CN111068071A

CN111068071A - Gene therapy for Leber genetic optic neuropathy

Info

Publication number: CN111068071A
Application number: CN201811230856.2A
Authority: CN
Inventors: 李斌
Original assignee: Wuhan Niufusi Biological Technology Co ltd
Current assignee: Wuhan Niufusi Biological Technology Co ltd; Wuhan Neurophth Biotechnology Ltd Co
Priority date: 2018-10-22
Filing date: 2018-10-22
Publication date: 2020-04-28
Also published as: WO2020082417A1

Abstract

The present invention relates to gene therapy for Leber's hereditary optic neuropathy. In particular, the present invention unexpectedly found that the administration of meprobamate before and after gene therapy of ocular diseases (i.e., administration of recombinant adeno-associated virus according to the present invention) not only significantly improved the therapeutic effect, but also effectively prevented and/or treated complications of gene therapy, such as selective cataract extraction, uveitis, anterior chamber inflammation, vitritis, with low side effects.

Description

Gene therapy for Leber genetic optic neuropathy

Technical Field

The invention relates to the field of gene therapy, in particular to gene therapy for Leber genetics optic neuropathy.

Background

Leber genetic optic neuropathy (LHON), a genetic disease that involves primarily fibers of the macular papilla tract, leading to optic neurodegeneration, is a maternal genetic disease whose etiology and mechanism have not been elucidated, was first reported in 1858 and was named after 1871 by the Leber name of the german scholars who first described its clinical features. LHON is rare, and clinically, the symptoms of simultaneous or sequential acute or subacute indolent visual deterioration of both eyes can be accompanied by central visual field loss and dyschromatopsia. At present, the treatment is usually carried out by using neurotrophic medicaments or Chinese medicinal herbs, but the treatment effect is poor. Because there is no effective treatment, only a few patients can get better once the disease is developed, and most patients eventually go to the end of blindness. Since the discovery of this disease, some doctors pay attention to it, and the etiology, mechanism and treatment method are being sought.

Human Genome Project (HGP) implementation is a great advance in medicine, and the source of the disease can be traced after all. Some researchers have conducted molecular level studies on LHONs by means of HGP-derived bioengineering techniques. Wallace in 1988^[2]Finding the first LHON related mutation site m.11778G>A, later researchers found more than 60 mitochondrial DNA (mtDNA) mutation sites in succession. It is internationally recognized at present, and comprises m.11778G>A，m.3460G>A and m.14484T>c mtDNA mutations including these three common primary mutation sites are the molecular basis for LHON pathogenesis.

With the improvement of molecular biology level, genetic engineering technologies represented by gene sequencing, gene diagnosis and gene therapy are becoming mature, and human beings have further deepened understanding of disease essence and more accurate therapeutic means.

The human eye is the first choice for gene therapy in the mind of researchers due to its special physiological and structural characteristics. Three groups of studies in the united states and the uk in 2007 were successful in clinical trials for gene therapy of Leber Congenital Amaurosis (LCA), and satisfactory results were obtained in both safety and efficacy, opening the way to gene therapy of ocular diseases. Subsequently, up to 31 clinical trials of gene therapy for ocular diseases, including Retinitis Pigmentosa (RP), were approved.

LHON is characterized by frequent and incomplete appearance and sex bias in young and strong years; the incidence rate of Asian region is about 1.18/10000, the mutation rate of primary mutation site m.11778G > A is about 87% -92.9%, and the mutation rate of China is about 90%. In other words, there are about 15 ten thousand LHON patients with m.11778g > a mutation at the primary mutation site in china.

Clinical research on gene therapy of the first LHON patient in the world is completed in 2011, 9 LHON gene therapy patients participating in clinical research have been observed for 7 years so far, the curative effect and the safety of the LHON gene therapy patients are fully verified, and the appearance and the form of retinas of the patients after the injection of the medicine are not abnormal. Similar studies were performed in 2015 by professor Guy in the united states, who treated 14 patients, 6 with improved vision, but two with uveitis. Clinical trials of LHON gene therapy conducted by GenSight Biologics, france 15 cases presented 2 selective cataract extractions, 2 severe anterior chamber inflammation and vitreal inflammation events.

Therefore, there is an urgent need in the art to develop new and safer gene therapy methods and drugs.

Disclosure of Invention

The invention aims to provide a safer gene therapy eye method and a safer gene therapy eye medicine.

