CN111100910A - Primer probe and kit for qualitatively detecting aspergillus with toxin-producing potential - Google Patents
Primer probe and kit for qualitatively detecting aspergillus with toxin-producing potential Download PDFInfo
- Publication number
- CN111100910A CN111100910A CN201811254595.8A CN201811254595A CN111100910A CN 111100910 A CN111100910 A CN 111100910A CN 201811254595 A CN201811254595 A CN 201811254595A CN 111100910 A CN111100910 A CN 111100910A
- Authority
- CN
- China
- Prior art keywords
- probe
- real
- aspergillus
- latent
- toxigenic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a primer and a probe for detecting latent toxigenic aspergillus. The invention also relates to a Real-time PCR detection method for detecting the latent aspergillus toxigenic in food, which comprises the use of specific oligonucleotide primers and probes for detecting the latent aspergillus toxigenic. The invention also relates to a Real-time PCR detection kit for the latent aspergillus toxigenic in food, which comprises specific oligonucleotide primers and probes. The Real-time PCR detection method can be used for simply, quickly, specifically and sensitively detecting the latent toxigenic aspergillus.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an oligonucleotide primer and a probe for quickly detecting latent aspergillus toxigenic with high specificity and high sensitivity, a dual Real-time PCR detection kit containing the primer pair and the probe, a Real-time PCR detection method for detecting the latent aspergillus toxigenic, and application of the primer pair, the probe or the kit in quickly detecting the latent aspergillus toxigenic.
Background
Fungi are a class of microorganisms that have cell walls, do not contain chlorophyll, do not have leaves and stems, live in a saprophytic or parasitic manner, and are capable of sexual or asexual reproduction. Mycotoxins are toxic materials produced by fungiSecondary metabolite, and plant products such as widely polluted crops, food and feed. The fungi and the mycotoxin produced by the fungi have the characteristics of strong toxicity, stable structure, small molecular weight and the like, are widely distributed in nature, and have more chances of infecting stored grains, animal feeds and foods. Common toxigenic fungi, e.g. Aspergillus (A. sp.), (B. sp.)Aspergillus) Penicillium genus (Penicillium) And Fusarium (F)Fusarium) Under appropriate conditions
Reproduction and generation of toxic secondary metabolite mycotoxins, over 400 of which have been found to cause acute and chronic intoxications and carcinogenic, teratogenic and mutagenic hazards.
In recent years, the incidence of invasive fungal infection in immunocompromised patients increases year by year, and fungal infectious diseases are common diseases and frequently encountered diseases, and are closely related to the wide application of broad-spectrum antibiotics, glucocorticoids and immunosuppressants. Mycoses have become one of the important diseases affecting the quality of life and threatening the life and health of human beings. Candida and aspergillus are the major opportunistic pathogens responsible for invasive fungal infections. The incidence of invasive aspergillosis in neutropenic patients is second only to candida infection, and invasive aspergillosis has become a major cause of death in immunocompromised patients.
However, the prevention of mycotoxin damage cannot be directed only to mycotoxins themselves, and is equally important for monitoring of toxigenic fungi. The traditional means for detecting the toxigenic fungi mainly comprises dilution plating inoculation and a method for identifying a culture medium or immunology, so that the traditional means is time-consuming and labor-consuming, needs expensive equipment and has rich mycology professional knowledge. The traditional fungus detection method is complicated and time-consuming in operation, depends on experience, is long in culture identification time, has serious hysteresis, cannot give early warning to pollution in time, and even if the method is used, the method is inexperienced in restraining false positive and unnecessary purified samples. For example, TLC methods are complicated in sample processing, long in analysis time and poor in sensitivity. More methods aim at detecting mycotoxin, and although the ELISA method can carry out large-scale detection, the repeatability is poor, the service life of reagents is short, low-temperature storage is needed, and the false positive rate is high. The HPLC method is used for detecting mycotoxins, although separation of various toxins can be completed and quantification is accurate, instruments are expensive, speciality is high, required sample purity is high, common mobile phases and derivative biochemical reagents are extremely toxic, and the detection is difficult to adopt in common laboratories. RIA requires the use of radioactive elements, which is very likely to cause pollution to detection personnel and the environment. It is further noted that all of the above methods are directed to the detection of samples that have been produced toxins, and are ineffective for those samples that have been contaminated with an aflatoxin-producing strain but have not produced or produced extremely low levels of toxins. Therefore, there is an urgent need to establish a method for rapidly detecting a toxigenic fungus. In recent years, with the change of molecular biology technology, more and more molecular biology technologies based on PCR are applied to fungal identification, typing, drug-resistant gene detection, and the like, such as one-step PCR, repeat sequence PCR, random amplified polymorphic dna (rapd), PCR-enzyme-linked immunosorbent assay (EIA), nested PCR, PCR-Restriction Fragment Length Polymorphism (RFLP), gene chips, real-time fluorescence PCR, and the like. The real-time fluorescence PCR method is simple, convenient, accurate and rapid to operate and is widely applied to fungus identification.
