CN111073957A - Method for calibrating real-time fluorescent quantitative PCR instrument - Google Patents

Abstract

The present invention relates to the field of bioanalysis. A method of calibrating a real-time fluorescent quantitative PCR instrument, comprising the steps of: preparing an unknown sample, carrying out real-time fluorescence quantitative PCR reaction, measuring the copy number concentration of the unknown sample, and calculating the sample indication error; performing serial dilution on a duck-derived IL-2 gene DNA standard substance, performing standard curve verification, and calculating a linear regression coefficient r; wherein the duck-origin IL-2 gene DNA standard substance contains duck-origin genome DNA.

Description

Method for calibrating real-time fluorescent quantitative PCR instrument

Technical Field

The invention relates to the field of biological analysis, in particular to a method for calibrating a real-time fluorescence quantitative PCR instrument.

Background

Meat and meat products are important nutritional sources for human life, and the demand of the meat and meat products is increasing along with the improvement of the living standard of people. However, in recent years, some lawbreakers at home and abroad are greatly adulterated with praise under the driving of economic interests, meat such as chicken, duck and the like which are relatively cheap are deeply processed and then are sold as beef and mutton, so that the legal rights and interests of consumers are infringed, and the international reputation of the country is seriously damaged. Therefore, the quality safety problem of meat has become a hot topic of concern all over the world. However, the animal-derived genomic DNA standard substance still has no systematic development unit at home and abroad, so that the supervision and detection are lack of basis. In recent years, the phenomenon that duck meat is used as beef and mutton to be adulterated is common in the market.

Meat and meat products are important sources of nutrition for human life. In recent years, driven by economic benefits, some lawless persons in China try to gain violence and adulterate embassies, meat such as chicken, ducks and the like which are relatively cheap is deeply processed and then faked as beef and mutton for sale, legal rights and interests of consumers are infringed, and the international reputation of export beef and mutton products in China is seriously damaged. In the eu countries, the price of horse meat is about one third of that of beef, and some suppliers have higher profits with horse meat acting as beef. The horse meat wind wave which is exploded in the European Union of 1 month in 2013 involves a plurality of European countries into the pharaoh, causes the sylvan of concerned countries and causes the consumer to feel dislike. Therefore, the quality safety problem of meat has become a hot topic of concern all over the world. Therefore, the establishment of an accurate and reliable meat identification method has important economic value and profound social significance. However, the lack of animal-derived standard substances in the supervision and detection system causes the lack of traceability of the value of the supervision and detection result.

The traditional methods for species identification mainly include methods of anatomy, histology, sensory judgment, chemical methods, electrophoresis, chromatography, immunology, and the like. In conventional authentication methods: due to the similarity of the physiological structure and components of animals, methods such as anatomy, histology, sensory judgment and the like have great limitations; chemical methods are time consuming and laborious, and it is difficult to detect trace samples; the chromatographic method has multiple sample processing links and has higher requirements on hardware and software; therefore, electrophoresis and immunological methods are most widely used. Even so, in the electrophoresis method, since the loading amount of protein, the freshness of the sample, the age and sex of the animal, the amount of residual blood, the degree of heat treatment and the dyeing technique all affect the electrophoresis speed of protein, the low sensitivity and poor repeatability become the biggest obstacles limiting the use of the technique for detecting meat species. The core of the immunological detection technology lies in two layers of antigen and antibody: (1) denaturation of the protein after heat treatment results in changes in antigenic determinants and reduced protein solubility, often resulting in cross-reactivity and reduced detection sensitivity. (2) The success of immunological methods depends on the quality of the antibody used, whereas double antibody sandwich requires two matching epitopes, which puts higher demands on the specificity and sensitivity of the antibody. Therefore, the immunological detection method has the limitations of low specificity, large influence by a sample matrix and easy generation of false positive results. In summary, these conventional authentication methods have certain limitations.

With the development of molecular biology technology, the detection of nucleic acid level is gradually gaining wide acceptance. The nucleic acid has the advantages of abundant genetic information, stable physicochemical property (both thermal stability and acid-base stability are superior to protein), wide existence in vivo and the like, the differential genetic information between animal species and genera is taken as a detection target spot for species identification, and then a PCR (polymerase chain reaction) technology with the advantages of strong specificity, high sensitivity, simple and rapid operation, low cost and the like is combined, the meat and meat product species identification technology based on DNA (deoxyribonucleic acid) detection has the advantages of high specificity, convenient method, no limitation of tissue types and the like, the detection precision can reach the genus and sub-genus level, and the method becomes a mainstream method of animal origin authenticity identification and traceability analysis technology in food. However, at present, the nucleic acid detection of animal origin lacks repeatability, comparability and traceability due to the lack of available standard substances.

In recent years, animal-derived detection technical methods and standardization work in China are rapidly advanced, a series of animal-derived product detection technical standards are formulated, and animal-derived standard substances are indispensable material bases in the processes of animal product counterfeiting detection, safety supervision, qualitative and quantitative detection, detection method establishment and standardization. Meanwhile, the meat import in China increases year by year in recent years, and the total import amount in 2018 reaches 421.7 ten thousand tons. Due to the lack of corresponding standard substances, certain influence is brought to the identity verification, import and export inspection, enterprise automatic control and international trade mutual recognition of products. The use of reliable standard substances is a guarantee for obtaining high-quality analytical measurement data. Establishing an animal-derived standard substance development and production technology platform is a basic requirement for animal food safety supervision in China. In order to effectively and safely monitor animal-derived products, in principle, corresponding standard substances must be developed for each animal source, so that the detection, monitoring and tracing of the animal products are guaranteed.

However, at present, the lack of animal-derived standard substances at home and abroad has seriously influenced the standardization of animal-derived detection technology and the adoption of the existing standards. We consulted the COMAR library, the Institute for Reference Materials and Measurements (IRMM), the American Petroleum Chemists' Society, and other famous international organizations and institutions related to standard substances, as well as the national standard substance network, etc., all of which did not find any evidence of animal-derived genomic DNA standard substances

Disclosure of Invention

Therefore, the invention develops and prepares the duck-origin IL-2 gene DNA standard substance, can effectively improve the comparability, effectiveness and traceability of the detection result of the animal-origin product, and realizes the quantity transfer in the component analysis of the animal-origin product. The standard substance is obtained by establishing a duck-origin IL-2 gene DNA identification method and preparing genome DNA. The results of uniformity test and stability test show that the standard substance has good uniformity, can be stored at 4 ℃ for 14 days, needs cold chain transportation, and can be frozen and thawed for 10 times. Can be stably stored for 6 months at-20 ℃. The characteristic quantity value of the standard substance is the copy number of genome DNA, and the identification result of the standard substance is sequentially expressed by a standard value plus or minus an expansion uncertainty: (5.78. + -. 0.51). times.10³copies/. mu.L. The standard substance of the invention has 100 mu L per tube, the sampling amount is 2 mu L when in use, and the standard substance can be used for qualitative and quantitative detection of duck source, and can also be used in the fields of calibration of PCR instruments, verification of DNA quantitative methods, quality control of laboratories and the like.

A method of calibrating a real-time fluorescent quantitative PCR instrument, comprising the steps of: preparing an unknown sample, carrying out real-time fluorescence quantitative PCR reaction, measuring the copy number concentration of the unknown sample, and calculating the sample indication error; performing serial dilution on a duck-derived IL-2 gene DNA standard substance, performing standard curve verification, and calculating a linear regression coefficient r;

wherein the duck-origin IL-2 gene DNA standard substance contains duck-origin genome DNA.

Preferably, the duck-origin IL-2 gene DNA standard substance is in a form of dilution with a plurality of concentration gradients.

Preferably, the gene copy number is 5.78X 10³Copy/. mu.l, extension uncertainty 0.51X 10³The product can be stably preserved for more than 6 months at the temperature of minus 20 +/-2 ℃ after being copied/mul, can still be stably kept after being frozen and thawed for 10 times, has good product uniformity and meets the requirements of standard substances.

Preferably, the preparation method of the duck-origin IL-2 gene DNA standard substance comprises the following steps: pretreatment of duck meat; extracting genome DNA and identifying quality; subpackaging and storing; uniformity evaluation, stability evaluation, fixed value evaluation and uncertainty evaluation, thereby obtaining the standard substance.

Preferably, the duck meat pretreatment is to homogenize duck leg meat, and the obtained homogenate is used for extracting genome DNA; and extracting the genome DNA by adopting an animal tissue large extraction kit.

Preferably, the animal tissue large-volume extraction kit is an animal tissue large-volume extraction kit of Hangzhou Xinjing biological reagent development company, and comprises the following specific steps:

transferring 250mg of homogenate into a 50mL centrifuge tube, adding 200 μ L of protease K solution, adding 1.8mL of Buffer AT preheated AT 56 ℃, and performing vortex oscillation for several seconds to disperse the tissue homogenate;

transferring the centrifuge tube into 56 deg.C water bath, incubating for 30min, and performing vortex oscillation for several times during incubation to help tissue dissolution;

adding 2mL Buffer SL, and carrying out vortex oscillation for 15 seconds; placing the centrifuge tube in 70 deg.C water bath for 15 min;

adding 2mL of absolute ethyl alcohol, gently turning for 4-6 times, and uniformly mixing;

pouring the mixed solution into a nucleic acid purification column, covering a cover, and centrifuging at the rpm of not less than 4500 for 5 min;

discarding the filtrate in the 50mL centrifuge tube, putting the nucleic acid purification column back into the 50mL centrifuge tube, adding 5mL Buffer WB into the nucleic acid purification column, covering the column with a cover, and centrifuging at 4500rpm for 2min or more;

discarding the filtrate in the 50mL centrifuge tube, putting the nucleic acid purification column back into the 50mL centrifuge tube, and centrifuging for 5min at the highest speed;

discarding the filtrate in a 50mL centrifuge tube, placing the nucleic acid purification column in another clean 50mL centrifuge tube, and placing the centrifuge tube in a 56 ℃ constant temperature incubator for standing for 10 min;

adding 1-2mL of 56 deg.C incubation Buffer TE in the center of the nucleic acid purification column, covering the lid, standing in a 56 deg.C incubation incubator for 5min, and centrifuging at 4500rpm for 2min or more;

the column was discarded and the DNA was eluted.

Preferably, the primers and probes used in the fluorescent quantitative PCR are selected from the group consisting of primers and probes for IL-2 gene, COX3 gene, 16SrRNA gene or Cytb gene, preferably one of the nine primer and probe combinations of Table 2-1.

Preferably, the primer and the probe used in the fluorescent quantitative PCR are primers and/or probes for detecting the IL-2 gene of the duck.

