Disclosure of Invention
The invention aims to provide a composition for identifying benign and malignant thyroid nodules, which is used for detecting methylation conditions of target sites in BIN1 genes and DNM2 genes so as to realize the identification of the benign and malignant thyroid nodules.
The present invention provides a nucleic acid molecule selected from the group consisting of: (1) a fragment of BIN1 gene amplified by using SEQ ID NO 1 and 2 or a sequence having at least 90% identity thereto as a primer; (2) a fragment of the DNM2 gene amplified from SEQ ID NOs 3 and 4 or a sequence having at least 90% identity thereto as primers; and (3) a mixture of the fragments of (1) and (2).
In one or more embodiments, unmethylated cytosines in the fragment are converted to bases that do not bind guanine.
The invention also provides a primer molecule selected from: (1) 1 and 2 or a sequence having at least 90% identity thereto; (2) 3 and 4 or a sequence having at least 90% identity thereto; and (3) mixtures of the sequences described in (1) and (2).
In one or more embodiments, the primer molecules further comprise primers for detecting the reference gene ACTB, wherein the primers for detecting the reference gene ACTB amplify a segment of the ACTB gene amplified from SEQ ID NOs 5 and 6 or sequences at least 90% identical thereto as primers. Preferably, the primers for detecting the reference gene ACTB are SEQ ID NO's 5 and 6 or sequences at least 90% identical thereto.
The invention also provides a probe molecule capable of hybridising to one or more fragments selected from the group consisting of: a fragment of BIN1 gene amplified by using SEQ ID NO. 1 and 2 as primers, a fragment of DNM2 gene amplified by using SEQ ID NO. 3 and 4 as primers, and optionally a fragment of ACTB gene amplified by using SEQ ID NO. 5 and 6 as primers.
It is claimed that the probe molecule comprises the sequences shown in SEQ ID NO 7 and 8 or sequences at least 90% identical thereto and optionally the sequence shown in SEQ ID NO 9 or sequences at least 90% identical thereto.
The invention also provides a composition for identifying thyroid nodule benign and malignant, which comprises nucleic acid molecules for detecting BIN1 gene and DNM2 gene related to thyroid nodule benign and malignant in a sample and optional nucleic acid molecules for detecting reference genes.
In one or more embodiments, the detecting is detecting a methylation level.
Specifically, the invention provides a composition for identifying benign and malignant thyroid nodules, which comprises a nucleic acid sequence of a BIN1 gene and a nucleic acid sequence of a DNM2 gene which are respectively used for detecting methylation regions related to the benign and malignant thyroid nodules in a sample to be detected, and a nucleic acid sequence of an internal reference gene.
In one or more embodiments, the nucleic acid molecule detecting the BIN1 gene comprises a sequence set forth in any one of SEQ ID NOs 1-2 and the nucleic acid molecule detecting the DNM2 gene comprises a sequence set forth in any one of SEQ ID NOs 3-4. The specific sequence is as follows:
BIN1 gene forward primer F:
AGGCGGTTTAGTTTGGGTTTTAG(SEQ ID NO:1),
BIN1 gene reverse primer R:
AAACCCCGCCTAAAAAAACTTCC(SEQ ID NO:2),
DNM2 gene forward primer F:
GAAGATGAGTTGTAGAATGAGAGGT(SEQ ID NO:3),
DNM2 gene reverse primer R:
CCCTCACAAAAACTTCCTTCCC(SEQ ID NO:4)。
in one or more embodiments, the reference gene is ACTB. In one or more embodiments, the nucleic acid molecule for detecting the reference gene comprises a sequence as set forth in any one of SEQ ID NOS 5-6. The specific sequence is as follows:
reference gene forward primer F:
CCCTTAAAAATTACAAAAACCACAACC(SEQ ID NO:5),
internal reference gene reverse primer R:
AGGAGGTTTAGTAAGTTTTTTGGATTG(SEQ ID NO:6)。
in one or more embodiments, the nucleic acid molecule is a primer.
In one or more embodiments, the composition further comprises a probe for BIN1 gene, a probe for DNM2 gene, and a probe for an internal reference gene, each of which recognizes an amplified fragment of the corresponding nucleic acid molecule. Preferably, the probe of BIN1 gene comprises the sequence shown in SEQ ID NO. 7, and the probe of DNM2 gene comprises the sequence shown in SEQ ID NO. 8. The specific probe sequence is as follows:
BIN1 gene probe: TTTGAGAACGTGAGGTTGTTGGCGGGA (SEQ ID NO:7)
DNM2 gene probe: TCGGGTGACGATTTTTGAATCGCGGGGA (SEQ ID NO: 8).