The invention is based on the molecular biology technology based on real-time fluorescent PCR, takes the DNA of the latent aspergillus toxigenic as the detection basis, takes the internal transcribed spacer 2 (ITS 2) in the ribosome RNA gene of the latent aspergillus toxigenic as the target gene design primer and probe, and utilizes the real-time fluorescent PCR method to detect the latent aspergillus toxigenic in the sample. The method breaks through the defect that the existing instrument method only targets the toxin and cannot predict the toxin-producing potential of a sample before the toxin is formed or in an early stage, monitors whether the latent toxin-producing aspergillus exists or not in advance, realizes effective prevention and control of toxin pollution and harm, and adds a quick and accurate technical means for diagnosis of the latent toxin-producing aspergillus.
Disclosure of Invention
An object of the present invention is to provide specific oligonucleotide primers and probes for rapidly detecting latent aspergillus toxigenic.
Another objective of the invention is to provide a real-time fluorescence PCR detection method for rapidly detecting latent toxigenic aspergillus.
The invention further provides application of the specific oligonucleotide primer and the probe of the latent aspergillus toxigenic in detecting the latent aspergillus toxigenic in food.
Aiming at the above purpose, the invention provides the following technical scheme:
the invention takes the DNA of the latent aspergillus toxigenic as the detection basis, takes the internal transcribed spacer 2 (ITS 2) in the ribosome RNA gene of the latent aspergillus toxigenic as the target gene design primer and probe, and utilizes the real-time fluorescence PCR method to detect the latent aspergillus toxigenic in the sample.
In one embodiment, the present invention provides oligonucleotide primer sets and probes for detecting latent aspergillus toxigenic by a real-time fluorescent PCR method, which are designed based on the region of the internal transcribed spacer 2 (ITS 2) in the ribosomal RNA gene of latent aspergillus toxigenic.
In one embodiment, the primer pair sequences used are:
Asp ITS2-F-1：GCGTCATTGctgccctcaagca；
Asp ITS2-R-1：cactcgccgttactgaggcaat；
the probe sequence is as follows:
Asp ITS2-P：VIC-taggcctggccggcgcctgtcga-BHQ1；
in one embodiment, the probe is a Taqman probe.
In one embodiment, the probe is linked to a fluorescence quencher at its 3 'end and a fluorescence reporter at its 5' end.
In the present invention, the fluorescence quenching group may be a fluorescence quenching group generally used in the art, such as BHQ3, BHQ1, BHQ2, TAMRA, or the like; the fluorescent reporter may be a fluorescent reporter commonly used in the art, such as FAM, CY3, CY5, HEX or TET, and the like.
In one embodiment, the 5 'end of the probe is attached to a VIC and the 3' end is attached to BHQ 1.
In one aspect, the invention provides a kit for detecting latent aspergillus toxigenic by a real-time fluorescent PCR method, wherein the kit comprises the primer pair and probe of the invention.
In one embodiment, the kit further comprises reagents for extracting latent toxigenic aspergillus DNA, reagents for real-time fluorescent PCR, a positive control, a negative control, a blank control, and instructions for use.
In another aspect, the present invention provides a method for detecting latent aspergillus toxigenic by a real-time fluorescent PCR method, comprising the use of a primer pair and a probe of the invention or a kit of the invention.
In one embodiment, the real-time fluorescent PCR reaction conditions are: 10 min at 95 ℃; 95 ℃ 15 s, 60 ℃ 1 min, 40 cycles.