Preferably, the primers and probes used in the real-time fluorescent PCR detection are:

6-F	GGAGCACCTCTATCAGAGAAAGACA
		6-R	GTGTGTAGAGCTCAAGATCAATCCC
6-P	FAM-TGGGAACAAGCATGAATGTAAGTGGATGGT-BHQ1

preferably, the reaction conditions and procedures of the real-time fluorescent quantitative PCR detection are as follows: denaturation at 95 deg.C for 5 min; then denaturation at 95 ℃ for 10s, annealing and extension at 58 ℃ for 32s, and 40 cycles; the PCR reaction system is as follows:

reagent	Final concentration	Volume of
			TaqMan reaction solution	1×	12.5μL
10 mu mol/L forward primer	0.8μmol/L	2.0μL
			10 mu mol/L reverse primer	0.8mol/L	2.0μL
10 mu mol/L probe	0.2μmol/L	0.5μL
			DNA template	/	2.0μL
Sterile water	/	6.0μL
			Total volume	/	25.0μL

The invention has the following beneficial effects: the characteristic quantity value of the standard substance is the duck-origin genome DNA copy number of eight laboratories adopting digital PCR combined definite value. The copy number of the duck-derived IL-2 gene DNA standard substance is 5.78 multiplied by 10³copies/. mu.L, expansion uncertainty 0.51X 10³copies/. mu.L. The uniformity and stability of the standard substance are detected by digital PCR, and the result shows that the uniformity and stability of the standard substance are good, the standard substance can be stably stored for more than 6 months at the temperature of minus 20 +/-2 ℃, and the standard substance is stored at the temperature of minus 20 ℃ in the laboratory.

The target gene of the standard substance is IL-2 gene in nuclear genome, is also suitable for detecting cytochrome c oxidase subunit 3 gene (COX3), and relates to the following standards: identification method of common fowl species in food and feed part five: duck component detection PCR method (SN/T3731.5-2013), "Duck-derived component detection PCR method in animal-derived feed" (DB 22/T2049 2014), "Duck-derived component real-time fluorescence PCR detection method in meat food" (Shenzhen), etc. (SZDB/Z258-2017); is suitable for detecting 16S rRNA gene and relates to the following standards: real-time fluorescence PCR method (SN/T2727-2-10) for detecting poultry-derived components in feed; is suitable for detecting Cytb gene and relates to the following standards: a real-time fluorescence PCR method for detecting animal-derived components of common livestock and fowl (SN/T submission).

The use of the duck-origin IL-2 gene DNA standard substance can effectively solve the problem that the detection results among animal-origin laboratories in China are incomparable, and provides technical support for the detection and monitoring of animal-origin products in China.

Drawings

FIG. 1 shows the IL-2 gene sequence and primer/probe design position. The 1 st and 3 rd frame regions are primer sequences and the 2 nd frame region is a probe sequence.

FIG. 2 fluorescent quantitative amplification curve of primer/probe sequence of IL-2 nuclear gene.

FIG. 3 fluorescent quantitative PCR amplification curve analysis.

FIG. 4 intervarietal specific real-time fluorescent quantitative amplification curve analysis.

FIG. 5 analysis of the internal specific fluorescent quantitative amplification curve.

FIG. 6 is a sequence alignment chart of IL-2 gene (part) in different duck breeds.

FIG. 7 comparison of Anatid IL-2 gene mRNA sequences in NCBI database. The frame part is the primer sequence.

FIG. 8 is a comparison (section) of the genomic sequences of Duck green head IL-2 (AY821656 and AY707747) in NCBI database. The frame part is the primer and probe sequence.

FIG. 9 analysis of sensitivity of duck-origin genomic DNA by real-time fluorescent quantitative PCR method.

FIG. 10 shows the amplification curve of duck-origin genomic DNA IL-2 nuclear gene by real-time fluorescent quantitative PCR method.

FIG. 11 shows a standard curve of real-time fluorescent quantitative PCR method for duck-derived genomic DNA IL-2 nuclear gene.

Figure 12 digital PCR primer probe concentration optimization PCR amplification heatmap.

Figure 13 digital PCR annealing temperature optimized PCR amplification heatmap.

FIG. 14 digital PCR specific detection amplification map of duck-derived genomic DNA/IL-2 nuclear gene. Wherein 1 in the B picture: and 2, golden sheldrake: you county sheldrake 3: gaoyou sheldrake 4: shaoxing duck 5: 6, Beijing duck: 7, wild sheldrake: martaihu duck 8: 9, Jinyun sheldrake: you county duck 10: green duck 11: and (3) the spotted duck 12: medium duck 13: lazhou group old ducks 14: 15, cherry duck: h₂O。

FIG. 15 Linear Range test of digital PCR, X-axis represents expected copy number concentration of DNA solution, and Y-axis represents copy number concentration measured by digital PCR.

FIG. 16 mass spectra and amplification efficiency detection maps of IL-2 nuclear gene primers/probes.

FIG. 17 shows a technical route for preparing duck-origin component genome DNA standard substance.

FIG. 18 genomic DNA electropherogram. 1, 1.0. mu.L of genomic DNA; 2, 2.0. mu.L of genomic DNA.

FIG. 19 is a standard curve of duck-origin genomic DNA. A: standard Curve B amplification Curve

FIG. 20 shows that the standard substance of the present invention is used for specific detection and quantitative determination.

FIG. 21 shows the amplification profile of duck component detection PCR method (SN/T3731.5-2013). A: DB 22/T2049-2014; b: ddH 2O; c: SN/T3731.5-2013; d: ddH2O

FIG. 22 SN/T2727-2010 Standard amplification Curve.

FIG. 23 SZDB/Z258-.

FIG. 24: a real-time fluorescence PCR method standard amplification curve of a common livestock and poultry animal derived component detection method.

Detailed Description

The present invention is described in detail below with reference to specific embodiments, which should not be construed as limiting the scope of the present invention.

Example 1 scope of the invention study

The method collects fourteen main duck varieties in China, such as Beijing ducks, Shaoxing ducks, cherry ducks, Huzhou group old ducks, green-headed ducks, medium ducks, spotted-mouth ducks, Jinyun sheldrake, Shanma ducks, Mataihu ducks, Jindingsheldrake, Jindingxian ducks and Gaoyou sheldrakes, and adopts interleukin 2(Interleukin 2, IL-2) in nuclear genome DNA as a target gene to establish the method. IL-2 is a cytokine secreted by lymphocytes after being stimulated by antigens and having an immunoregulatory effect, has an important effect on immune response of organisms, virus infection resistance and the like, and is a single-copy gene. IL-2 of different species has a species-specific sequence, and by sequence alignment of IL-2 genes of different duck varieties, we find that the specific sequence exists in all collected ducks, and the characteristic sequence has commonality in the duck subfamily, and the gene sequence is shown in FIG. 1.

Duck meat is currently used as the main adulterated meat for counterfeiters because of its relative cheapness. But due to the lack of standard substances of duck-origin components in the market, the monitoring and detecting results lack comparability and traceability. Through the research and development of duck-origin IL-2 gene DNA standard substances, a duck-origin genome DNA standard substance preparation, quantitative detection, quality control and quantity value tracing technical platform is established, a set of complete and standardized animal-origin genome standard substance preparation technical system is formed, a proven standard substance is provided for the safety supervision of meat products, data comparability and quantity value unification are realized among laboratories, and technical, information and standard substance services are provided for the detection and safety evaluation of meat products in China. Meanwhile, the duck source IL-2 gene DNA standard substance can be used in the fields of calibrating related instrument and equipment in molecular biology, evaluating animal source analysis method and the like, and the construction of the development and preparation platform of the standard substance can be a technical basis for developing and storing animal source series standard substances in China.

Example 2 Duck-derived component detection method

DNA has the advantages of abundant genetic information, stable physicochemical property (thermal stability and acid-base stability are superior to protein), wide in-vivo existence and the like, the identification technology for detecting the species of meat and meat products by using the PCR method based on the DNA has the advantages of high specificity, convenient method, no limitation of tissue types and the like, the detection precision can reach the level of subgenus and subgenera, and the method becomes a mainstream method of the identification and analysis technology of animal-derived components in food. At present, quantitative detection can be divided into real-time fluorescent quantitative PCR and digital PCR according to different platforms of PCR reaction. The real-time fluorescence quantitative PCR is to perform PCR amplification reaction on a real-time fluorescence quantitative PCR instrument, and the digital PCR is to perform PCR amplification reaction on a digital PCR platform.

In the invention, the primer/probe screening and the reaction condition optimization are carried out by adopting real-time fluorescent quantitative PCR and digital PCR, and the uniformity, the stability and the copy number of the duck-origin component genome DNA standard substance are accurately measured by adopting the digital PCR.

2.1 Duck-origin component specificity detection primer/Probe screening

8 groups of primers/probes are searched by the literature and relevant standards, and a group of primers/probes is designed by self (Table 2-1), and screened by a real-time fluorescent quantitative PCR test for specificity performance among species, wherein only interleukin 2 (IL-2) primers/probes have good specificity, only duck-origin genomic DNA can be amplified, and no amplification is carried out in other species (Table 2-2, FIG. 2).

In the selection of PCR template, we performed comparative studies on mitochondrial DNA and nuclear genomic DNA. The PCR method for meat component identification usually selects mitochondrial DNA or nuclear genomic DNA as a template for PCR. The animal mitochondrial DNA is characterized in that: one cell contains a plurality of mitochondrial DNAs, and the tissues are different, and the copy number of mitochondria is different, for example, the number of mitochondria in cardiac muscle cells and liver cells is much greater than that in skin cells; mitochondrial DNA is a naked circular DNA double-stranded molecule, with genomes typically small, 15-20 kb; mitochondrial DNA does not contain non-coding regions; mitochondrial DNA evolves at a relatively high rate and follows a certain law, and is therefore widely used in the study of evolutionary genetics. Nuclear genomic DNA is characterized by its high degree of conservation and consistency: the sequences of somatic cells are highly conserved, except for the partial rearrangement of genomic DNA that occurs in very specific cell types; the mutation rate of the nuclear genome DNA is low; the copy numbers of nuclear genomic DNA in different cells of the same species are basically consistent, which is beneficial to the quantification of DNA. Therefore, compared with mitochondrial DNA, nuclear genomic DNA has the advantage of being not influenced by tissue source, copy number and evolution rate, and is the best choice for templates and standard substances in animal-derived component identification systems.

TABLE 2-1 primers and Probe sequences used in development of Duck-derived genomic DNA standards

TABLE 2-2 IL-2 Nuclear Gene primer/Probe sequence inter-species specificity amplification fluorescent quantitation Ct values

Species of	Ct value	Species of	Ct value
				Duck	25.14	Fox	N/A
Cattle	N/A	Mouse	N/A
				Sheep (sheep)	N/A	Horse	N/A
Chicken with egg yolk	N/A	Deer shaped food	N/A
				Pig	N/A	Dog	N/A

2.2 real-time fluorescent quantitative PCR method confirmation

2.2.1 primer/Probe concentration optimization experiment

Real-time fluorescent quantitative PCR is carried out by IL-2 primer/probe with several concentration ratios, the final concentration of the primer/probe in the reaction system is optimized, and different combinations of the primer/probe concentrations are set (Table 2-3). After the reaction efficiency is examined, the final concentration of the subsequent testing primer is determined to be 0.8 mu mol/L, and the final concentration of the probe is determined to be 0.2 mu mol/L (figure 3). PCR amplification was performed on a CFX96 fluorescent PCR instrument (Bio-rad, Hercules, Calif., USA) with the following PCR reaction program: denaturation at 95 deg.C for 5 min; 40 cycles (denaturation at 95 ℃ for 10s, annealing extension at 58 ℃ for 32 s). Finally, confirming the quantitative PCR amplification system of duck-derived genomic DNA (tables 2-4).