In one or more embodiments, the reference gene is ACTB. In one or more embodiments, the probe for the reference gene comprises the sequence shown in SEQ ID NO 9. The specific sequence is as follows:
internal reference gene probe: ACCACCACCCAACACACAATAACAAACACA (SEQ ID NO: 9).
In one or more embodiments, each probe further comprises a detectable moiety. In one or more embodiments, the detectable species is a 5 'fluorescent reporter and a 3' labeled quencher. In one or more embodiments, the fluorescent reporter is selected from Cy5, FAM, and VIC.
Preferably, the probe sequence is as follows:
BIN1 gene probe:
Cy5-TTTGAGAACGTGAGGTTGTTGGCGGGA-BHQ2
DNM2 gene probe:
FAM-TCGGGTGACGATTTTTGAATCGCGGGGA-BHQ1
internal reference gene probe:
VIC-ACCACCACCCAACACACAATAACAAACACA-BHQ1。
the invention also provides a methylation detection kit for identifying benign and malignant thyroid nodules, which is characterized by comprising a primer molecule and an optional probe molecule, wherein the primer molecule can amplify a fragment of the BIN1 gene obtained by taking SEQ ID Nos. 1 and 2 or a sequence at least 90% identical thereto as a primer and a fragment of the DNM2 gene obtained by taking SEQ ID Nos. 3 and 4 or a sequence at least 90% identical thereto as a primer, and the probe molecule comprises sequences shown in SEQ ID Nos. 7 and 8 or a sequence at least 90% identical thereto.
In one or more embodiments, the kit further comprises a primer for detecting the reference gene ACTB and an optional probe molecule for detecting the reference gene ACTB, wherein the primer for detecting the reference gene ACTB can amplify a fragment of the ACTB gene obtained by amplifying SEQ ID NO. 5 and 6 or a sequence at least 90% identical thereto as a primer, and the probe molecule for detecting the reference gene ACTB comprises a sequence shown in SEQ ID NO. 9 or a sequence at least 90% identical thereto.
In one or more embodiments, the kit comprises a primer molecule described herein, optionally a nucleic acid molecule described herein, and optionally a probe molecule described herein.
In one or more embodiments, the kit further comprises a transformed positive standard in which unmethylated cytosines are converted to bases that do not bind guanine. In one or more embodiments, the positive standard is fully methylated.
In one or more embodiments, the kit further comprises PCR reaction reagents. Preferably, the PCR reaction reagent comprises Taq DNA polymerase, PCR buffer (buffer), dNTPs and Mg2+。
In one or more embodiments, the kit further comprises reagents for detecting DNA methylation, the reagents being reagents used in one or more of the following methods selected from: bisulfite conversion based PCR (e.g., methylation specific PCR), DNA sequencing (e.g., bisulfite sequencing, whole genome methylation sequencing, simplified methylation sequencing), methylation sensitive restriction enzyme analysis, fluorometry, methylation sensitive high resolution melting curve, chip-based methylation profile analysis, mass spectrometry (e.g., flight mass spectrometry). Preferably, the agent is selected from one or more of: bisulfite and its derivatives, restriction enzyme sensitive or insensitive to methylation, enzyme digestion buffer, fluorescent dye, fluorescence quencher, fluorescence reporter, exonuclease, alkaline phosphatase, internal standard, and reference substance.
In one or more embodiments, the method of identification of benign and malignant thyroid nodules is: and calculating scores according to the methylation levels of BIN1 and DNM2, and judging the result to be positive if the score is greater than 0, namely the thyroid nodule is a malignant nodule. In one or more embodiments, a score less than 0 determines a negative result, i.e., the thyroid nodule is a benign nodule.
Preferably, the score is 3.80-0.07 × BIN1 methylation level-0.02 × DNM2 methylation level.
In PCR embodiments, preferably, the methylation level is 2-delta Ct to-be-detected sample/2-delta Ct positive standard X 100 where Δ Ct ═ CtTarget gene–CtInternal reference gene。
The invention also provides application of the nucleic acid molecule, the primer molecule and the probe molecule in preparation of a reagent for identifying benign and malignant thyroid nodules. In one or more embodiments, the reagents are used to detect DNA in a sample for levels of BIN1 methylation and DNM2 methylation, the identifying comprising interpreting thyroid nodule benign and malignant based on the methylation levels.