In one embodiment, the detection method comprises the steps of:
(a) extracting a DNA sample from a product to be detected;
(b) providing conditions for a real-time fluorescent PCR reaction;
(c) the primer pair and the probe or the kit are used for carrying out nucleic acid amplification reaction and detecting an amplification product by a real-time fluorescence PCR method.
Real-time fluorescent quantitative PCR is that on the basis of a conventional PCR method, a probe or a fluorescent dye which is fluorescently labeled is added, a fluorescent signal emitted by the probe or the dye is enhanced along with the accumulation of a PCR product, and a fluorescent monitoring system can receive the fluorescent signal, namely, one fluorescent molecule is formed every time one DNA chain is generated, so that the complete synchronization of the accumulation of the fluorescent signal and the formation of the PCR product is realized. Therefore, the whole PCR reaction process can be monitored in real time, and the initial copy number of the sample to be detected can be finally detected, so that the latent toxigenic aspergillus in the sample to be detected can be detected.
The real-time fluorescent PCR detection method adopts complete closed-tube detection, does not need PCR post-treatment, and avoids cross contamination and false positive. The method skillfully utilizes the high-efficiency DNA amplification of the PCR technology, the specificity of nucleic acid hybridization and the rapidness and the sensitivity of the fluorescence detection technology, and has the advantages of simple operation, time and labor saving, reliable result, accuracy and sensitivity and the like. The real-time fluorescence PCR detection method is simple, rapid, specific and sensitive, and is suitable for detecting the latent toxigenic aspergillus in food and other samples.
Drawings
FIG. 1 shows the results of specific amplification of latent toxigenic Aspergillus by real-time fluorescent PCR.
FIG. 2 shows the results of the real-time fluorescence PCR-specific detection, in which the genomic DNA of the latent Aspergillus toxigenic was diluted ten-fold to concentrations of 20 and 20X 10-1、20×10-2、20×10-3、20×10-4、20×10-5、20×10-6Mu g/mL, using DNA solution with each concentration gradient as a template to carry out Real-time PCR amplification, and detecting the sensitivity of the method. Wherein 1-6 are the concentrations of the DNA solution for real-time fluorescence PCR amplification, 20 and 20 × 10 in sequence-1、20×10-2、20×10-3、20×10-4、20×10-5The amplification results of. mu.g/mL and blank were repeated 3 times.
FIG. 3 is a graph showing the results of detection of a mock contaminated sample, wherein the fluorescence curves are the results of amplification of the mock contaminated sample, a positive control, a negative control, and a blank control (sterile water).
Detailed Description
The present invention will be further described by way of examples, but the present invention is not limited to only the following examples.
Example 1
In this example, the specificity of the primers and probes for latent Aspergillus toxigenic was verified by the following experiment.
The specificity of the aspergillus dual real-time fluorescent PCR primer probe is verified by selecting penicillium, aspergillus and fusarium as experimental strains and amplifying corresponding sequences of the strains.
The main detection instruments used:
a micropipette (10 μ L, 100 μ L, 1000 μ L, Eppendorf), a centrifuge (5804R, Eppendorf, Germany), a nucleic acid protein analyzer (DU640, Beckman, Germany), a fluorescent PCR amplification instrument (7500, ABI, USA), and the like.
Main reagents for detection:
potato dextrose medium (Beijing Omboxing Biotechnology Ltd.), agarose (Gene Company Ltd.), a fungal genomic DNA extraction kit (Tiangen Biotechnology Ltd.), Real-time PCR Master Mix (USA AB), and a primer probe synthesized by Biotechnology engineering Ltd.
The detection comprises the following main steps:
1) strain culture and template DNA preparation
Inoculating activated experimental strains into a potato glucose broth culture medium, culturing for 4 d at 28 ℃ and 120 r/min on a constant temperature shaking table, collecting mycelia after vacuum filtration, washing with sterile ultrapure water for several times, and sucking water with sterile filter paper for extracting genome DNA. Extracting genome DNA by using a fungus genome DNA extraction kit, determining the DNA concentration by using a nucleic acid protein analyzer, diluting the DNA to 20 mu g/mL, and storing at-20 ℃ for later use as a DNA template of Real-time PCR amplification reaction.