TABLE 2-3 primer and Probe concentration combinations

Final concentration of primer	Final concentration of probe	Quality of primer Probe	Origin of origin	Ct value
					0.8μmol/L	0.2μmol/L	4: 1	The invention	25.52
0.15μmol/L	0.05μmol/L	3:1	The invention	26.77
					0.2μmol/L	0.1μmol/L	2:1	The invention	28.75
0.4μmol/L	0.2μmol/L	2:1	The invention	26.12

TABLE 2-4 Duck-origin genomic DNA quantitative PCR amplification system

2.2.2 fluorescent quantitative PCR method specificity and sensitivity

2.2.2.1 interspecies specificity

Interspecific specificity was tested by real-time fluorescent quantitative PCR on cattle, sheep, chickens, ducks, pigs, foxes, mice, horses, deer, dogs, and closely related species pigeons, quails, geese. The test result shows that: only the IL-2 nuclear gene has a typical amplification curve in duck-derived genomic DNA (Table 2-5, FIG. 4).

TABLE 2-5 intervarietal specific real-time fluorescent quantitative PCR Ct values

2.2.2.2 intraspecific

The intraspecific characteristics of the duck are tested by carrying out real-time fluorescent quantitative PCR on the duck-derived genomic DNA of different varieties. The test result shows that: the IL-2 nuclear gene has typical amplification curves in the genomic DNA of different duck varieties (Table 2-6, FIG. 5). Meanwhile, sequencing comparison is carried out on PCR products of different duck varieties (as shown in figure 6), and comparison results show that amplification sequences of 14 varieties are completely consistent, have high conservation and meet expectations.

TABLE 2-6 species internal specificity fluorescence quantitative Ct values

Duck variety	Ct value	Duck variety	Ct value
				Spotted-mouth duck	25.46	Jinding sheldrake	25.46
Medium duck	25.53	You county duck	25.48
				Green duck	25.36	You county sheldrake	25.61
Huzhou group old duck	25.42	Shaoxing duck	25.26
				Cherry duck	25.45	Gaoyou sheldrake	25.41
Mountainella duck	25.53	Jinyun sheldrake	25.56
				Mataihu duck	25.55	Beijing duck	25.23

Taking "duck internukin-2" as a keyword, the IL-2mRNA sequences of 15 anatidae animals can be retrieved in NCBI database (https:// www.ncbi.nlm.nih.gov /), and the 15 IL-2 genes are subjected to multi-sequence alignment, and as a result, the IL-2 genes of other anatidae species are found to be highly conserved except kindred species (swan geese, bar geese and white wild geese) (FIG. 7), and the primers: IL-2-F:5'-GGAGCACCTCTATCAGAGAAAGACA-3' and IL-2-R:5'-GTGTGTAGAGCTCAAGATCAATCCC-3' are highly conserved in these species (FIG. 7), where IL-2-F is located in the first exon and IL-2-R is located in the second exon.

JX239770 and AY392557 are Anser cygnoides (great goose), JX239766 is Anser indicus (wide goose), JX239769 is Anser albifrons (white wild goose), KX943297 is Anatidae sp, Sansui ShelderDuck (Sansui duck), JX239768 is Anas poecillonhycha (spotted mouth duck), AY193713 and DQ666278 are Cairinamoschata (cockamadora wartii), AF294323, AF294322, NM _001310373, AY 028173, AY232490, JX239765 and HQ008784 are Anas platyrhynchos (green head duck).

Since the vertebrate IL-2 gene contains 4 exons and 3 introns, and the probe sequence spans the 1 st exon and the 1 st intron, with "duck interleukin-2 gene" as the keyword, only 2IL-2 gene sequences of green-headed ducks could be retrieved in NCBI database (https:// www.ncbi.nlm.nih.gov /), and the sequence alignment results showed that the two are highly similar (FIG. 8). Based on the high conservation of the IL-2mRNA sequence, the probe sequence is presumed to be highly conserved in ducks, and the intraspecific experiment also proves that the presumption is correct.

2.2.2.3 sensitivity

The duck meat genomic DNA is subjected to gradient dilution, the concentrations are 13930, 6965, 2786, 557, 112, 23, 11, 6 and 3copies respectively, and the sensitivity of the quantitative detection method is examined. No typical amplification curve was found when the amount of DNA template was as low as 3 copies; on the other hand, when the amount of the template is 6copies, a typical amplification curve is generated, and thus the detection sensitivity of the quantitative PCR reaction is about 6copies of the DNA molecule (FIG. 9).

2.2.3 Standard Curve of real-time fluorescent quantitative PCR method

The real-time fluorescent quantitative PCR amplification product is exponentially increased in the initial stage, and enters a platform stage due to the consumption of reaction substrates after amplification is carried out for a certain number of cycles. The level of fluorescence produced early in the PCR reaction was not clearly distinguishable from background. The quantitative detection is generally carried out in the exponential phase of PCR amplification, the reaction cycle number of which the fluorescence signal exceeds a certain threshold value is defined as a Ct (cycle threshold) value, the Ct value of each template has a linear relation with the logarithm of the initial copy number of the template, and the larger the initial copy number is, the smaller the Ct value is. And (3) drawing a standard curve by using a standard substance with known initial copy number by utilizing the principle that the Ct value of each template has a linear relation with the logarithm of the initial copy number of the template, wherein the abscissa represents the logarithm of the initial template copy number, and the ordinate represents the Ct value. Therefore, the amount of the duck-origin component genomic DNA (the amount of the total genomic DNA) in the sample can be calculated according to the standard curve as long as the Ct value of the unknown sample is obtained.

And (3) carrying out gradient dilution on the concentration of the duck-derived genome DNA, taking the DNA solution subjected to gradient dilution as a standard substance, drawing a standard curve, and inspecting various technical parameters of the duck genome DNA quantitative detection method. The amplification curves and the plotted standard curves are shown in FIGS. 10 and 11.

Determining coefficient R of duck-origin genome DNA standard curve²A value of 0.995, greater than 0.98; the slope of the standard curve of the duck-derived genomic DNA is-3.434 and ranges from-3.6 to-3.1; the amplification efficiency of the duck-derived genomic DNA quantitative method is 95.5% and between 90% and 110%. RSD values for Ct values between replicates for each gradient sample were less than 25%.

2.3 digital PCR method establishment and validation

Digital PCR is a quantitative analysis technique that has been rapidly developed in recent years, and is an absolute quantitative technique of DNA copy number that does not depend on a standard substance and a standard curve, unlike the conventional quantitative PCR technique. The digital PCR is not quantified according to the cycle threshold (Ct value) of the amplification curve, so that the digital PCR is not influenced by the amplification efficiency, has good accuracy and reproducibility, and can realize absolute quantitative analysis. Several companies like Fludigym, Bio-rad, ABI have proposed digital PCR products in succession so far, and these products have shown great technical advantages and application prospects in the research fields of single cell analysis, early cancer diagnosis and prenatal diagnosis. In terms of standard substance preparation, digital PCR has been successfully used for the valuing of leukemia diagnosis plasmid DNA standard substance (ERM-AD623 a-ERM-AD 623f) and breast cancer diagnosis genomic DNA standard substance (SRM2373), and reliable valuing results are obtained.

The microdroplet type digital PCR is to microdroplet process the sample, and in the microdroplet generator, the reaction system containing nucleic acid molecules is formed into thousands of nano-upgrading water-in-oil microdroplets, wherein each microdroplet contains no nucleic acid target molecules to be detected or contains one to several nucleic acid target molecules to be detected, and each microdroplet is used as an independent PCR reactor. After PCR amplification, a droplet analyzer (droplet reader) is adopted to detect water-in-oil droplets one by one, the interpretation of droplets with fluorescence signals is 1, the interpretation of droplets without fluorescence signals is 0, and finally, according to the Poisson distribution principle and the proportion of positive droplets, QuantaSoft can calculate the copy number concentration of target molecules to be detected. The microdroplet digital PCR reaction comprises 4 steps of preparing the system, generating microdroplets, amplifying cycles and reading signals.

2.3.1 droplet digital PCR reaction System optimization

The primer/probe sequence used in the microdroplet digital PCR is identical to that of real-time fluorescent quantitative PCR, and the sequence is shown in Table 2-1. Add 20. mu.L of PCR system and 70. mu.L of microdroplet generating oil generating microdroplet to the microdroplet generating card and transfer the generated microdroplet to a PCR tube for PCR amplification reaction. Digital PCR was performed by using several concentrations of IL-2 primer/probe, optimizing the final concentration of primer/probe in the reaction system, and setting different combinations of primer/probe concentrations (tables 2-7). According to the investigation, when the mass ratio of the primer to the probe is 2:1, the final concentrations are 0.5 mu mol/L and 0.25 mu mol/L respectively, no obvious rain phenomenon occurs (figure 12), and the concentration of the primer and the probe for the subsequent test of the digital PCR is determined. The annealing temperature in the PCR reaction procedure has obvious influence on the raining phenomenon of the microdroplets, and a temperature gradient is set in the annealing link of the reaction procedure. According to the heat map of the PCR reaction, there was a significant difference in the fluorescence intensity of the droplets at different annealing temperatures for the duck-derived genomic DNA (fig. 13). Comparing the digital PCR amplification heat maps of different annealing temperatures, finding that when the annealing temperature is 60 ℃, no obvious rain phenomenon occurs, and determining the optimal annealing temperature of the digital PCR to be 60 ℃.

TABLE 2-7 primer and Probe concentration combinations

Final concentration of primer	Final concentration of probe	Quality of primer Probe	Origin of origin
				0.2μmol/L	0.1μmol/L	2:1	The invention
0.5μmol/L	0.25μmol/L	2:1	The invention
				0.8μmol/L	0.2μmol/L	4:1	The invention
0.15μmol/L	0.05μmol/L	3:1	The invention

Thus, after optimization, the microdroplet digital PCR system was 20. mu.L, containing 10. mu.L of 2 XDdPCR Master Mix, 1.0. mu.L each of 10. mu. mol/L forward and reverse primers, 0.5. mu.L probe, and 2. mu.L DNA template. The micro-drop digital PCR reaction program is denaturation at 95 ℃ for 10 min; 40 cycles (denaturation at 94 ℃ for 15s, annealing extension at 60.0 ℃ for 1 min); denaturation at 98 ℃ for 10 min; storing at 4 ℃. After amplification, the 96-well plate was placed in a microdroplet reader to read the signal and the experimental data was analyzed using software QuantaSoft version1.6.6.0320 to obtain absolute quantitative results.