In a first aspect of the present invention, there is provided a pharmaceutical combination comprising:

(A) a first agent comprising (a) a first active ingredient which is a recombinant adeno-associated virus comprising an exogenous nucleic acid encoding a polypeptide which is a polypeptide that restores or enhances function of an optic nerve or retinal cell; and (b) a pharmaceutically acceptable carrier; and

(B) a second drug, the second drug being mejole.

In another preferred embodiment, said restoring or enhancing optic nerve or retinal cell function comprises treating or ameliorating optic nerve or retinal (cell) disorders, and/or restoring or enhancing vision in a subject.

In another preferred embodiment, the retinal cell is a photoreceptor (including cone and/or rod cells), retinal ganglion cell, muller cell, bipolar cell, amacrine cell, horizontal cell, or retinal pigment epithelial cell.

In another preferred embodiment, the polypeptide is a polypeptide that restores or enhances optic nerve function, preferably a polypeptide that treats or ameliorates optic neuropathy, more preferably a polypeptide that treats or ameliorates Leber hereditary optic neuropathy.

In another preferred embodiment, the polypeptide is selected from the group consisting of: ND1, ND4, ND6, or a combination thereof. Preferably, the polypeptide is ND 4.

In another preferred embodiment, the coding sequence of ND4 is shown in SEQ ID NO. 7.

In another preferred embodiment, the content of the recombinant adeno-associated virus is 1 × 10⁷vg/0.05ml-1×10¹⁴vg/0.05ml, preferably 1X 10⁹vg/0.05ml-1×10¹²vg/0.05ml, more preferably 1X 10¹⁰vg/0.05ml-1×10¹¹vg/0.05ml。

In another preferred embodiment, the recombinant adeno-associated virus further comprises a sequence encoding a mitochondrial targeting peptide.

In another preferred embodiment, the coding sequence of the mitochondrial targeting peptide comprises: the coding sequence of COX8 (including optimized or unoptimized), COX10, OPA1, or a combination thereof.

In another preferred example, the coding sequence of COX8 has the sequence shown in SEQ ID No. 1.

In another preferred example, the coding sequence of optimized COX10 has the sequence shown in SEQ ID No. 2.

In another preferred example, the non-optimized COX10 coding sequence has the sequence shown in SEQ ID No. 3.

In another preferred embodiment, the coding sequence of OPA1 has the sequence shown in SEQ ID NO. 4.

In another preferred embodiment, the recombinant adeno-associated virus comprises a fusion nucleic acid having the structure of formula I from 5 'to 3':

Z0-Z1-Z2-Z3 (I)

in the formula (I), the compound is shown in the specification,

each "-" is independently a bond or a nucleotide linking sequence;

z0 is nothing, or a 5' -UTR sequence;

z1 is the coding sequence of a mitochondrial targeting peptide;

z2 is a coding sequence for the polypeptide (i.e., an exogenous nucleic acid encoding the polypeptide); and

z3 is a 3' -UTR sequence.

In another preferred embodiment, each nucleotide linker sequence is 0 to 21nt, preferably 3 to 12nt in length.

In another preferred embodiment, the coding sequence of the mitochondrial targeting peptide is the coding sequence of optimized COX 10.

In another preferred embodiment, the fused nucleic acid has a structure of COX10-ND4-UTR from the 5 '-3' end.

In another preferred embodiment, the fusion nucleic acid sequence is as set forth in SEQ ID No. 5 or 6.

In another preferred embodiment, in the fusion nucleic acid having the sequence shown in SEQ ID No. 5 or 6,

the coding sequence of COX10 at positions 1-84;

the 85-1464 th position is nucleotide sequence for coding human NADH dehydrogenase subunit 4 protein;

the 1465-2889 th site is a 3' -UTR sequence.

In another preferred embodiment, the serotype of the recombinant adeno-associated virus is selected from the group consisting of: AAV2, AAV5, AAV7, AAV8, or a combination thereof; preferably AAV 2.

In another preferred embodiment, the dosage form of the first drug is selected from the group consisting of: a lyophilized formulation, a liquid formulation, or a combination thereof. Preferably, the dosage form of the first medicament is an injection dosage form.

In another preferred embodiment, the mode of administration of the second medicament comprises: intravenously, subcutaneously, orally, or a combination thereof. Preferably, the dosage form of the second medicament is preferably an oral formulation.

