarkably enhance the activation effect of Decitabine on HIV-1 latent infection in J-lat 8.4 cells (FIG. 5).

*P<0.05；**P<0.01；***P<0.001。

Example 5 PIWIL4 region of action

First, experiment method

(I), cloning and plasmid construction

Cloning the DNA target fragment obtained by PCR amplification of the specific primer to a target vector by using a double enzyme digestion-T4 DNA ligase connection method. The PIWIL4 was obtained by PCR using the total cDNA of PBMC as a template and then cloned into pcDNA3.1 vector. The HA tag sequence or nuclear entry signal (NLS) was introduced by PCR. The fragment deletion mutations of PIWIL4 were all introduced by means of overlapping PCR and cloned into pcDNA3.1 vector. The PAZ domain active site mutant PIWIL4-PAZmut is synthesized and cloned by Guangzhou Tianyihui biological technology limited company.

Table 1 primers used for PCR:

(II), ChIP-qPCR

1. Chromatin co-immunoprecipitation experiments were performed according to the protocol provided by the ChIP kit (9003s) from CST.Briefly described as follows: a single co-immunoprecipitation experiment required 4X 10⁶A TZM-bl cell or 8X 10⁶J-lat10.6 cells. Study of PIWIL4 binding region on HIV-15' LTR, TZM-bl cells transfected HA-tagged wild-type or mutant PIWIL4 in the case of knockdown of endogenous PIWIL 4; study of PIWIL4 recruited proteins aggregated on the HIV-15' LTR, TZM-bl cells and J-lat10.6 cells both established an experimental group and a control group for knockdown of endogenous PIWIL 4. The collected cells were first fixed with 1% formaldehyde at room temperature for 10 minutes and then treated with 0.125M glycine for 5 minutes to stop crosslinking. Centrifuging at 500g for 5 min, removing supernatant, washing with precooled PBS for 2 times, disrupting cell membrane with liquid A containing DTT, centrifuging cell nucleus, washing with liquid B containing DTT for one time, suspending the cells again with liquid B, adding 0.5 μ l of Microcosyme, digesting at 37 ℃ for 20 min, mixing by gentle inversion every 4 min, terminating digestion with 50mM EDTA, and centrifuging at 13000rpm for 1 min at 4 ℃. Resuspend the nuclei in 500. mu.l ChIP buffer, sonicate the nuclear membrane (40% amplitude, 20s on,30s off, 3 cycles) under ice bath conditions, centrifuge at 10000rpm for 10 min at 4 ℃ after sonication, transfer the supernatant to a clean 1.5 ml EP tube, freeze-80 ℃ or directly perform downstream experiments. The concentration of chromatin DNA was determined by measuring OD260 readings. The length of the digested DNA is determined by DNA gel electrophoresis and should be in the range of 150 to 900 bp. Each set of co-immunoprecipitation experiments required approximately 10. mu.g of chromatin DNA in a 500. mu.l reaction, and 2% of the mass of chromatin DNA was taken as input for calculation of aggregation efficiency. Chromatin DNA from each set of reaction systems incubated with the corresponding antibodies at 4 ℃ overnight. Incubation was continued for 2 hours at 4 ℃ with the addition of 30. mu.l of ChIP-grade protein G-coupled magnetic beads. After incubation, the column was eluted with low-salt eluent 3 times and high-salt eluent 1 time, respectively. And (3) performing crosslinking and proteinase K digestion on the input sample and the sample which is incubated with the antibody and is eluted to remove non-specific binding, purifying DNA, and performing downstream fluorescent quantitative PCR (polymerase chain reaction) experiment.

2. Mixing the reaction components according to the following reaction system:

3. two-step PCR amplification is adopted, and the conditions are as follows: pre-denaturation at 95 ℃ for 1 min; then for a total of 40 cycles: denaturation at 95 ℃ for 10 seconds, and annealing and extension at 60 ℃ for 30 seconds; the dissolution curve was taken from 60 ℃ to 95 ℃ with 1 ℃ every 5 seconds.

4. The number of jump-start cycles (Ct) of each target RNA was obtained by amplification. According to 2^-ΔΔCtThe relative expression level was calculated by the method, and the expression level of GAPDH was used as an internal control.

Second, experimental results

The input DNA obtained by purification of the PIWIL4 antibody group and the IgG antibody group, respectively, and the DNA obtained by immunoprecipitation were detected with 8 primers covering different regions of the HIV-1 genome. Quantitative PCR results indicated that the PIWIL4 antibody panel had significant aggregation in the indicated HIV-15' LTR region relative to the IgG panel (FIG. 6A). There are 3 contiguous nucleosomes on the HIV-15' LTR and its terminal Gag Leader Sequence (GLS), specifically designated Nuc 0, Nuc 1 and Nuc 2.

To further refine the region of PIWIL4 that aggregates on the 5' LTR, quantitative PCR detection with the new 4 pairs of primers was continued, and the results showed that PIWIL4 aggregates mainly in the region between Nuc 1 and Nuc 2 (fig. 6B). The experimental results show that inactivation or deletion of the PAZ domain significantly reduced the degree of aggregation of PIWIL4 on the HIV-15' LTR, whereas introduction of NLS sequence was not able to reverse this effect (fig. 6C). P < 0.05; p < 0.01; p < 0.001.

Taken together, the PAZ domain mediates PIWIL4 action on the region between Nuc-1 and Nuc-2 on the HIV-15' LTR.

Example 6 Effect of PIWIL4 on recruitment of Histone H3K9

1. Experimental methods

Packaging and concentrating PIWIL4 specific or control shRNA lentivirus to infect J-lat10.6 cells, and collecting the cells after infection for downstream ChIP-qPCR experiment.

2. Results of the experiment

PIWIL4 was able to recruit histone H3K9 inhibitory modification proteins including SETDB1 and HP1 α/β/γ to act on HIV-15' LTR (fig. 7A); PIWIL4 was also able to mediate the formation of epigenetic modifications of this region inhibitory H3K9 (fig. 7B). P < 0.05; p < 0.01; p < 0.001.

Claims

Use of an inhibitor of either PIWIL4 gene or PIWIL4 protein in the manufacture of a medicament for promoting the response activation of HIV-1 virus latently infected cells to a latently activating agent, wherein the inhibitor is shRNA or siRNA, and the latently activating agent is one or more of SAHA, JQ1, prostratin, or Decitabine.
The application of an inhibitor of any one of PIWIL4 gene or PIWIL4 protein in preparing an enhancer of a latent activator is characterized in that the latent reverse transcription agent is one or more of SAHA, JQ1, prostratin or Decitabine, and the inhibitor is shRNA or siRNA.