2.3.2 specific detection of digital PCR

In order to investigate the duck-derived genomic DNA/IL-2 gene digital PCR interspecific specificity, the genomic DNA and ddH of Shaoxing duck, cattle, sheep, chicken, pig and fox are respectively used₂O (blank control) was used as a template for digital PCR amplification. Only the Shaoxing duck genome DNA/IL-2 gene has positive microdroplets, and the amplification results of other templates are negative. The amplification result shows that the Shaoxing duck genomeThe DNA/IL-2 gene digital PCR system has good inter-species amplification specificity (FIG. 14A).

In order to examine the duck-derived genomic DNA/IL-2 gene digital PCR intraspecific species, the genomic DNA and ddH of Jinding sheldrake, Zhi county sheldrake, Gaoyou sheldrake, Shaoxing duck, Beijing duck, Shanma sheldrake, Mataihu duck, Jinyun sheldrake, Zhi county duck, green-head duck, spotted-mouth duck, medium duck, Huzhou group old duck, cherry duck₂O (blank control) was used as a template for digital PCR amplification. ddH₂When O is a template, no positive microdroplet exists; the amplification results of other templates are positive. The amplification result shows that the duck-derived genomic DNA/IL-2 gene digital PCR system has good intraspecific amplification (FIG. 14B).

2.3.3 Linear Range of digital PCR

The theoretical effective linear range of the droplet-type digital PCR is 1-100000 copies, but 20 μ L of the reaction solution can only generate 12000-16000 effective droplets in the droplet generator, and the number of droplets greater than 10000 is effective reaction. To test the linear range of the digital PCR system, duck-derived genomic DNA was subjected to gradient dilution with copy numbers 13859, 6929.5, 2772, 554.5, 111, 22, respectively, and microdroplet digital PCR measurements 13060, 6535, 2690, 529.5, 113, 22.5, respectively. Analysis of the correlation between the expected and measured values revealed that when the template amount was between 20 and 14000copies, the measured value obtained by the digital PCR of the microdroplet had a good correlation with the expected copy number concentration, determining the coefficient R²The value is equal to 1 and the linear equation y is 0.9412x +22.037(y represents the measured copy number and x represents the expected copy number, see fig. 15).

2.3.4 detection and quantitation limits of digital PCR

To determine the detection limit and the quantification limit of the digital PCR system, digital PCR amplification was performed by gradient dilution of duck-derived genomic DNA to 22, 11 and 6 copies/. mu.L. Each concentration is repeated for 4 times, when the DNA concentration is as low as 11copies, a positive signal can still be stably detected, and the positive microdroplet is between 9 and 12 copies; when the DNA concentration is as low as 6copies, one reaction has a positive signal, and the rest has no positive microdroplets; the detection limit of digital PCR was estimated to be 11 copies/. mu.L. When the DNA concentration was 22 copies/. mu.L, the relative standard deviation of the measurement values between the repeated reactions was 4.06%, which was less than 25%, and the limit of quantitation of the digital PCR was presumed to be 22copies of the duck-derived genomic IL-2 nuclear gene.

2.3.5 repeatability of digital PCR

Carrying out digital PCR amplification by using the duck-origin genomic DNA subjected to gradient dilution as a template, and repeating the reaction for 4 times on each template. Data statistics were performed on the standard deviation and relative standard deviation of the measurements between 4 replicates, and the standard deviation between replicates was measured as the template copy number decreased (tables 2-8). In the linear range of digital PCR, the relative standard deviation increases with decreasing copy number, but is less than 25%.

TABLE 2-8 Duck-origin genomic DNA/IL-2 digital PCR measurement result stability analysis

In summary, to ensure that the measurements have less uncertainty, a droplet digital PCR system and procedure is recommended, see 2.3.1. The repeatability test result shows that the digital PCR system with the optimized project has good repeatability, and the measurement result between the repetitions is stable and reliable.

Example 3 primer/Probe Synthesis and confirmation

In the process of developing duck-derived IL-2 gene DNA standard substances, primers/probes are used for standard substance uniformity, stability detection, standard substance quantification and the like, so that the synthesis quality of the primers/probes is very important for the development process and quantification.

3.1 primer/Probe Synthesis

In order to ensure the quality of the synthesis of the primers/probes, the primers/probes obtained by research units and cooperative value-fixed laboratories were synthesized by Biotechnology engineering (Shanghai) GmbH. The primer/probe for standard substance development is synthesized by committee organism (Shanghai) of development unit, and after receiving the synthesized primer, the development unit is responsible for confirming the synthesis quality of the primer/probe. The primer/probe for standard substance joint rating is synthesized by the Joint rating organization unit, living organism (Shanghai) committed by the institute of biotechnology of Chinese academy of agricultural sciences, and after receiving the synthesized primer, the Joint rating organization unit is responsible for confirming the synthesis quality of the primer/probe.

3.2 confirmation method

The principle of primer/probe quality confirmation is to ensure that the primer/probe can be efficiently amplified in qualitative and quantitative amplification, and the amplification efficiency reaches 90-110%. Primer/probe quality confirmation is generally performed from two aspects: (1) the primers/probes provided by the validation company were of very high purity. After receiving the primers/probes, the "DNA synthesis report" provided by the company was checked to confirm whether the nucleotide sequences and molecular weights of the primers/probes were consistent with those expected. The purity and molecular weight of the primer/probe are judged by observing a DNA mass spectrum detection map, and the mass spectrum is required to have only one single peak, and the molecular weight is consistent with the expectation. (2) The amplification efficiency of the primer/probe reaches 90-110%. The confirmation method is to dilute the DNA solution containing the target sequence in a gradient way, perform real-time fluorescence PCR amplification as a standard sample, and draw a standard curve y ═ ax + b according to the linear relation between the logarithm of the initial template copy number and the Ct value after the amplification is finished. According to the slope of the standard curve, using the formula E ═ 10^(-1/a)-1) × 100 the efficiency of amplification was calculated. The research of the standard substance in the report mainly adopts a quantitative detection method of IL-2 nuclear gene, and a primer/probe mass spectrogram and an amplification efficiency detection map are shown in figure 16, wherein the peak map of the primer/probe is single, and the molecular weight is consistent with the expected molecular weight; the amplification efficiency of the IL-2 nuclear gene primers/probes was 94.9%, between 90-110%. The quality confirmation result of the primer/probe proves that the synthesized primer/probe can be efficiently amplified, has good quality and can be used for standard substance development and value determination.

Example 4 preparation of Standard substance

4.1 preparation strategy

The technical route for preparing the duck-derived IL-2 gene DNA standard substance is shown in figure 17, and mainly comprises preparation of a genome DNA candidate, measurement of genome DNA copy number concentration, subpackage and storage of the standard substance candidate, uniformity test and stability test of the standard substance, joint valuing of the standard substance, uncertainty evaluation and the like.

4.2 genomic DNA candidate preparation

4.2.1 Duck leg harvesting

The duck legs are collected at animal husbandry and veterinary research institute of agricultural academy of sciences in Zhejiang province, and the Shaoxing duck leg meat is used for extracting a large amount of genome DNA.

4.2.2 Duck leg meat homogenate

The duck leg meat is peeled by a sterile scalpel, cut into small pieces, put into a clean Philips homogenizer for homogenate, and transferred into a 50mL centrifuge tube for subsequent DNA extraction after homogenate.

4.2.3 extraction of genomic DNA

And the kit is screened out by a preliminary test at the early stage. The invention can adopt an animal tissue large-extraction kit to extract genome DNA, and preferably selects the animal tissue large-extraction kit of Hangzhou Xinjing biological reagent development company Limited. The principle is that DNA of dissolved animal tissue is combined on a purification column after being digested by proteinase K, degraded protein and PCR inhibitor are filtered and removed, and the DNA is washed by Buffer and then eluted, so that the DNA can be used in molecular experiments.

The DNA extraction procedure is as follows:

1) 250mg of homogenate was transferred to a 50mL centrifuge tube, 200. mu.L of proteinase K solution was added, 1.8mL of Buffer AT preheated AT 56 ℃ was added, and the homogenate was dispersed by vortexing for several seconds.

2) Transferring the centrifuge tube into 56 deg.C water bath, incubating for 30min, and performing vortex oscillation for several times during incubation to help tissue dissolution;

3) 2mL Buffer SL was added and vortexed for 15 seconds. The tube was placed in a 70 ℃ water bath for 15 min.

4) Adding 2mL of absolute ethyl alcohol, gently turning for 4-6 times, and uniformly mixing.

5) Pouring the mixed solution into a nucleic acid purification column, covering a cover, and centrifuging at a speed of not less than 4500rpm for 5 min.

6) Discard the filtrate in the 50mL centrifuge tube, put the nucleic acid purification column back into the 50mL centrifuge tube, add 5mL Buffer WB into the nucleic acid purification column, cover the column, and centrifuge at 4500rpm for 2 min.

7) Discard the filtrate from the 50mL centrifuge tube, place the nucleic acid purification column back into the 50mL centrifuge tube, and centrifuge at the highest speed for 5 min.

8) The filtrate in the 50mL centrifuge tube was discarded, and the nucleic acid purification column was placed in another clean 50mL centrifuge tube and placed in a 56 ℃ incubator for 10 min.

9) Adding 1-2mL of 56 deg.C incubation Buffer TE in the center of the nucleic acid purification column, covering the lid, standing in a 56 deg.C incubation incubator for 5min, and centrifuging at 4500rpm for 2 min.

10) The column was discarded and the eluted DNA was immediately used.

4.2.4 quality evaluation and concentration determination of genomic DNA candidates

(1) Agarose gel electrophoresis analysis

1.0 mu L and 2.0 mu L of the extracted genomic DNA samples are respectively taken and detected by 1 percent agarose gel electrophoresis, and if the bands are clear and bright, the bands are single and no miscellaneous bands exist, the quality of the extracted genomic DNA is very good. FIG. 18 shows the genomic DNA extracted according to the present invention, which is bright, single, and non-dispersive, and thus meets the quality requirements.