In another preferred embodiment, the pharmaceutical combination further comprises: (C) a third medicament, the third medicament comprising: creatine phosphate sodium, methylprednisolone, or a combination thereof.

In another preferred embodiment, the pharmaceutical combination comprises:

(A) a first medicament comprising (a) a therapeutically effective amount of a first active ingredient, and (b) a pharmaceutically acceptable carrier;

(B) a prophylactically and/or therapeutically effective amount of a second agent.

In another preferred embodiment, the pharmaceutical combination is used for restoring vision or treating an ocular disease in a subject.

In another preferred embodiment, the first drug and the second drug in the drug combination are each independently.

In a second aspect of the invention, there is provided a kit comprising:

(A) a first agent that is a recombinant adeno-associated virus comprising an exogenous nucleic acid encoding a polypeptide that is a polypeptide that restores or enhances function of an optic nerve or retinal cell; and

(B) a second formulation which is alterole.

In another preferred embodiment, the kit further comprises a label or instructions indicating the following: administering a second formulation to a subject in need thereof before and/or after administration of the first formulation.

In another preferred embodiment, the first formulation and the second formulation are each independent.

In another preferred embodiment, the dosage form of the first formulation is selected from the group consisting of: a lyophilized formulation, a liquid formulation, or a combination thereof. Preferably, the dosage form of the pharmaceutical preparation is injection dosage form.

In another preferred embodiment, the mode of administration of the second formulation comprises: intravenously, subcutaneously, orally, or a combination thereof. Preferably, the dosage form of the second formulation is preferably an oral formulation.

In a third aspect of the invention, there is provided the use of a pharmaceutical combination according to the first aspect of the invention for the manufacture of a medicament or formulation for restoring or improving vision and/or treating an ocular disease in a subject.

In another preferred embodiment, said restoring or enhancing vision in the subject comprises restoring or enhancing optic nerve or retinal cell function.

In another preferred embodiment, the ocular disease is optic neuropathy, glaucoma, retinitis pigmentosa, macular degeneration, retinoschisis, leber's congenital amaurosis, diabetic retinopathy, achromatopsia or achromatopsia, degenerative diseases of the retina, or combinations thereof.

In another preferred embodiment, the ocular disease is optic neuropathy.

In another preferred embodiment, the formulation or composition is for use in the treatment of an optic neuropathy, preferably an inherited optic neuropathy, preferably Leber inherited optic neuropathy (LHON).

In another preferred embodiment, the formulation or composition is used to augment or restore photoreceptor function to the retina, restore vision (or light sensitivity) in a subject, and/or treat a degenerative disease of the retina.

In another preferred embodiment, the degenerative disease of the retina is selected from the group consisting of: retinal dystrophy (such as rod dystrophy, cone dystrophy, or macular dystrophy), retinal or macular degeneration, retinitis pigmentosa, other diseases, or combinations thereof.

In a fourth aspect of the invention, there is provided a method of treating an ocular disorder, the method comprising the steps of: administering to a subject in need thereof a pharmaceutical combination according to the first aspect of the invention or a kit according to the second aspect of the invention.

In another preferred embodiment, the pharmaceutical combination or the kit is administered before, simultaneously with and/or after the administration of a further active substance for the treatment of an ocular disease.

In a fifth aspect of the invention, there is provided a method of treatment comprising the steps of:

administering alterole to a subject in need thereof prior to, concurrently with, and/or after intraocular administration of a recombinant adeno-associated virus to the subject.

In another preferred example, the recombinant adeno-associated virus is a recombinant adeno-associated virus having the function of restoring or improving the vision of a subject and/or treating an ocular disease.

In another preferred embodiment, the recombinant adeno-associated virus comprises an exogenous nucleic acid encoding a polypeptide that restores or enhances function of an optic nerve or retinal cell.

In another preferred example, the administration mode of mellita comprises: intravenously, subcutaneously, orally, or a combination thereof. Preferably, the administration mode of the meprobamate is oral administration.

In another preferred embodiment, the treatment method comprises the steps of:

(1) a pre-operative pre-treatment comprising administering meprobamate to a subject in need thereof;

(2) administering a recombinant adeno-associated virus to the eye of the subject, the recombinant adeno-associated virus comprising an exogenous nucleic acid encoding a polypeptide that restores or enhances function of an optic nerve or retinal cell; and

(3) a post-operative treatment comprising administering alterole to the subject.