In one or more embodiments, the sample is from a tissue, cell, or bodily fluid of a mammal, such as thyroid tissue or blood. The mammal is preferably a human. In one or more embodiments, the sample is a thyroid nodule biopsy, preferably a fine needle biopsy. In one or more embodiments, the sample is plasma.
In one or more embodiments, the sample is from a subject having benign or malignant nodules of the thyroid. In one or more embodiments, the sample is from a patient with goiter.
In one or more embodiments, the DNA is whole genome DNA and/or cfDNA.
In one or more embodiments, the DNA is transformed in which unmethylated cytosines are converted to bases that do not bind guanine. The conversion is carried out using an enzymatic method, preferably a deaminase treatment, or the conversion is carried out using a non-enzymatic method, preferably a treatment with bisulfite or bisulfate, more preferably a treatment with calcium bisulfite, sodium bisulfite, potassium bisulfite, ammonium bisulfite, sodium bisulfite, potassium bisulfite and ammonium bisulfite.
In one or more embodiments, the detection includes, but is not limited to: bisulfite conversion based PCR (e.g., methylation specific PCR), DNA sequencing (e.g., bisulfite sequencing, whole genome methylation sequencing, simplified methylation sequencing), methylation sensitive restriction enzyme analysis, fluorometry, methylation sensitive high resolution melting curve, chip-based methylation profile analysis, mass spectrometry (e.g., flight mass spectrometry).
In one or more embodiments, the detection is bisulfite sequencing detection.
In one or more embodiments, the detection is a fluorescent quantitative PCR detection, further comprising the use of a probe as described herein.
In one or more embodiments, the reaction solution for PCR comprises Taq DNA polymerase, PCR buffer (buffer), dNTPs, Mg2+. Preferably, the Taq DNA polymerase is a hot start Taq DNA polymerase. Preferably, Mg2+The final concentration is 1.0-10.0 mM.
In one or more embodiments, the concentration of each primer in the PCR is 200-700 nM.
In one or more embodiments, the concentration of each probe in the PCR is 100-400 nM.
In one or more embodiments, the PCR reaction conditions are, pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 1min, and 45 cycles.
In one or more embodiments, the interpretation method is: a score is calculated based on the methylation levels of both genes, and a score greater than 0 gives a positive result, i.e., the thyroid nodule is a malignant nodule. In one or more embodiments, a score less than 0 is negative, i.e., the thyroid nodule is a benign nodule.
Preferably, the score is 3.80-0.07 × BIN1 methylation level-0.02 × DNM2 methylation level.
In PCR embodiments, preferably, the methylation level is 2-delta Ct sample to be detected/2- Δ Ct positive standard X 100, where Δ Ct ═ CtTarget gene–CtInternal reference gene。
In a sequencing embodiment, preferably, the methylation level is methylation base number/total base number.
The invention also provides a method for identifying the benign and malignant thyroid nodules, which comprises the following steps:
(1) detecting the level of BIN1 methylation and DNM2 methylation of DNA in the sample using the primers described herein,
(2) judging whether the thyroid nodule is benign or malignant according to the methylation level of (1).
In one or more embodiments, the method further comprises DNA extraction and/or quality control prior to step (1).
In one or more embodiments, the sample is from a tissue, cell, or bodily fluid of a mammal, such as thyroid tissue or blood. The mammal is preferably a human. In one or more embodiments, the sample is a thyroid nodule biopsy, preferably a fine needle biopsy. In one or more embodiments, the sample is plasma.
In one or more embodiments, the sample is from a subject having benign or malignant nodules of the thyroid. In one or more embodiments, the sample is from a patient with goiter.
In one or more embodiments, the DNA is whole genome DNA and/or cfDNA.
In one or more embodiments, the DNA is transformed in which unmethylated cytosines are converted to bases that do not bind guanine. The conversion is carried out using an enzymatic method, preferably a deaminase treatment, or the conversion is carried out using a non-enzymatic method, preferably a treatment with bisulfite or bisulfate, more preferably a treatment with calcium bisulfite, sodium bisulfite, potassium bisulfite, ammonium bisulfite, sodium bisulfite, potassium bisulfite and ammonium bisulfite.