2) Primer pair and probe for real-time fluorescent PCR detection
The primer pair is as follows:
Asp ITS2-F-1：GCGTCATTGctgccctcaagca；
Asp ITS2-R-1：cactcgccgttactgaggcaat；
the probe sequence is as follows:
Asp ITS2-P：VIC-taggcctggccggcgcctgtcga-BHQ1；
3) real-time fluorescent PCR reaction 25. mu.L:
mu.L of template DNA, 12.5. mu.L of Master Mix, 1. mu.L of forward primer (10. mu.M), 1. mu.L of reverse primer (10. mu.M), 0.5. mu.L of probe (10. mu.M), and sterile water to 25. mu.L.
4) Real-time fluorescent PCR reaction parameters:
10 min at 95 ℃; 95 ℃ 15 s, 60 ℃ 1 min, 40 cycles.
Note: a corresponding blank control (the ultrapure water for preparing the reaction system is used for replacing a DNA template) is set for each PCR detection, and whether the reagent is polluted or not is detected.
As shown in FIG. 1, the real-time fluorescent PCR method established in the scheme can only specifically amplify the Aspergillus strain, and has no amplification to the negative control strain and the blank control.
Example 2
In this example, primers and probes were detected with sensitivity by the following experiment based on the DNA of Aspergillus.
The sensitivity of detection of the primer pair and the probe in the present real-time fluorescent PCR method can be determined by detecting the internal transcribed spacer 2 (ITS 2) in the ribosomal RNA gene of the latent Aspergillus toxigenic.
1) Primer pairs and probe sequences for real-time fluorescent PCR detection:
the primer pair is as follows:
Asp ITS2-F-1：GCGTCATTGctgccctcaagca；
Asp ITS2-R-1：cactcgccgttactgaggcaat；
the probe sequence is as follows:
Asp ITS2-P：VIC-taggcctggccggcgcctgtcga-BHQ1。
2) the main detection instruments used:
a micropipette (10 μ L, 100 μ L, 1000 μ L, Eppendorf), a centrifuge (5804R, Eppendorf, Germany), a nucleic acid protein analyzer (DU640, Beckman, Germany), a fluorescent PCR amplification instrument (7500, ABI, USA), and the like.
3) Main reagents for detection:
potato dextrose medium (Beijing Omboxing Biotechnology Ltd.), agarose (Gene Company Ltd.), a fungal genomic DNA extraction kit (Tiangen Biotechnology Ltd.), Real-time PCR Master Mix (USA AB), and a primer probe synthesized by Biotechnology engineering Ltd.
4) Diluting the genomic DNA of the Aspergillus strain by ten-fold ratio to make the concentration of the DNA reach 20 and 20 × 10 respectively-1、20×10-2、20×10-3、20×10-4、20×10-5、20×10-6、20×10-7、20×10-8Mu g/mL, using DNA solution with each concentration gradient as a template to carry out Real-time PCR amplification, and detecting the sensitivity of the method. When the Ct value of the sample is less than or equal to 30, the detection result is positive(ii) a If the Ct value is still less than 35, the detection result is judged to be positive; if the Ct value is more than 35 or no Ct value, the detection result is judged to be negative.
5) Reaction system:
mu.L of template DNA, 12.5. mu.L of Master Mix, 1. mu.L of forward primer (10. mu.M), 1. mu.L of reverse primer (10. mu.M), 0.5. mu.L of probe (10. mu.M), and sterile water to 25. mu.L.
6) Real-time fluorescent PCR reaction parameters:
10 min at 95 ℃; 95 ℃ 15 s, 60 ℃ 1 min, 40 cycles.
The amplification curve is shown in FIG. 2, the template concentrations corresponding to the Real-time PCR amplification curve are 20, 20 × 10-1、20×10-2、20×10-3、20×10-4、20×10-5μ g/mL, when the template concentration reaches 2X 10-6At. mu.g/mL, the template was not significantly amplified, and it was judged that the target gene could not be detected, i.e., Aspergillus could not be detected, and therefore, the template concentration at which Aspergillus could be detected was 2X 10-5Mu g/mL, that is, the detection sensitivity of the Real-time PCR method is the template concentration 2 multiplied by 10-5μg/mL。
Example 3
The inventors of the present invention examined and verified the latent aspergillus toxigenic in the simulated contaminated sample by the following test.
And (3) carrying out real-time fluorescence PCR detection on aspergillus in the simulated pollution sample to determine whether the established real-time fluorescence PCR method is feasible.