(2) Spectrophotometry for measuring concentration and purity

Determination of the purity (OD) of the DNA extracted by UV spectrophotometry₂₆₀/OD₂₈₀The value should be within 1.8 to 2.0). Then, the DNA concentration was measured using a Qubit 2.0 fluorometer. The mass concentration and copy number concentration of the duck-derived genomic DNA are converted according to the following formulas:

Cc＝(Cm×NA×10^-9)/(M×S×2)

in the formula:

cc-genomic DNA copy number concentration, copies/. mu.L

Cm-genomic DNA Mass concentration, mg/L

NA-Avogastron constant, 6.02X 10²³copies/mol

Average molecular weight of M-nucleotide, g/mol

S-Duck genome size, 1.1Gb

6 parallel reactions, OD, were measured by UV spectrophotometry using the absorbance of genomic DNA standard candidate determined by Nanodrop 2000(Thermo Scientific, USA)₂₆₀/OD₂₈₀Has an average value of 1.98, between 1.8 and 2.0; OD₂₆₀/OD₂₃₀Has an average value of 2.28, greater than 2.0. The test result shows that the purity of the genome DNA meets the requirement.

Then, the DNA concentration was preliminarily estimated by the Qubit 2.0, and the DNA concentration was about 100 ng/. mu.L. According to the measurement value, the genomic DNA was diluted to about 6.5 ng/. mu.L with 0.1 XTE.

(3) PCR reaction inhibitor detection

In order to examine whether or not the genomic DNA extracted according to the present invention contains an inhibitor that interferes with the PCR reaction, and whether or not it is suitable for the quantitative PCR detection by fluorescence. And (3) carrying out gradient dilution on the extracted duck-origin genomic DNA, and diluting for 6 gradients, wherein the concentration ranges from 100 ng/mu L to 0.02 ng/mu L are approximately corresponded. And (3) performing fluorescence quantitative PCR by using the diluted 6 concentration gradient DNAs as templates, drawing a standard curve, and checking the linear range of the detection method. The detection results are shown in fig. 19. And drawing a standard curve by taking the logarithm of the copy number of the template as an abscissa and the Ct value as an ordinate. The standard curve is: -3.415X +42.632, R²0.998, slope: 3.415, amplification efficiency 96.3%. The amplification efficiency of the extracted duck-origin genome DNA is normal, and no inhibitor interfering PCR reaction is contained. Each technical parameter of the drawn standard curve is within a specified range, and the standard curve is suitable for quantitatively detecting duck-origin components. The linear range of the standard curve corresponds to 100 ng/mu L-0.02 ng/mu L, which is equivalent to 1.69 multiplied by 10 of duck-origin genome DNA⁵-34copies/μ L, covering the concentration range of conventional duck-origin quantitative detection.

EXAMPLE 5 Standard substance dispensing and preservation

And (4) subpackaging the genomic DNA subjected to quality evaluation and concentration determination in a biological safety cabinet. The subpackaging process is always kept in a low-temperature state. The dispensed genomic DNA was 100. mu.L per tube, and 500 tubes were dispensed. The split-packaged genomic DNA was placed in 100-grid freezing boxes and stored in an ultra-low temperature freezer at-20 ℃.

EXAMPLE 6 homogeneity test

The duck-origin IL-2 gene DNA standard substance is subjected to statistical test according to a test method specified in 'general principle and statistical principle of JJF1343-2012 standard substance definite value' in China.

The duck source IL-2 gene DNA standard substance of the invention prepares 500 tubes, randomly extracts 15 tubes from the 500 tubes, respectively marks 1-15, and takes 3 subsamples per tube, and totally 45 samples. Each sample was taken at 2 μ L, the IL-2 nuclear gene was amplified by digital PCR, the copy number was checked for homogeneity by analysis of variance (F-test), and homogeneity uncertainty was synthesized based on the results of homogeneity check.

1.16.1 homogeneity test protocol

And detecting the uniformity of the DNA standard substance among bottles by adopting a digital PCR technology. After the digital PCR was completed, the data were statistically analyzed by anova (F-test). The ANOVA method is to judge whether there is a systematic difference between the measured values of each group by comparing the variance between the groups and the variance within the group, and if the ratio of the two is less than the critical value of the statistical test, the sample is considered to be uniform.

In order to test the uniformity of the samples, m bottles of minimum packaging units are extracted, and n samples are extracted from each bottle of minimum packaging unit. M sets of equal precision measurement data are obtained under the same conditions as follows:

1.x₁₁，x₁₂，……

mean value of

2.x₂₁，x₂₂，……

Mean value of

…………

m,x_m1,x_m2,

… … average value

Is provided with

Then the difference between the groups

Within group difference sum

Note the book

ν₁As m-1 (inter-group freedom)

ν₂Equal to N-m (group inner freedom)

As statistic F:

it follows that the statistic is a degree of freedom (v)₁，v₂) F distribution variable of (2).

According to degree of freedom (v)₁，v₂) And given significance level α, the critical F can be found from the F table_αThe value is obtained. If F<F_αIf the difference between the samples is not obvious, the samples are uniform, and if F is more than or equal to F_αSystematic differences between groups are suspected.

The standard deviation of uniformity between bottles can be calculated by the following formula. Equivalent to the uncertainty component u due to intertubular inhomogeneities_bb。

When the repeatability of the measurement method for uniformity inspection is poor, the method may cause

The standard deviation of uniformity at this time can be calculated as follows:

6.2 homogeneity test results

The measurements were performed on each sample taken under identical experimental conditions, so that the differences between the individual samples are completely reflected by the inhomogeneities of the samples. At the same time, 45 genomic DNAs were subjected to digital PCR detection, and the obtained copy data are shown in Table 6-1. Analyzing the measured data by adopting an F test method, and showing F by a statistical analysis result<F_0.05(14,30)(Table 6-1), that is, this batch of genomic DNA standard substance had good uniformity.

TABLE 6-1 results of uniformity test between bottles

6.3 optimal sample size

The invention discovers that when the template amount is between 20 and 14000copies through a linear range test of digital PCR, the measured value obtained by microdroplet digital PCR has good correlation with the expected copy number, and the coefficient R is determined²The value is equal to 1. From this, it can be seen that the optimal sampling amount should be within the linear range. Digital PCRThe reaction system commonly used in the experiment is 20 mu L, and the conventional method in the industry is to add 2 mu L of DNA template into the reaction system of 20 mu L. The result of the present invention was 5780copies, which is in the linear range, and thus it was determined that the sub-standard substance of the present invention had an optimum sample size of 2. mu.L, i.e., 2. mu.L in the PCR reaction.

In addition, the invention in the standard substance tube, tube uniformity experiment, using 2 u L genome DNA solution as template test, the test results confirmed the invention of the standard substance in tube and tube uniformity.

6.4 uniformity-induced uncertainty assessment

The results of the homogeneity test showed that the genomic DNA standards had good homogeneity between vials. Due to the fact that

(Table 6-1), the uncertainty introduced by the uniformity of the characteristic quantity, gene copy number, was calculated using the following formula:

the relative uncertainty is:

example 7 stability test

7.1 stability test protocol

The stability of the standard substance is another important parameter for measuring the standard substance. The long term stability of the standard substance is related to the storage conditions and the short term stability is related to external factors during transport of the sample. There are two basic experimental designs for stability studies: classical stability studies and simultaneous stability studies.

In a classical stability study, samples prepared simultaneously (e.g. in the same batch) are measured over time under the same conditions. In this case, the work is performed under (laboratory) reproducibility conditions, resulting in a relatively high uncertainty, since it also involves instability of the measurement system; in the simultaneous stability study, all measurements of the stability study can be performed under repetitive conditions, which emphasizes that all measurements are performed simultaneously, rather than being distributed over the time interval of the stability study as in the classical stability study. The synchronization method reduces the dispersion at time points, thereby improving the "resolution" of the stability study. Therefore, based on the difference between measurement repeatability and (laboratory) reproducibility, the synchronization stability studies are usually less uncertain than the classical methods. A prerequisite for such a design is the ability to specify conditions under which no degradation occurs or at least at a rate different from the selected storage conditions.

In the stability research of the duck source IL-2 gene DNA standard substance, the DNA standard substance stored at the temperature of-70 ℃ is taken as a reference in combination with the research results of other international DNA standard substances, the DNA standard substance is considered not to change under the condition, the magnitude under other temperature conditions is compared with the magnitude under the temperature of-70 ℃, and the adopted research method is a synchronous stability method.

The stability was evaluated by measuring the characteristic value of the standard substance at different times, and plotting the relationship between the characteristic value and time with time as the X-axis and the characteristic value as the Y-axis.

The basic model for stability assessment can be expressed as Y- β₀+β₁X

In the formula:

β₁,β₀-a regression coefficient;

x-time;

y-characteristic value of candidate substance for standard substance

For a stable standard substance, β₁Is zero.

Assuming that there are n observations of X, Y (X)_i，Y_i) Y on each analog straight line_iAvailable formulas

And (6) estimating.

In the formula:

xi-ith time point;

yi is the observed value of the ith time point;

-average of all time points;

-average of all observations.

Formula available for intercept

And (4) calculating.

β₁Standard deviation s (β)₁) By the formula

And (4) calculating.

Where s-standard deviation of each point on the line, in

And (4) calculating.

In the formula:

xi-ith time point;

yi is the observed value of the ith time point;

β₁,β₀-a regression coefficient;

n-number of measurements

Based on β₁The standard deviation of (A) can be determined by t-test by comparing the standard deviation with the standard deviation of | β₁|＜t_0.95，n-2·s(β₁) Then the slope is not significant and no instability is observed.

The uncertainty introduced by stability is estimated according to the formula: mu.s_s＝s(β1)·X

In the formula:

u_suncertainty introduced by stability

s(β₁)—β₁Standard deviation of (2)

X-given shelf life

7.2 short term stability

According to the results of the research combined with other international DNA standard substances, the DNA standard substances are not changed under the condition of-70 ℃. The short-term stability test aims at investigating the transportation stability of the standard substance, and the condition of extreme high temperature cannot be excluded in the transportation process, so that the samples are respectively stored at 4 ℃, 25 ℃, 37 ℃ and 60 ℃, are respectively sampled after the 0 th day, the 1 st day, the 3 rd day, the 7 th day and the 14 th day and are stored at-70 ℃, 3 tubes are randomly selected at each storage temperature, each tube is repeatedly sampled for 3 times (N is 3), and the samples are uniformly detected after the sampling is finished. And (3) adopting a method of amplifying the IL-2 gene by digital PCR to carry out stability test. Copy number of IL-2 nuclear gene (Table 7-1), T-test was performed on the data (Table 7-2), and the samples were evaluated for short-term stability.

As a result, analysis shows that after 14 days of storage, the copy number of the DNA standard substance does not change significantly under the storage conditions of 4 ℃, 25 ℃ and 37 ℃, and the DNA standard substance shows good short-term stability. Due to the high temperature of 60 ℃, only 1 day of standing showed good short term stability. Therefore, the short-term stability examination result shows that the DNA standard substance can be stably stored and transported for 14 days at normal temperature, the characteristic value can not be obviously changed, and a cold chain transportation mode is required.

TABLE 7-2 short term stability test results

The short-term stability results are analyzed on the data through T-test, and the results show that the variation difference does not reach a significant level. After the sample is stored for 14 days at 37 ℃, the copy number change trend is not obvious, but the sample is stable for one day at most at 60 ℃, so that a cold chain transportation mode is required to ensure the transportation stability of the standard substance during the transportation process in summer.