In one or more embodiments, the detection includes, but is not limited to: bisulfite conversion based PCR (e.g., methylation specific PCR), DNA sequencing (e.g., bisulfite sequencing, whole genome methylation sequencing, simplified methylation sequencing), methylation sensitive restriction enzyme analysis, fluorometry, methylation sensitive high resolution melting curve, chip-based methylation profile analysis, mass spectrometry (e.g., flight mass spectrometry).
In one or more embodiments, the detection is bisulfite sequencing detection.
In one or more embodiments, the detection is a fluorescent quantitative PCR detection, further comprising the use of a probe as described herein.
In one or more embodiments, the reaction solution for PCR comprises Taq DNA polymerase, PCR buffer (buffer), dNTPs, Mg2+. Preferably, the Taq DNA polymerase is a hot start Taq DNA polymerase. Preferably, Mg2+The final concentration is 1.0-10.0 mM.
In one or more embodiments, the concentration of each primer in the PCR is 200-700 nM.
In one or more embodiments, the concentration of each probe in the PCR is 100-400 nM.
In one or more embodiments, the PCR reaction conditions are, pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 1min, and 45 cycles.
In one or more embodiments, the interpretation method is: a score is calculated based on the methylation levels of both genes, and a score greater than 0 gives a positive result, i.e., the thyroid nodule is a malignant nodule. In one or more embodiments, a score less than 0 is negative, i.e., the thyroid nodule is a benign nodule.
Preferably, the score is 3.80-0.07 × BIN1 methylation level-0.02 × DNM2 methylation level.
In PCR embodiments, preferably, the methylation level is 2-delta Ct sample to be detected/2- Δ Ct positive standard X 100, where Δ Ct ═ CtTarget gene–CtInternal reference gene。
In a sequencing embodiment, preferably, the methylation level is methylation base number/total base number.
The main advantages of the invention are: by detecting a plurality of target sequences simultaneously, the sensitivity and specificity of identifying benign and malignant thyroid nodules are improved. The PCR method is adopted, the operation is simple, the result is easy to interpret, the requirement on the instrument is not high, and the clinical popularization and application are more convenient in the form of the kit.
Detailed Description
The inventors found that methylation levels of BIN1 and DNM2 genes were associated with malignant thyroid nodules. Referring to thyroid nodules, the terms "benign" and "malignant" as used herein refer to the nature of thyroid nodules. Generally, benign is manifested by slow growth of nodules, uniform texture, good mobility, smooth surface, cystic changes, no enlargement of lymph nodes, no calcification, etc. Malignancy is characterized by uncontrolled malignant cell growth, spread and tissue infiltration. Ultrasound signs that suggest that thyroid nodules are malignant include: the height of the nodule is greater than the width, lack of acoustic halo, micro-calcification, irregular boundaries, reduced echo, solid nodules, abundant blood flow within the nodule, and the like. In some embodiments, the malignant thyroid nodule comprises thyroid cancer.
Herein, methods for detecting DNA Methylation are well known in the art, such as Bisulfite conversion-based PCR (e.g., Methylation-specific PCR (MSP)), DNA Sequencing (e.g., Bisulfite Sequencing, BS), Whole genome Methylation Sequencing (WGBS), Reduced Methylation Sequencing (RRBS)), chips, Methylation-Sensitive restriction enzyme assays (Methylation-Sensitive dependent specificity Enzymes), fluorescence quantification, Methylation-Sensitive High resolution Melting curves (MS-HRM), chip-based Methylation mapping, mass spectrometry (e.g., mass-spectrometric flight analysis). In one or more embodiments, detecting comprises detecting either strand at the gene or site.
Thus, the present invention relates to a reagent for detecting DNA methylation. Reagents used in the above-described methods for detecting DNA methylation are well known in the art. In addition, in detection methods involving DNA amplification, the reagents for detecting DNA methylation include primers. The primer sequences are methylation specific or non-specific. Preferably, the sequence of the primer comprises a non-methylation specific blocking sequence (Blocker). Blocking sequences may enhance the specificity of methylation detection.