In another preferred embodiment, the subject is a human or non-human mammal.

In another preferred example, the mode of administration of melbine in the pre-operative pretreatment is oral administration.

In another preferred embodiment, in step (1), the amount of mejole administered is 28-36mg/60kg body weight per time, preferably 30-34mg/60kg body weight per time.

In another preferred example, in step (1), the interval of administration of altrexone is at least once every three days, preferably at least once every two days, more preferably at least once a day.

In another preferred example, in step (1), the melbine is administered at least 1 time, preferably not less than 3 times, preferably not less than 5 times, more preferably not less than 7 times.

In another preferred example, in step (1), the melphalan is administered for a period of at least 3 days, preferably not less than 5 days, preferably not less than one week.

In another preferred embodiment, the preoperative pretreatment comprises:

administering to a subject in need thereof, meluole once daily at an interval of 30-34mg/60kg body weight per administration for at least one week.

In another preferred example, in step (1), the pre-operative pre-treatment further comprises topical (ocular) administration of an antibiotic eye drops and/or eye ointment one day before the operation.

In another preferred example, in step (2), the recombinant adeno-associated virus is administered by intraocular administration, preferably by subretinal, direct retinal, suprachoroidal or intravitreal injection.

In another preferred embodiment, the recombinant adeno-associated virus is administered by intravitreal injection.

In another preferred embodiment, the administration of the recombinant adeno-associated virus is a single ocular injection or a double ocular injection.

In another preferred embodiment, the recombinant adeno-associated virus is administered in an amount of 1 × 10⁷vg/0.05ml-1×10¹⁴vg/0.05ml, preferably 1X 10⁹vg/0.05ml-1×10¹²vg/0.05ml, more preferably 1X 10¹⁰vg/0.05ml-1×10¹¹vg/0.05ml。

In another preferred example, in step (3), the post-operation treatment further includes: administering creatine phosphate sodium and/or methylprednisolone to the subject prior to administration of mezzolane.

In another preferred example, the administration mode of the creatine phosphate sodium and/or methylprednisolone comprises: intravenously, subcutaneously, orally, or a combination thereof. Preferably, the creatine phosphate sodium and/or methylprednisolone is administered intravenously.

In another preferred embodiment, the recombinant adeno-associated virus is administered first, followed by creatine phosphate sodium; the (first) administration interval of the recombinant adeno-associated virus and the creatine phosphate sodium is at most 24h, preferably 4-20h, more preferably 6-18h, more preferably 10-14 h.

In another preferred embodiment, the amount of creatine phosphate sodium administered is 1.5-2.5g/60kg body weight per time, preferably 1.8-2.2g/60kg body weight per time.

In another preferred embodiment, the administration interval of creatine phosphate sodium is at least once every two days, preferably at least once daily.

In another preferred embodiment, the creatine phosphate sodium is administered at least 1 time, preferably no less than 2 times.

In another preferred embodiment, the creatine phosphate sodium is administered for a period of at least 1 day, preferably 2-4 days.

In another preferred embodiment, the recombinant adeno-associated virus is administered first, followed by methylprednisolone; the (first) administration interval of the recombinant adeno-associated virus and the methylprednisolone is at most 24h, preferably 4-20h, more preferably 6-18h, more preferably 10-14 h.

In another preferred embodiment, the amount of methylprednisolone administered is 70-90mg/60kg body weight each time, preferably 75-85mg/60kg body weight each time, preferably 78-82mg/60kg body weight each time.

In another preferred embodiment, the interval between applications of methylprednisolone is at least once every two days, preferably at least once a day.

In another preferred embodiment, the methylprednisolone is applied at least 1 time, preferably not less than 2 times.

In another preferred embodiment, the methylprednisolone is applied for at least 1 day, preferably 2-4 days.

In another preferred embodiment, in step (3), within one week of administering the recombinant adeno-associated virus, the amount of melbine administered is 28-36mg/60kg body weight per administration, preferably 30-34mg/60kg body weight per administration.

In another preferred embodiment, in step (3), the amount of mellita administered is decreased by a weekly increment of 1-10mg/60kg body weight, preferably 2-8mg/60kg body weight.

In another preferred example, in step (3), the administration interval of melphalan is at least once every three days, preferably at least once every two days, more preferably at least once a day.