7.3 Long term stability

The long-term stability test is to store the samples at-20 ℃ respectively, take samples after months 0, 1, 2, 4 and 6, randomly select 3 bottles at each storage temperature, and repeatedly take samples 3 times per bottle (N is 3 ). Digital PCR tests gave IL-2 gene copy numbers (Table 7-3) and the data were subjected to T-test (Table 7-4). The long-term stability of the product is examined by detecting the change of the copy number of the product.

TABLE 7-3 Long-term stability test IL-2 Gene copy number

TABLE 7-4 Long-term stability test results

Therefore, the stability investigation result shows that the DNA standard substance of the duck-derived IL-2 gene is | β at the temperature of-20 DEG C₁|＜t_0.95，n-2·s(β₁) The slope of the straight line has no significant change, and the storage stability is good in 6 months. Therefore, the duck-derived IL-2 gene DNA standard substance is in a stable state within 6 months.

7.4 Freeze thaw stability

Because the minimum sampling amount of the standard substance is 2 mu L when in use, each tube of the standard substance is 100 mu L, 3 tubes of samples of the duck-derived IL-2 gene DNA standard substance are taken in an experiment, the freeze thawing is carried out for 10 times repeatedly, each tube of samples is sampled for 3 times, and whether the amount value of the duck-derived IL-2 gene DNA standard substance is changed or not is detected. The data of the number of the fusogenic copies of the standard substance are shown in tables 7-5, and the statistical table of the copy number results is shown in tables 7-6.

TABLE 7-5 Freeze/thaw stability test results

TABLE 7-6 statistical analysis of freeze thaw stability test

The statistical results (tables 7-6) of the repeated freezing and thawing for 10 times show that the slope is not significant, which indicates that the duck-origin genome standard substance has no obvious rising or falling trend in the repeated freezing and thawing for 10 times, and the variation range is within the characteristic quantity value and the uncertainty range thereof. Therefore, the duck-origin genome standard substance is stable in the use process of repeated freeze thawing for 10 times.

7.5 evaluation of uncertainty introduced by Standard substance stability

7.5 evaluation of uncertainty introduced by Standard substance stability

The uncertainty contribution to copy number stability is given by the formula: u. of_s＝s(β₁)·X。

Long-term stability uncertainty calculation:

long-term stability uncertainty u at-20 ℃ with a pot life t of 6 months_s＝17.88×6＝107.28copies/μL

5553.11 copies/. mu.L, relative uncertainty u_rel(S)Is 0.020.

Short-term stability uncertainty calculation: the results in Table 7-2 show that the standard deviation is large at 25 ℃, and the uncertainty introduced by the short-term stability is as follows:

u_sts＝13.69×14＝191.70copies/μL，

the relative uncertainty is:

u_rel(sts)comprises the following steps: 0.035.

EXAMPLE 8 valuing

The duck-derived IL-2 gene DNA standard substance described in the report is prepared by taking Shaoxing duck legs as raw materials. At present, each detection mechanism mainly adopts a real-time fluorescent quantitative PCR method and a digital PCR method to carry out quantitative detection on animal-derived components, and a detection target is total genomic DNA. In order to facilitate the tracing of the detection result, the characteristic quantity value of the standard substance is the copy number of the duck-origin total genome DNA, and the characteristic quantity value is jointly determined by eight laboratories by adopting digital PCR independent of the standard substance.

8.1 selection of the fixed value laboratory

The fixed value of the standard substance is determined by cooperation of a plurality of laboratories according to the requirements of JJF1343-2012 standard, and the number of the laboratories participating in the fixed value at this time is 8.8 laboratories are engaged in DNA measurement for a long time, have certain technical authoritativeness, and have necessary conditions and equivalent technical capability and experience in the aspect of measuring the characteristic quantity of the standard substance.

8.2 purpose and method for laboratory valuability verification

By distributing a blind sample (the blind sample is a national first-class standard substance) to 8 laboratories: a transgenic rice G6H1 genome DNA standard substance [ GBW10141]) is verified to have the same technical capability in 8 laboratories by using a digital PCR instrument to determine the blind sample copy number so as to ensure that the provided result has higher accuracy and reliability.

The 8 laboratories (table 8-1) tested 2 tubes of blind samples, repeated 2 times per tube, performed statistical analysis on the experimental data and returned the experimental data to the academy of agriculture sciences in Zhejiang province for validation.

TABLE 8-1 participating in the benchmarking laboratory

8.3 laboratory constant value capability verification test results

TABLE 8-2 laboratory rating capability verification test results (copies/. mu.L)

Conclusion of the experiment

The experimental results show that: 8 laboratory testsThe RSD% is less than 25%, and the values fall in the value of the transgenic rice G6H1 genome DNA standard substance (standard value + -uncertainty (2.66 + -0.25) × 10)⁵Within the uncertainty interval range of copies/uL, the detection capability of 8 laboratories is proved to be stable, and the requirement of joint constant value capability is met. (Table 8-2)

8.4 measurement traceability description

The digital PCR is an absolute nucleic acid quantitative method independent of standard substances, and the principle is to divide an original PCR reaction system, further amplify all small reaction systems (water-in-oil microdroplets or chip reaction chambers), and calculate and obtain the copy number or copy number concentration of a target sequence in a sample through the positive rate and the poisson distribution. This method has become the main method for accurate quantification of nucleic acids. The preparation raw material of the secondary duck source IL-2 gene DNA standard substance is obtained by extracting and diluting Shaoxing duck leg meat with DNA. The copy number of the IL-2 nuclear gene in the duck genome is quantified by a digital PCR method through 8 laboratories in a combined manner, so that the copy number of the standard substance is quantified.

In the development process, the digital PCR determination method system is fully optimized, the linear range, the precision, the quantitative limit, the detection limit and the like of the method are confirmed in a laboratory, and the established test method is fully researched to ensure that the requirement of a fixed value is met.

The laboratory of the unit of the invention is provided with a quality management system of qualification certification and Certification (CMA) of a national certification and supervision inspection institution, and a certification/calibration plan, a calibration and confirmation program, a period check program, a supplier evaluation program and the like of related instruments and equipment are established, so that the accuracy, the effectiveness and the traceability of the rating result of the related instruments and equipment are ensured.

The 8 units with joint fixed values select mechanisms with quality system guarantee such as CMA or CNAS and are engaged in DNA test for a long time. Before the value is determined, a blind sample (national first-class standard substance transgenic rice G6H1 genome DNA) is issued for laboratory capability examination, and the result shows that the value of the detection result of 8 laboratories falls into the value of the standard substance (standard value +/-uncertainty (2.66 +/-0.25) multiplied by 10)⁵copies/uL ] uncertaintyWithin the range of the degree interval, the detection capability of 8 laboratories is proved to be stable, and the provided result is ensured to have higher accuracy and reliability.

The unit of the invention participates in digital PCR quantitative detection capability verification organized by LGC and SIMT in 2019 and 7 months, and the used digital PCR instrument QX200 is provided with an operation inspection report by an instrument manufacturer. Two blind samples are examined, quantitative data are provided after the analysis of a digital PCR test, the expected value (the Z value is-0.73) is met, and the result is satisfactory. The result of the capability verification can provide a metering proof for the accuracy and comparability of the digital PCR instrument.

8.5 method of valuing

The invention discloses a method for jointly determining the copy number of a duck-origin IL-2 gene DNA standard substance genome by adopting a digital PCR method in multiple laboratories. Designing and screening primers/probes of the duck genome quantitative PCR method, and optimizing the concentration. Different primer/probe combinations are compared and screened, the optimal primer probe combination IL-2-F/IL-2-R/IL-2-P is screened as a candidate primer, the primer probe sequence is detailed in a table 2-1, the length of an amplification product is 212bp, and the reaction system is detailed in a table 2.3.5. In the quantitative determination process, the IL-2 nuclear gene copy number is used to characterize the total amount of genomic DNA.

The digital PCR instrument is the latest experimental platform in the field of life science, and the digital PCR technology is the most accurate nucleic acid quantitative detection technology which is regarded at present and is an absolute quantitative technology independent of standard substances. This technique has been used by the National Institute of Standards and Technology (NIST) for quantitative determination of nucleic acid Standards, and also in the development of IRMM transgenic assay Standards for the European Union. Leukemia diagnosis plasmid standard substance (ERM-AD263 a-ERM-AD 263f) developed by IRMM of European Union and breast cancer diagnosis genome DNA standard substance (HER2) released in the United states are assigned values by digital PCR method. In the invention, the detection is carried out by using a Berlol microdroplet digital PCR platform, and the details of a digital PCR reaction system are shown in 2.3.5. By utilizing an optimized reaction system, digital PCR amplification of duck-origin genomic DNA IL-2 nuclear genes can be carried out on a droplet-type digital PCR platform, positive droplets and negative droplets can be clearly distinguished within an acceptable linear range, and the result shows that absolute quantitative analysis of duck-origin IL-2 gene DNA standard substance IL-2 nuclear genes can be carried out on the droplet-type digital PCR platform.

8.6 Joint constant value implementation

In order to measure the copy number of the standard substance, 8 laboratories organized by the institute of agricultural product quality standards of agricultural academy of sciences in Zhejiang province use a digital PCR method for joint value determination, which comprises: 1. agricultural rural agricultural product and processed product quality safety supervision, inspection and test center (Hangzhou) (agricultural product quality standard institute of agricultural academy of sciences, Zhejiang province), 2. agricultural rural plant and plant microbial ecological environment safety supervision, inspection and test center (Beijing) (Biotechnology institute of Chinese agricultural academy of sciences), 3. agricultural rural grain and product quality supervision, inspection and test center (Harbin) (Black dragon Jiang province agricultural academy of sciences), 4. Zhejiang province inspection and quarantine scientific technology institute, 5. agricultural rural transgenic plant environment safety supervision, inspection and test center (Hangzhou) (Rice institute of Chinese agricultural academy of sciences), 6. agricultural rural plant and plant microbial ecological environment safety supervision, inspection and test center (Guangzhou) (southern agricultural university), 7. agricultural rural agricultural product and transgenic product supervision, inspection and test center (Tianjin), 8. The plant ecological environment safety supervision and detection test center (Shanghai) (Shanghai university of transportation) in rural areas of agriculture.

Before the implementation of the joint valuation, a detailed implementation scheme is made by agricultural product quality standard research institute of agricultural academy of sciences in Zhejiang province. The agricultural product quality standard research institute of Zhejiang agricultural science institute distributes the primers/probes subjected to quality verification and the prepared genome DNA standard substances to 8 laboratories, and after the determination is completed, the data is fed back to the agricultural product quality standard research institute of Zhejiang agricultural science institute of organizer. The data were collected and processed by the organizer and the data of the digital PCR experiments in 8 laboratories are summarized in tables 8-3.