Illustratively, when using fluorescent quantitative PCR, the reagent for detecting DNA methylation may further comprise a probe. The 5 'end of the sequence of the probe is marked with a fluorescent reporter group, and the 3' end is marked with a quenching group. The reaction solution for PCR usually contains Taq DNA polymerase, PCR buffer (buffer), dNTPs, and Mg2+. Preferably, the Taq DNA polymerase is a hot start Taq DNA polymerase. Illustratively, Mg2+The final concentration is 1.0-10.0 mM; the concentration of each primer is 200-700 nM; the concentration of each probe was 100-400 nM; the PCR reaction condition is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 1min, and 45 cycles.
The term "variant" or "mutant" as used herein refers to a polynucleotide that has a nucleic acid sequence altered by insertion, deletion or substitution of one or more nucleotides compared to a reference sequence, while retaining its ability to hybridize to other nucleic acids. A mutant according to any of the embodiments herein comprises a nucleotide sequence having at least 70%, preferably at least 80%, preferably at least 85%, preferably at least 90%, preferably at least 95%, preferably at least 97% sequence identity to a reference sequence and retaining the biological activity of the reference sequence. Sequence identity between two aligned sequences can be calculated using, for example, BLASTn from NCBI. Mutants also include nucleotide sequences having one or more mutations (insertions, deletions, or substitutions) in the nucleotide sequence of the reference sequence, while still retaining the biological activity of the reference sequence. The plurality of mutations typically refers to within 1-10, such as 1-8, 1-5, or 1-3. The substitution may be a substitution between purine nucleotides and pyrimidine nucleotides, or a substitution between purine nucleotides or between pyrimidine nucleotides. The substitution is preferably a conservative substitution. For example, conservative substitutions with nucleotides of similar or analogous properties are not typically made in the art to alter the stability and function of the polynucleotide. Conservative substitutions are, for example, exchanges between purine nucleotides (A and G), exchanges between pyrimidine nucleotides (T or U and C). Thus, substitution of one or more sites with residues from the same in the polynucleotides of the invention will not substantially affect their activity. Furthermore, the methylation sites (e.g., contiguous CGs) in the variants of the invention are not mutated. That is, the method of the present invention detects methylation of a methylatable site in the corresponding sequence, and a mutation may occur in the base of a non-methylatable site.
The invention also provides a methylation detection kit for identifying benign and malignant thyroid nodules, which comprises a primer molecule and an optional probe molecule, wherein the primer molecule can amplify a fragment of the BIN1 gene obtained by amplifying SEQ ID NO. 1 and 2 or a sequence at least 90% identical to the SEQ ID NO. 1 and 2 as a primer and a fragment of the DNM2 gene obtained by amplifying SEQ ID NO. 3 and 4 or a sequence at least 90% identical to the SEQ ID NO. 3 and 4 as a primer, and the probe molecule comprises sequences shown in SEQ ID NO. 7 and 8 or a sequence at least 90% identical to the sequence. The kit can also comprise a primer for detecting the internal reference gene ACTB and an optional probe molecule for detecting the internal reference gene ACTB, wherein the primer for detecting the internal reference gene ACTB can amplify a segment of the ACTB gene obtained by taking SEQ ID NO. 5 and 6 or a sequence which has at least 90% of homology with the sequence as a primer, and the probe molecule for detecting the internal reference gene ACTB comprises a sequence shown by SEQ ID NO. 9 or a sequence which has at least 90% of homology with the sequence.
The kit can also include a transformed positive standard in which unmethylated cytosines are converted to bases that do not bind guanine. The positive standard may be fully methylated. The kit may further comprise PCR reaction reagents. Preferably, the PCR reaction reagent comprises Taq DNA polymerase, PCR buffer (buffer), dNTPs and Mg2+. The kit may further comprise reagents for detecting DNA methylation, said reagents being reagents used in one or more of the following methods selected from: bisulfite conversion based PCR (e.g., methylation specific PCR), DNA sequencing (e.g., bisulfite sequencing, whole genome methylation sequencing, simplified methylation sequencing), methylation sensitive restriction enzyme analysis, fluorometry, methylation sensitive high resolution melting curve, chip-based methylation profile analysis, mass spectrometry (e.g., flight mass spectrometry). The agent may be selected from one or more of: bisulfite and its derivatives, restriction enzyme sensitive or insensitive to methylation, enzyme digestion buffer, fluorescent dye, fluorescence quencher, fluorescence reporter, exonuclease, alkaline phosphatase, internal standard, and reference substance.