Weighing 25 g of sample, placing the sample into a sterile homogenizing bag containing 225 mL of sterile diluent (physiological saline), and homogenizing for 1 min to 2 min at 8000r/min to 10000 r/min to prepare 1:10 sample homogeneous solution; sucking 1 mL of sample homogeneous solution into a potato glucose broth culture medium, culturing for 4 d at 28 ℃ and 120 r/min on a constant temperature shaking table, collecting mycelia after vacuum filtration, washing with sterile ultrapure water for several times, sucking water by using sterile filter paper, and extracting the genome DNA. Genomic DNA was extracted using the fungal genomic DNA extraction kit as a template for PCR reaction, and preparation of template DNA and real-time fluorescence detection were performed according to the procedure in example 1. The real-time fluorescent PCR method was repeated 3 times per sample. As shown in FIG. 3, positive signals were detected in the mock-contaminated sample, and the remaining samples and the blank were not detected.
Claims (8)
1. The primer pair and the probe are used for detecting the latent aspergillus toxin producing nucleotide by a real-time fluorescent PCR method;
wherein the primer pair is selected from the following primer pairs:
the primer pair is as follows:
Asp ITS2-F-1：GCGTCATTGctgccctcaagca；
Asp ITS2-R-1：cactcgccgttactgaggcaat；
the probe sequence is as follows:
Asp ITS2-P：VIC-taggcctggccggcgcctgtcga-BHQ1。
2. the oligonucleotide primer pair and probe of claim 1, wherein the real-time fluorescent PCR method is Taqman fluorescent probe method.
3. The primer set and the probe according to claim 2, wherein a fluorescence quencher is linked to the 3 'end of the probe, and a fluorescence reporter is linked to the 5' end of the probe.
4. The primer pair and probe of claim 3, wherein the fluorescence quencher is BHQ, BHQ1, BHQ2 or TAMRA, and the fluorescence reporter is FAM, CY3, CY5, HEX or TET.
5. A kit for detecting latent Aspergillus toxigenic by a real-time fluorescent PCR method, wherein the kit comprises the primer pair and probe of any one of claims 1-4.
6. A method for detecting latent Aspergillus toxigenic by real-time fluorescent PCR method, comprising using the primer pair and probe of any one of claims 1-4 or the kit of claim 5, which method is not used for disease diagnosis and treatment purposes.
7. The method of claim 6, comprising:
(a) providing conditions for a real-time fluorescent PCR reaction;
(b) performing a nucleic acid amplification reaction and detecting an amplification product by a real-time fluorescent PCR method using the primer pair and the probe as set forth in any one of claims 1 to 4 or the kit as set forth in claim 5.
8. Use of the primers and probes as defined in any of claims 1 to 4 or the kit as defined in claim 5 for the detection of latent aspergillus toxigenic, said use not being for disease diagnosis and treatment purposes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811254595.8A CN111100910A (en) | 2018-10-26 | 2018-10-26 | Primer probe and kit for qualitatively detecting aspergillus with toxin-producing potential |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201811254595.8A CN111100910A (en) | 2018-10-26 | 2018-10-26 | Primer probe and kit for qualitatively detecting aspergillus with toxin-producing potential |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111100910A true CN111100910A (en) | 2020-05-05 |
Family
ID=70418949
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201811254595.8A Pending CN111100910A (en) | 2018-10-26 | 2018-10-26 | Primer probe and kit for qualitatively detecting aspergillus with toxin-producing potential |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111100910A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113293225A (en) * | 2021-06-29 | 2021-08-24 | 江南大学 | Primer probe combination capable of specifically recognizing aspergillus, penicillium and fusarium and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101038254A (en) * | 2007-04-29 | 2007-09-19 | 南方医科大学 | PCR kit for fluorescence quantitative detecting aspergilli |
| CN101492743A (en) * | 2009-01-19 | 2009-07-29 | 中国人民解放军第三军医大学 | Pathogenic epiphyte detection gene chip |
| WO2009150244A1 (en) * | 2008-06-13 | 2009-12-17 | National University Of Ireland, Galway | Swi5 gene as a diagnostic target for the identification of fungal and yeast species |