TABLE 8-3 Duck origin IL-2 gene DNA standard substance IL-2 nuclear gene copy number value combined definite value data

8.7 analysis of Joint constant value data

(1) Laboratory data suspect value inspection

The suspicious values of 8 groups of data from 8 laboratories were examined by the dixon method and the glabraun method, respectively (see table 8-3 for details). In the dixon method, measurement data are arranged in descending order of magnitude, and r is calculated separately₁Value of sum r_nValue r₁＝(X₍₂₎-X₍₁₎)/(X_(n)-X₍₁₎)，r_n＝(X_(n)-X_(n-1))/(X_(n)-X₍₁₎). If r₁>r_nAnd r is₁>f_(a,n)Then, X is judged₍₁₎Is an abnormal value; if r₁<r_nAnd r is_n>f_(a,n)Then, X is judged_(n)Is an abnormal value; if r₁And r_nAll values are less than f_(a,n)Then all data is retained. Through dixon examination, all data in the laboratory in the joint fixed value are not abnormal and are reserved. In the Glabraun method, residual

When | v_i|>λ_(a,n)When s, then x_iShould be rejected. From the table lookup, λ (0.05,8) ═ 2.126, checked by the grazing brown method, and all data in the laboratory were retained in this combined set.

(2) Joint constant-value data normality distribution test

And (4) carrying out normal distribution test on all the joint constant-value raw data because the cooperative constant-value data has no suspicious value. The assay was performed using the agostipol method.

In the formula:

n is the number of measurements.

Carrying out statistical analysis on the data of the joint fixed value of the 8 laboratories, and calculating to obtain Y_{Number of copies}1.05, falling in the critical interval of the Dagowstrino method test, and conforming a plurality of fixed value data to be normal distribution.

(3) Data set equal precision test between laboratories

And (3) adopting a Koclen method to check whether the average values have equal precision, firstly calculating the variance of each group of n data of the m groups of data, and then calculating the ratio of the maximum variance to the sum of the m variances:

according to the significance level α, the data set number m, the repeated measurement times n and the Critical value table of the Cocklon test, the C (α, m, n) ═ C (0.05,8,8) ═ 0.3043 of the DNA standard substance of the duck-origin IL-2 gene is obtained, and the C values calculated at this time are respectively as follows:

C_{number of copies}＝0.2261

And calculating to obtain C values which are all smaller than the critical value C (a, m, n), and indicating that the average values of all groups of data have equal precision.

The result of the duck-derived IL-2 gene DNA standard substance table 8-3 data is statistically analyzed, and the data result meets the requirement of JJF 1343. The total average value was taken as a standard value.

8.8 Standard values of Standard substance

As can be seen from the statistical results, the joint-fixed-value measurement data are equal-precision data, and the mean values among the groups have no significant difference, so the measurement results can be represented by arithmetic mean values, see tables 8-4.

TABLE 8-4 Duck origin component genome DNA constant value multi-parameter statistical results

8.9 uncertainty assessment

8.9.1 uncertainty introduced by fixed value process

Synthetic uncertainty u due to the process of standard substance valuing_cThe first part is to calculate the uncertainty of A class according to the standard deviation of the measured data, the measuring times and the required confidence level by a statistical method. And the second part is to evaluate the type-B uncertainty of the measurement influence factors by a non-statistical analysis method.

(1) A-type uncertainty introduced by combining duck-origin genome DNA copy number with definite value

Measuring standard value of standard substance by digital PCR, subjecting the measured data to normal distribution, and testing

The average values of the experiments are summarized, and the arithmetic average value is the average value of the standard values

Therefore, the specific calculation method of the uncertainty introduced by the fixed value of the duck-derived component genome DNA is based on the 7.3.2 part of JJF1343-2012 and specifically comprises the following steps:

the A-type uncertainty of the duck-origin component genome DNA is as follows:

u_{copy number of A}＝33.55copies/μL，u_rel(A)＝0.0059

(2) Class B uncertainty introduced in the valuing process

Class B uncertainty results primarily from uncertainties resulting from digital PCR misidentification of positive and negative droplets, and from inconsistencies in digital PCR micro-reaction volumes. Accurate identification of positive and negative droplets is ensured by using specially designed automatic identification software and by using optimized digital methods, in which uncertainty is negligible, based on the fact that droplets which are difficult to identify are not generated during the optimization of the digital PCR method. Class B uncertainty thus essentially accounts for the uncertainty resulting from inconsistent PCR droplet volumes.

During the process of preparing droplets, inconsistencies in droplet volumes can occur (Demeke and Dobnik, 2018). The present invention uses an 8-channel droplet generator (DG8) for droplet digital PCR, and the extended uncertainty introduced by the droplets in this method is given in the article published by the European Union laboratories and Australian measurement institute as 2% (Philippe Corbistier et al, 2015). The invention selects the measurement uncertainty as the uncertainty introduced by the droplet volume inconsistency, and then the relative uncertainty is as follows:

in the invention, the IL-2 nuclear gene is amplified by adopting single-fold digital PCR, and the uncertainty brought by the digital PCR in the joint value-fixing process of the invention is as follows: 0.01.

(3) relative standard uncertainty introduced by definite value process of synthetic standard substance

The relative uncertainty introduced during the standard substance calibration was synthesized as:

8.9.2 uniformity-induced uncertainty

The results of the homogeneity test showed that the genomic DNA standards had good homogeneity between vials. Due to the fact that

(Table 6-1), the uncertainty introduced by the uniformity of the characteristic quantity, the IL-2 gene copy number, was calculated using the following formula:

the relative uncertainty is:

8.9.3 uncertainty introduced by stability

Uncertainty in copy number stabilityThe degree contribution adopts a formula: u. of_s＝s(β₁)·X。

Long-term stability uncertainty calculation:

long-term stability uncertainty u at-20 ℃ with a pot life t of 6 months_s＝17.88×6＝107.28copies/μL

5553.11 copies/. mu.L, relative uncertainty u_rel(S)Is 0.020.

Short-term stability uncertainty calculation: the results in Table 7-2 show that the standard deviation is large at 25 ℃, and the uncertainty introduced by the short-term stability is as follows:

u_sts＝13.69×14＝191.70copies/μL，

the relative uncertainty is:

u_rel(sts)comprises the following steps: 0.035.

8.9.4 standard uncertainty of synthesis

The total uncertainty of the standard mass quantitation result consists of three parts. The first part is the synthetic uncertainty u of the A-and B-type uncertainties brought about by the standard substance valuing process_c(ii) a The second component is the standard uncertainty u caused by the heterogeneity of the material_bb(ii) a The third component is the standard uncertainty u caused by the instability of the substance over the useful life_s。

The synthesis standard uncertainty was:

and (3) the extended uncertainty U is ku (k is 2, the confidence probability is 95%), and then the relative standard uncertainty of the duck-origin genomic DNA copy number is:

the relative expansion uncertainty of the duck-derived genomic DNA copy number is:

U _rel2 × 0.044 ═ 0.088(k ═ 2, confidence probability 95%), extended uncertainty U ═ 0.088 × 5780.94 ═ 508.73 copies/. mu.l, so the magnitude of the copy number and uncertainty of the DNA standard substance of duck-derived IL-2 gene were (5.78 ± 0.51) × 10³copies/μL。

The characteristic quantity value of the standard substance is the duck-origin genome DNA copy number of eight laboratories adopting digital PCR combined definite value. The copy number of the duck-derived IL-2 gene DNA standard substance is 5.78 multiplied by 10³copies/. mu.L, expansion uncertainty 0.51X 10³copies/. mu.L. The uniformity and stability of the standard substance are detected by digital PCR, and the result shows that the uniformity and stability of the standard substance are good, the standard substance can be stably stored for more than 6 months at the temperature of minus 20 +/-2 ℃, and the standard substance is stored at the temperature of minus 20 ℃ in the laboratory.

The target gene of the standard substance is IL-2 gene in nuclear genome, is also suitable for detecting cytochrome c oxidase subunit 3 gene (COX3), and relates to the following standards: identification method of common fowl species in food and feed part five: duck component detection PCR method (SN/T3731.5-2013), "Duck-derived component detection PCR method in animal-derived feed" (DB 22/T2049 2014), "Duck-derived component real-time fluorescence PCR detection method in meat food" (Shenzhen), etc. (SZDB/Z258-2017); is suitable for detecting 16S rRNA gene and relates to the following standards: real-time fluorescence PCR method (SN/T2727-2-10) for detecting poultry-derived components in feed; is suitable for detecting Cytb gene and relates to the following standards: a real-time fluorescence PCR method for detecting animal-derived components of common livestock and fowl (SN/T submission).

The use of the duck-origin IL-2 gene DNA standard substance can effectively solve the problem that the detection results among animal-origin laboratories in China are incomparable, and provides technical support for the detection and monitoring of animal-origin products in China.

Example 10 use of the Standard substance of the present invention for specific detection and quantitative determination

Standard substance development units purchase certain brand ham sausages from supermarkets, and the package is marked with duck meat components.

Extracting DNA from duck leg meat stored in a laboratory, and performing gradient dilution to establish standard yeast. Meanwhile, duck-derived standard substances are used as positive quality control substances, extracted ham sausage DNA is used as a sample, and IL-2 genes are used as target genes for real-time fluorescence PCR detection by referring to standard substance specifications. The results are shown in FIG. 20:

from FIG. 20, we can see R of the constructed standard curve²The amplification efficiency was 99.4% satisfactory at 0.999, slope-3.336, and the copy number of the standard substance was calculated as 5600 copies, and the sample copy number was 270 copies within the uncertainty range of the standard substance.

Therefore, the practical detection shows that the duck-origin IL-2 gene genome DNA standard substance can completely meet the requirements of practical detection, can be used as a positive quality control substance for detection, and can also be used for accurately quantifying the copy number of duck-origin components in a sample.

Example 11 calibration of a real-time fluorescent quantitative PCR instrument with the standard substance of the present invention

According to the polymerase chain reaction analyzer calibration standard (JJF1527-2015), the duck-origin IL-2 genome DNA standard substance is used for calibrating and detecting a laboratory real-time fluorescence quantitative PCR instrument.

1. Sample indication error:

according to the standard requirements, preparing an unknown sample 1(U1) and an unknown sample 2(U2), fully shaking and mixing the samples after the preparation, and testing the copy number concentration of the samples. The results are as follows:

calculating sample indicating value error according to the formula:

2. diluting the duck source IL-2 gene DNA standard substance, and performing standard yeast verification.

R²＝0.999

If the standard curve conforms to R²And if the sample uncertainty is within the allowable range, the instrument has no problem. Tong (Chinese character of 'tong')After experiments, the standard substance meets the requirements of 'polymerase chain reaction analyzer calibration standard'.