The invention also provides a method for identifying the benign and malignant thyroid nodules, which comprises the following steps: (1) the primers described herein were used to detect the levels of BIN1 methylation and DNM2 methylation of DNA in the samples, and (2) thyroid nodule benign and malignant was judged based on the methylation levels of (1). Typically, the method further comprises DNA extraction and/or quality control prior to step (1).
As used herein, a "DNA" or "DNA molecule" is a deoxyribonucleic acid. Bases (bp) of DNA are mainly adenine (A), guanine (G), cytosine (C) and thymine (T). The form of DNA includes cDNA, genomic DNA, fragmented DNA, or artificially synthesized DNA. The DNA may be single-stranded or double-stranded.
As used herein, "uracil" or "U" is a component of RNA. An "RNA" or "RNA molecule" is a ribonucleic acid. RNA is a long chain molecule formed by the condensation of ribonucleotides via phosphodiester bonds. RNA has 4 main bases, namely adenine (A), guanine (G), cytosine (C) and uracil (U). In base pairing of RNA, U replaces the position of T in DNA, i.e. a is hydrogen-bonded to U and G is hydrogen-bonded to C.
Transformation can occur between bases of DNA or RNA. "transformation", "cytosine transformation" or "CT transformation" as used herein is the process of converting an unmodified cytosine base (C) to a base that does not bind guanine, such as a uracil base (U), by treating the DNA using non-enzymatic or enzymatic methods. Non-enzymatic or enzymatic methods of performing cytosine conversion are well known in the art. Illustratively, non-enzymatic methods include bisulfite or bisulfate treatments, such as calcium bisulfite, sodium bisulfite, potassium bisulfite, ammonium bisulfite, sodium bisulfate, potassium bisulfate, ammonium bisulfate, and the like. Illustratively, the enzymatic method includes a deaminase treatment. The transformed DNA is optionally purified. DNA purification methods suitable for use herein are well known in the art.
In one or more embodiments, the thyroid nodule benign and malignant interpretation process is: the methylation level of the gene is mathematically analyzed, a score is calculated, and when the score meets a certain threshold, a malignant nodule is identified. Methods of conventional mathematical analysis and processes of determining thresholds are known in the art, an exemplary method being binary Logistic regression analysis. Typically, the threshold is 0. That is, if the score is greater than 0, the result is positive, i.e., the thyroid nodule is a malignant nodule. In one or more embodiments, a score less than 0 is negative, i.e., the thyroid nodule is a benign nodule. Preferably, the score is calculated by the following formula: (ii) a score of 3.80-0.07 × BIN1 methylation level-0.02 × DNM2 methylation level, wherein a score of greater than or equal to 0 indicates that the thyroid nodule is malignant; a score of <0 indicates that the thyroid nodule is benign.
Methods for calculating methylation levels are known in the art. Illustratively, in embodiments where methylation is detected by PCR, the methylation level is 2-delta Ct sample to be detected/2- Δ Ct positive standard X 100, where Δ Ct ═ CtTarget gene–CtInternal reference gene. Alternatively, in embodiments where methylation is detected by sequencing, the level of methylation is the number of methylated bases/total bases.
Herein, the sample is from a mammal, preferably a human. The sample may be from any organ (e.g., thyroid), tissue (e.g., epithelial tissue, connective tissue, muscle tissue, and neural tissue), cell (e.g., thyroid nodule biopsy), or body fluid (e.g., blood, plasma, serum, interstitial fluid, urine). In general, it is sufficient that the sample contains genomic DNA or cfdna (circulating free DNA or Cell free DNA). cfDNA is called circulating free DNA or cell free DNA, and is a degraded DNA fragment that is released into plasma. Illustratively, the sample is a thyroid nodule biopsy, preferably a fine needle biopsy. Alternatively, the sample is plasma, blood or serum.