In another preferred example, in step (3), the meldol is administered for at least 2 weeks, preferably 3 weeks to 10 weeks, more preferably 4 weeks to 7 weeks.

In another preferred example, in step (3), the mode of administration of melphalan is oral administration.

In another preferred example, in the step (3), the post-operation treatment includes:

administering creatine phosphate sodium and methylprednisolone to a subject in need thereof on days 0 (the same day) to 2 of administration of the recombinant adeno-associated virus, wherein administration intervals of the creatine phosphate sodium are once a day and 3 days, wherein administration amount of the creatine phosphate sodium is 1.8-2.2g/60kg body weight each time, and administration amount of the methylprednisolone is 78-82mg/60kg body weight each time;

on day 3 of administration of the recombinant adeno-associated virus, mezepine is administered in an amount of 30-34mg/60kg body weight each time, with the amount decreasing weekly by an amount of 2-8mg/60kg body weight once daily, preferably for at least 4 weeks.

In a sixth aspect of the invention, there is provided the use of melbine in the preparation of a formulation or composition for reducing side effects or complications of intraocular administration of a recombinant adeno-associated virus.

In another preferred embodiment, the side effects or complications include: cataract extraction, uveitis, vitritis, keratitis, anterior chamber inflammation, vitreous hemorrhage, ophthalmalgia, allergic conjunctivitis, ocular hypertension, or combinations thereof.

In another preferred embodiment, the formulation or composition is also used to enhance the therapeutic effect of the recombinant adeno-associated virus.

In another preferred embodiment, the therapeutic effect is an effect of improving or restoring vision and/or treating an ocular disease in a subject.

In another preferred embodiment, the therapeutic effect is an effect of treating an ocular disease selected from the group consisting of:

optic neuropathy, glaucoma, retinitis pigmentosa, macular degeneration, retinoschisis, leber's congenital amaurosis, diabetic retinopathy, achromatopsia or achromatopsia, degenerative diseases of the retina, or combinations thereof.

It is to be understood that within the scope of the present invention, the above-described features of the present invention and those specifically described below (e.g., in the examples) may be combined with each other to form new or preferred embodiments. Not to be reiterated herein, but to the extent of space.

Drawings

FIG. 1 shows the functional representation of the entry of ND4 fusion protein with the MTS sequence into mitochondria.

Detailed Description

The present inventors have conducted extensive and intensive studies and have unexpectedly found that the administration of mellea before and/or after gene therapy (i.e., the administration of the recombinant adeno-associated virus according to the present invention) not only significantly improves the therapeutic effect, but also effectively prevents and/or treats complications of gene therapy, such as selective cataract extraction, uveitis, anterior chamber inflammation, and vitritis. On the basis of this, the present invention has been completed.

After sufficient theoretical preparation is made in the early stage, the inventor does a lot of work in the foundation and clinic from 2008, from the construction of the gene therapy vector to the exploration of safety detection and evaluation, and from a lot of animal experiments to clinical trials, the invention strictly proves the safety of the gene therapy LHON in a plurality of aspects.

The inventor carries out random multi-center clinical research according to related national regulations, clinical trials pass examination and approval of ethical committees, and the inventor signs an informed consent with patients, treats LHON patients with genes, carries out safety inspection regularly, can recover by self except a small amount of ocular hypertension, has no any serious complications, and has high safety. This study confirmed that the gene therapy of this research team was safe and effective.

The gene therapy adopts ectopic expression technology, as shown in figure 1, namely, exogenous nucleic acid (such as ND4 gene) is brought to cells by adeno-associated virus to express normal protein, and the small peptide chain anchored in the front can guide target protein to enter mitochondria, replace defective protein caused by gene mutation and play normal physiological function. The research is at the forefront of the global ophthalmologic gene therapy field and is a leading technology in the world.

Term(s) for

In order that the disclosure may be more readily understood, certain terms are first defined. As used in this application, each of the following terms shall have the meaning given below, unless explicitly specified otherwise herein. Other definitions are set forth throughout the application.

The term "about" can refer to a value or composition that is within an acceptable error range for the particular value or composition as determined by one of ordinary skill in the art, which will depend in part on how the value or composition is measured or determined.

As used herein, the term "comprising" or "includes" can be open, semi-closed, and closed. In other words, the term also includes "consisting essentially of …," or "consisting of ….