| CN102321738A (en) * | 2011-07-29 | 2012-01-18 | 广州呼吸疾病研究所 | Fluorescence quantitative PCR (polymerase chain reaction) universal premier for detecting pathogenic aspergillus, detection probe and kit |
| CN104164511A (en) * | 2014-08-25 | 2014-11-26 | 天津喜诺生物医药有限公司 | Aspergillus quantitative detection fluorescence PCR (polymerase chain reaction) kit |
-
2018
- 2018-10-26 CN CN201811254595.8A patent/CN111100910A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101038254A (en) * | 2007-04-29 | 2007-09-19 | 南方医科大学 | PCR kit for fluorescence quantitative detecting aspergilli |
| WO2009150244A1 (en) * | 2008-06-13 | 2009-12-17 | National University Of Ireland, Galway | Swi5 gene as a diagnostic target for the identification of fungal and yeast species |
| CN101492743A (en) * | 2009-01-19 | 2009-07-29 | 中国人民解放军第三军医大学 | Pathogenic epiphyte detection gene chip |
| CN102321738A (en) * | 2011-07-29 | 2012-01-18 | 广州呼吸疾病研究所 | Fluorescence quantitative PCR (polymerase chain reaction) universal premier for detecting pathogenic aspergillus, detection probe and kit |
| CN104164511A (en) * | 2014-08-25 | 2014-11-26 | 天津喜诺生物医药有限公司 | Aspergillus quantitative detection fluorescence PCR (polymerase chain reaction) kit |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113293225A (en) * | 2021-06-29 | 2021-08-24 | 江南大学 | Primer probe combination capable of specifically recognizing aspergillus, penicillium and fusarium and application thereof |
| CN113293225B (en) * | 2021-06-29 | 2024-04-02 | 江南大学 | Primer probe combination capable of specifically identifying aspergillus, penicillium and fusarium and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cruz-Perez et al. | Detection and quantitation of Aspergillus fumigatus in pure culture using polymerase chain reaction | |
| Babu et al. | Quantitative real-time PCR assay for rapid detection of plant and human pathogenic Macrophomina phaseolina from field and environmental samples | |
| Mahmoud | Detection of Aspergillus flavus in stored peanuts using real-time PCR and the expression of aflatoxin genes in toxigenic and atoxigenic A. flavus isolates | |
| CN113881789B (en) | Probe and primer pair composition for detecting cryptococcus and detection method and application | |
| Rahman et al. | Current PCR-based methods for the detection of mycotoxigenic fungi in complex food and feed matrices | |
| CN110616253A (en) | Kit and method for detecting fungi based on micro-drop digital PCR technology | |
| CN114134249B (en) | Multiplex PCR primer combination and multiplex PCR kit for rapidly detecting aflatoxin-producing bacteria and detection method | |
| Badali et al. | Molecular tools in medical mycology; where we are! | |
| KR20170003403A (en) | Method for detecting food borne pathogens using digital PCR | |
| CN115747353A (en) | Primer group, reagent, kit and detection method for detecting Listeria monocytogenes | |
| Tian et al. | Visual detection of Didymella bryoniae in cucurbit seeds using a loop-mediated isothermal amplification assay | |
| Cruz et al. | Development and evaluation of a real-time quantitative PCR assay for Aspergillus flavus | |
| CN111100910A (en) | Primer probe and kit for qualitatively detecting aspergillus with toxin-producing potential | |
| CN109868329B (en) | Screening, quarantine and identification method of colletotrichum specific primers | |
| CN108950043B (en) | Drowning-related plankton composite amplification detection system and kit | |
| CN109735635B (en) | Method for simultaneously detecting staphylococcus aureus, salmonella and shigella | |
| CN112852988A (en) | Microdroplet digital PCR detection method for simultaneously detecting penicillium and fusarium | |
| JP2007174973A (en) | Method for variety identification by multiplex pcr using ssr primer | |
| CN110257544B (en) | Ergota germ fluorescent quantitative PCR detection reagent, detection kit and application | |
| Deepa et al. | Molecular technologies for the early detection of fungal phytopathogens associated with cereal crops | |
| US20150292039A1 (en) | Method to amplify nucleic acids of fungi to generate fluorescence labeled fragments of conserved and arbitrary products | |
| Ijaz et al. | Molecular phytopathometry | |
| CN106755392B (en) | qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting coelomacter in algae culture | |
| Van Der Wolf et al. | Bacterial pathogens: detection and identification methods | |
| RU2455364C2 (en) | Method of identifying mycobacteria by polymerase chain reaction |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200505 |