In a specific embodiment, the method comprises: (1) sample preparation: comprises DNA extraction and quality inspection; (2) DNA transformation: carrying out bisulfite conversion on the DNA obtained in the step (1), and converting unmethylated cytosine (cytosine, C) into uracil (uracil, U); methylated cytosine is not altered after conversion; (3) preparing a reaction mixed solution: comprises PCR reaction solution, primer mixture and probe mixture; (4) preparation of PCR mixture: adding the template DNA transformed by the bisulfite in the step (2) and a positive standard, a negative control or a non-template control (NTC) into the step (3); (5) and (3) PCR reaction: and carrying out PCR reaction and collecting fluorescence. The PCR reaction solution comprises: taq DNA polymerase, PCR buffer (buffer), dNTPs, Mg2+(ii) a The Taq DNA polymerase is hot start Taq DNA polymerase; mg (magnesium)2+The final concentration is 1.0-10.0 mM. The primer mixture is a mixture consisting of the gene primers to be amplified, wherein the final concentration of each primer is 200-700 nM. The probe mixture is a mixture of gene probes to be amplified, wherein the final concentration of each probe is 100-400 nM. The PCR reaction condition is pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 1min, and 45 cycles.
Example 2 validation of the relationship between benign and malignant thyroid nodules and Gene methylation
2.1, sample preparation
DNA extraction of 22 cases of thyroid cancer and 22 cases of benign thyroid nodule tissue using QIAamp DNA Mini Kit (QIAGEN, cat # 51304); using qubitsTMThe concentration of the DNA was measured by the dsDNA HS Assay Kit (Thermo, cat # Q32854); quality control was performed using 1% agarose gel electrophoresis.
2.2, DNA transformation
Using MethycodeTMBisulfite Conversion of the DNA obtained in step 1 by the Bisulfit Conversion Kit (Thermo, cat # MECOV50) to convert unmethylated cytosine (cytosine, C) to uracil (uracil, U); methylated cytosines are not altered after conversion.
2.3 PCR mixture preparation
Using the kit provided by the present invention, including PCR reaction solution, primer mixture (SEQ ID NO:1-6), probe mixture (SEQ ID NO:7-9), the preparation of a single sample was performed as shown in Table 1:
TABLE 1 PCR reaction System composition
2.4 fluorescent quantitative PCR
Setting PCR program as 95 deg.c pre-denaturation for 5 min; denaturation at 95 ℃ for 15s, annealing and extension at 60 ℃ for 1min, and 45 cycles. The fluorescence signal was collected during the 60 ℃ annealing extension phase.
2.5, analysis of the test results
Each sample score was calculated using the following formula and the formula in example 1:
methylation level ═ 2Detection of-Delta CtSample (I)/2- Δ Ct positive standard×100。
ΔCt=CtTarget gene–CtInternal reference gene。
Scores of 3.80-0.07 × BIN1 methylation level-0.02 × DNM2 methylation level.
The scores of BIN1 and DNM2 genes are shown in table 2, and ROC curve analysis is shown in fig. 2 (AUC of 0.901). According to the interpretation standard provided by the kit, 2 positive thyroid benign nodules exist in 22 cases, 18 positive thyroid cancers exist in 22 cases, the specificity reaches 90.9%, and the sensitivity is 81.8%.
TABLE 2 score of BIN1 gene and DNM2 gene in combination for thyroid nodule benign and malignant discrimination
The above-mentioned embodiments only express the embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
Sequence listing
<110> secondary first hospital of Zhongshan university
Shanghai Kun Yuanzhi Co., Ltd
<120> gene fragment for identifying benign and malignant thyroid nodules and application thereof
<130>199381
<160>9
<170>SIPOSequenceListing 1.0
<210>1
<211>23
<212>DNA
<213>Artificial Sequence
<400>1
aggcggttta gtttgggttt tag 23
<210>2
<211>23
<212>DNA
<213>Artificial Sequence
<400>2
aaaccccgcc taaaaaaact tcc 23
<210>3
<211>25
<212>DNA
<213>Artificial Sequence
<400>3
gaagatgagt tgtagaatga gaggt 25
<210>4
<211>22
<212>DNA
<213>Artificial Sequence
<400>4
ccctcacaaa aacttccttc cc 22
<210>5
<211>27
<212>DNA
<213>Artificial Sequence
<400>5
cccttaaaaa ttacaaaaac cacaacc 27
<210>6
<211>27
<212>DNA
<213>Artificial Sequence
<400>6
aggaggttta gtaagttttt tggattg 27
<210>7
<211>27
<212>DNA
<213>Artificial Sequence
<400>7
tttgagaacg tgaggttgtt ggcggga 27
<210>8
<211>28
<212>DNA
<213>Artificial Sequence
<400>8
tcgggtgacg atttttgaat cgcgggga 28
<210>9
<211>30
<212>DNA
<213>Artificial Sequence
<400>9
accaccaccc aacacacaat aacaaacaca 30