The term "administering" or "administering" refers to the physical introduction of the product of the invention into a subject using any of a variety of methods and delivery systems known to those skilled in the art, including intravenous, intramuscular, subcutaneous, intraperitoneal, spinal or other parenteral routes of administration, e.g., by injection or infusion.

"preoperative" refers to prior to administration of a recombinant adeno-associated virus of the invention.

"post-operative" means after administration of the recombinant adeno-associated virus of the invention.

Meluole (Methylprednisolone tablets)

The main component of the medrolone is methylprednisolone, the chemical name of which is 11 β,17, 21-trihydroxy-6 α -methyl pregna-1, 4-diene-3, 20-diketone, the molecular formula of which is C₂₂H₃₀O₅Molecular weight: 374.48. the structural formula is shown as formula II:

through a large number of researches and clinical experiments, the invention discovers that the mezzolan not only can improve the treatment effect of the recombinant adeno-associated virus, but also can effectively prevent and/or treat complications of gene therapy, such as cataract extraction, uveitis, anterior chamber inflammation, vitritis, keratitis, vitreous hemorrhage, ophthalmalgia, allergic conjunctivitis, ocular hypertension and the like.

Recombinant adeno-associated virus

In the invention, the recombinant adeno-associated virus can restore or improve the vision of a subject and/or treat eye diseases. In one embodiment of the present invention, the recombinant adeno-associated virus according to the first aspect of the present invention comprises an exogenous nucleic acid encoding a polypeptide that restores or enhances function of an optic nerve or retinal cell.

In another preferred embodiment, the restoring or enhancing optic nerve or retinal cell function comprises treating or ameliorating optic nerve or retinal (cell) disorders, restoring or enhancing vision in a subject.

In another preferred embodiment, the polypeptide may also be a neuroprotective factor, an anti-angiogenic polypeptide, an anti-apoptotic factor or a polypeptide that enhances retinal cell function. For example, glial derived neurotrophic factor, fibroblast growth factor 2, neurotrophic factor, ciliary neurotrophic factor, nerve growth factor, brain derived neurotrophic factor, epidermal growth factor, rhodopsin, X-linked apoptosis inhibitor protein, retinoschisin, RPE65, retinitis pigmentosa gtpase interacting protein-1, peripherin-2, rhodopsin, or sonic hedgehog.

In another preferred example, the coding sequence (87bp) of COX8 is shown in SEQ ID No. 1.

ATGTCCGTCCTGACGCGCCTGCTGCTGCGGGGCTTGACACGGCTCGGCTCGGCGGCTCCAGTGCGGCGCGCCAGAATCCATTCGTTG(SEQ ID NO.:1)

In another preferred example, the coding sequence (84bp) of the non-optimized COX10 is shown in SEQ ID No. 3.

ATGGCCGCATCTCCGCACACTCTCTCCTCACGCCTCCTGACAGGTTGCGTAGGAGGCTCTGTCTGGTATCTTGAAAGAAGAACT(SEQ ID NO.:3)

In another preferred embodiment, the coding sequence (266bp) of OPA1 is shown in SEQ ID No. 4.

GTGCTGCCCGCCTAGAAAGGGTGAAGTGGTTGTTTCCGTGACGGACTGAGTACGGGTGCCTGTCAGGCTCTTGCGGAAGTCCATGCGCCATTGGGAGGGCCTCGGCCGCGGCTCTGTGCCCTTGCTGCTGAGGGCCACTTCCTGGGTCATTCCTGGACCGGGAGCCGGGCTGGGGCTCACACGGGGGCTCCCGCGTGGCCGTCTCGGCGCCTGCGTGACCTCCCCGCCGGCGGGATGTGGCGACTACGTCGGGCCGCTGTGGCCTG(SEQ ID NO.:4)

In another preferred embodiment, the coding sequence (84bp) of optimized COX10 is shown in SEQ ID NO. 2. Compared with the coding sequence of non-optimized COX10 and other mitochondrial targeting peptide coding sequences, the coding sequence of optimized COX10 is not only shorter, but also more accurately located, and more of the target protein is transported into mitochondria.