Example 12 example of the use of the standard substance of the invention for laboratory quality control

In order to detect whether the duck-origin IL-2 gene DNA standard substance can meet the requirement of laboratory quality control, the existing effective duck-origin component detection standard is found, and the duck-origin IL-2 gene DNA standard substance is used as a quality control sample, and a primer/probe, a reaction system and a reaction program in the standard are used for testing. The test results were as follows:

the fifth part of the method for identifying the common poultry varieties in food and feed comprises the following steps: the PCR method for detecting duck components (SN/T3731.5-2013) (the amplification map is shown in figure 21)

1. Primer sequences

TABLE 12-1 primer sequences

PCR reaction System

TABLE 12-2 PCR reaction System (25. mu.L)

PCR reaction conditions

TABLE 12-3 PCR reaction conditions

4. Sequencing results

>Contig\2

ctagttcgggggggttgggtactaggcttgagtggaagaatgccccagaaaaatccggaagaagcttggggtgatgaaggattgcctgcgtatcgtaggccttttgcttgggactgtaggtgtggtgggtgctggaaggtgcttgggaagggtgcctcctcgaaatggaggccctggcggcaggaggaggataagt5. blast result

The corresponding gene is Cytochrome C oxidase subunit 3, Cytochrome C oxidase subunit III, abbreviated as COX 3.

Secondly, a PCR method (DB 22/T2049-

1. Primer sequences

TABLE 12-4 primer sequences

PCR reaction System

TABLE 12-5 PCR reaction System (25. mu.L)

PCR reaction conditions

TABLE 12-6 PCR reaction conditions

4. Sequencing results

DBS22018-2013

>Contig\1

cttgaggtggaaaggccccagaaaaaaatccctagggaagaaggcttcggtgatgagggattgatcgtaggcctgccgtatgtaggccttttgggactgtaggtgtggtggtggtgctggaaggaggtgcctctctctctctctctgcggacaatgtccgctcgttcatgtgggatactgagcatgcattggccggcgcgcgcgcgcgcgcaggcaggaggagg 5.blast result

The corresponding gene is Cytochrome C oxidase subunit 3, Cytochrome C oxidase subunit III, abbreviated as COX 3.

Thirdly, the method for detecting the avian-derived components in the feed adopts a real-time fluorescence PCR method (SN/T2727-

1. Primer probe sequence

TABLE 12-7 primer Probe sequences

qPCR reaction System

TABLE 12-8 qPCR reaction System (50. mu.L)

qPCR reaction conditions

TABLE 12-9 qPCR reaction conditions

4. Sequencing results

TGAGCACTAAGATCCCACTAATTAAGACTTAACTAAAGCATTTTATACGA

Blast results

The target gene is as follows: 16S rRNA

Fourthly, the real-time fluorescence PCR detection method of duck-derived ingredients in meat food (Shenzhen city) (SZDB/Z258-

1. Primer probe sequence

TABLE 12-10 primer Probe sequences

qPCR reaction System

TABLE 12-11 qPCR reaction System (20. mu.L)

qPCR reaction conditions

TABLE 12-12 qPCR reaction conditions

4. Sequencing results

>Contig\1

tcttactcacaacctcagggctagtcatgtgattccactacaactcatctatcctgctagccgccggcctcttatcaat gctcctagtgatactccaatgatgacgggacattgtccgagagagcaccttccaaggccaccacacacctacaa

Blast results

The corresponding genes are: cytochrome C oxidase subunit 3, Cytochrome C oxidase subunit III, abbreviated COX 3.

Fifthly, a real-time fluorescence PCR method (SN/T submission draft) for detecting animal-derived components of common livestock and poultry (the amplification curve is shown in figure 24)

1. Primer probe sequence

TABLE 12-13 primer Probe sequences

qPCR reaction System

TABLE 12-14 qPCR reaction System (25. mu.L)

qPCR reaction conditions

TABLE 12-15 qPCR reaction conditions

4. Sequencing results

GCATGGCATGCCTACACCGCAGACACATCCCTTGCTTTATCCTCAGTCGCCAACACAAC

Blast results

The target gene is as follows: cytb gene

Through the tests of 5 standards, the duck-derived IL-2 gene DNA standard substance has good applicability and can be used as the positive quality control substance of the current effective standard.

The invention has been described in terms of specific embodiments, and equivalent alterations and modifications can be effected thereto, by those of skill in the art, without departing from the spirit of the invention and within the scope of the claims.

Sequence listing

<110> Zhejiang province academy of agricultural sciences

<120> method for calibrating real-time fluorescent quantitative PCR instrument

<160>1

<170>SIPOSequenceListing 1.0

<210>1

<211>865

<212>DNA

<213> Duck

<400>1

ttctatgggg gagtgggaca gcgcatgagg gaaaaagtgt ttcatgcaga aagcacaaag 60

agactgccaa aagtgagtgt gggcttctct ttccccaatg aatgtaggta aaatccctct 120

tgctttaaaa aaattccaaa gtgtcatcag gggaggaaaa acaaaagtaa tgattcttgc 180

catacaggta aagcatatga aaaaatgtgt aataaaacct cttttacatg acgcccccat 240

ctttttccct ccagaaagaa gagtataaat acactaaaca gcctaatgac aacatatcag 300

ctctcattac atatcacaac tgaaatacta gcacagagac aaccagaaca ctgacaagat 360

gtgcaaagta ctcatcttca gctgcctttc agtactaatg cttatgacta cagcttatgg 420

agcacctcta tcagagaaag acaacactct taaaacttta ataaaagatt tagaaaacct 480

gggaacaagc atgaatgtaa gtggatggtt ttcctgtatt aattctttac tatttgtctt 540

ttctacttat ttttgtctat taactttgtt cacaaaaatt aactttttcc ccctcttctc 600

tacaggggat tgatcttgag ctctacacac caaatgacac aaaggtaagt tcaagttttc 660

tgtcttcagg actgctaaga tacggctatt ttgaagttat gtgttattga attagaccaa 720

agtaattcac ttaccagaag gcccgataca aaagacaaat ctgagctgtc tgaactttgt 780

gtgaggatag cataagctaa cctagaagta ctgggcacaa ggatagcagg ctaacctaga 840

agacatttct gcttttgatt tgtat 865

Claims (10)

1. A method for calibrating a real-time fluorescent quantitative PCR instrument is characterized by comprising the following steps:

preparing an unknown sample, carrying out real-time fluorescence quantitative PCR reaction, measuring the copy number concentration of the unknown sample, and calculating the sample indication error;

performing serial dilution on a duck-derived IL-2 gene DNA standard substance, performing standard curve verification, and calculating a linear regression coefficient r;

wherein the duck-origin IL-2 gene DNA standard substance contains duck-origin genome DNA.

2. The method according to claim 1, wherein the duck-derived IL-2 gene DNA standard is in a form of multiple dilution with concentration gradient.

3. Method according to claim 1, characterized in that the gene copy number is 5.78 x 10³Copy/. mu.l, extension uncertainty 0.51X 10³The product can be stably preserved for more than 6 months at the temperature of minus 20 +/-2 ℃ after being copied/mul, can still be stably kept after being frozen and thawed for 10 times, has good product uniformity and meets the requirements of standard substances.

4. The method of claim 1, 2 or 3, wherein the preparation method of the DNA standard substance of the duck-derived IL-2 gene comprises the following steps: pretreatment of duck meat; extracting genome DNA and identifying quality; subpackaging and storing; uniformity evaluation, stability evaluation, fixed value evaluation and uncertainty evaluation, thereby obtaining the standard substance.

5. The method according to claim 4, wherein the duck meat pretreatment is to homogenize the duck leg meat, and the resulting homogenate is used to extract genomic DNA; and extracting the genome DNA by adopting an animal tissue large extraction kit.

6. The method according to claim 5, wherein the animal tissue macro-extraction kit is an animal tissue macro-extraction kit from Hangzhou Xinjing Bioreagent development Co., Ltd, and comprises the following steps:

transferring 250mg of homogenate into a 50mL centrifuge tube, adding 200 μ L of protease K solution, adding 1.8mL of Buffer AT preheated AT 56 ℃, and performing vortex oscillation for several seconds to disperse the tissue homogenate;

transferring the centrifuge tube into 56 deg.C water bath, incubating for 30min, and performing vortex oscillation for several times during incubation to help tissue dissolution;

adding 2mL Buffer SL, and carrying out vortex oscillation for 15 seconds; placing the centrifuge tube in 70 deg.C water bath for 15 min;

adding 2mL of absolute ethyl alcohol, gently turning for 4-6 times, and uniformly mixing;

pouring the mixed solution into a nucleic acid purification column, covering a cover, and centrifuging at the rpm of not less than 4500 for 5 min;

discarding the filtrate in the 50mL centrifuge tube, putting the nucleic acid purification column back into the 50mL centrifuge tube, adding 5mLBuffer WB into the nucleic acid purification column, covering the column with a cover, and centrifuging at 4500rpm for 2min or more;

discarding the filtrate in the 50mL centrifuge tube, putting the nucleic acid purification column back into the 50mL centrifuge tube, and centrifuging for 5min at the highest speed;

discarding the filtrate in a 50mL centrifuge tube, placing the nucleic acid purification column in another clean 50mL centrifuge tube, and placing the centrifuge tube in a 56 ℃ constant temperature incubator for standing for 10 min;

adding 1-2mL of 56 deg.C incubation Buffer TE in the center of the nucleic acid purification column, covering the lid, standing in a 56 deg.C incubation incubator for 5min, and centrifuging at 4500rpm for 2min or more;

the column was discarded and the DNA was eluted.

7. The method according to any one of claims 1 to 6, wherein the primers and probes used in the quantitative fluorogenic PCR are selected from the group consisting of primers and probes for the IL-2 gene, the COX3 gene, the 16SrRNA gene or the Cytb gene, preferably one of the nine primer and probe combinations of tables 2-1.

8. The method according to claim 7, wherein the primers and probes used in the fluorescent quantitative PCR are primers and/or probes for detecting the IL-2 gene of duck.

9. The method according to claim 8, wherein the primers and probes used in the real-time fluorescent PCR detection are:

6-F GGAGCACCTCTATCAGAGAAAGACA 6-R GTGTGTAGAGCTCAAGATCAATCCC 6-P FAM-TGGGAACAAGCATGAATGTAAGTGGATGGT-BHQ1

10. the method according to any one of claims 1 to 9, wherein the reaction conditions and procedures of the real-time fluorescent quantitative PCR assay are as follows: denaturation at 95 deg.C for 5 min; then denaturation at 95 ℃ for 10s, annealing and extension at 58 ℃ for 32s, and 40 cycles; the PCR reaction system is as follows:

reagent Final concentration Volume of TaqMan reaction solution 1× 12.5μL 10 mu mol/L forward direction 0.8 2.0μL 10 mu mol/L reverse primer 0.8 2.0μL 10 mu mol/L probe 0.2 0.5μL DNA template / 2.0μL Sterile water / 6.0μL Total volume / 25.0μL

Images