ATGGCCGCCTCTCCACACACACTGAGTAGCAGACTGCTGACCGGCTGTGTTGGCGGCTCTGTGTGGTATCTGGAACGGCGGACA(SEQ ID NO.:2)

In another preferred embodiment, the recombinant adeno-associated virus comprises a fusion nucleic acid having a structure according to formula I from 5 'to 3':

Z0-Z1-Z2-Z3 (I)

wherein each "-" is independently a bond or a nucleotide linking sequence;

z0 is nothing, or a 5' -UTR sequence;

z1 is the coding sequence of a mitochondrial targeting peptide;

z3 is a 3' -UTR sequence.

In another preferred example, in the fusion nucleic acid shown in SEQ ID NO. 5, the position from 1bp to 84bp is optimized COX10 sequence (total 84 bp); the position from 85bp to 1464bp is optimized ND4 gene, namely the nucleic acid (1380 bp in total) for coding the human NADH dehydrogenase subunit 4 protein, and the position from 1465bp to 2889bp is UTR sequence (1425 bp in total, also called 3' UTR). COX10 sequence guides ND4 protein to enter mitochondria to play its physiological function; the 3' UTR is a non-coding sequence designed to be behind the ND4 protein and serves to stabilize mitochondrial targeting sequences and expression of ND 4.

ATGGCCGCATCTCCGCACACTCTCTCCTCACGCCTCCTGACAGGTTGCGTAGGAGGCTCTGTCTGGTATCTTGAAAGAAGAACTATGCTAAAACTAATCGTCCCAACAATTATGTTACTACCACTGACATGGCTTTCCAAAAAACACATGATTTGGATCAACACAACCACCCACAGCCTAATTATTAGCATCATCCCTCTACTATTTTTTAACCAAATCAACAACAACCTATTTAGCTGTTCCCCAACCTTTTCCTCCGACCCCCTAACAACCCCCCTCCTAATGCTAACTACCTGGCTCCTACCCCTCACAATCATGGCAAGCCAACGCCACTTATCCAGTGAACCACTATCACGAAAAAAACTCTACCTCTCTATGCTAATCTCCCTACAAATCTCCTTAATTATGACATTCACAGCCACAGAACTAATCATGTTTTATATCTTCTTCGAAACCACACTTATCCCCACCTTGGCTATCATCACCCGATGGGGCAACCAGCCAGAACGCCTGAACGCAGGCACATACTTCCTATTCTACACCCTAGTAGGCTCCCTTCCCCTACTCATCGCACTAATTTACACTCACAACACCCTAGGCTCACTAAACATTCTACTACTCACTCTCACTGCCCAAGAACTATCAAACTCCTGGGCCAACAACTTAATGTGGCTAGCTTACACAATGGCTTTTATGGTAAAGATGCCTCTTTACGGACTCCACTTATGGCTCCCTAAAGCCCATGTCGAAGCCCCCATCGCTGGGTCAATGGTACTTGCCGCAGTACTCTTAAAACTAGGCGGCTATGGTATGATGCGCCTCACACTCATTCTCAACCCCCTGACAAA ACACATGGCCTACCCCTTCCTTGTACTATCCCTATGGGGCATGATTATGACAAGCTCCATCTGCCTACGACAAACAGACCTAAAATCGCTCATTGCATACTCTTCAATCAGCCACATGGCCCTCGTAGTAACAGCCATTCTCATCCAAACCCCCTGGAGCTTCACCGGCGCAGTCATTCTCATGATCGCCCACGGGCTTACATCCTCATTACTATTCTGCCTAGCAAACTCAAACTACGAACGCACTCACAGTCGCATCATGATCCTCTCTCAAGGACTTCAAACTCTACTCCCACTAATGGCTTTTTGGTGGCTTCTAGCAAGCCTCGCTAACCTCGCCTTACCCCCCACTATTAACCTACTGGGAGAACTCTCTGTGCTAGTAACCACGTTCTCCTGGTCAAATATCACTCTCCTACTTACAGGACTCAACATGCTAGTCACAGCCCTATACTCCCTCTACATGTTTACCACAACACAATGGGGCTCACTCACCCACCACATTAACAACATGAAACCCTCATTCACACGAGAAAACACCCTCATGTTCATGCACCTATCCCCCATTCTCCTCCTATCCCTCAACCCCGACATCATTACCGGGTTTTCCTCTTAAGAGCACTGGGACGCCCACCGCCCCTTTCCCTCCGCTGCCAGGCGAGCATGTTGTGGTAATTCTGGAACACAAGAAGAGAAATTGCTGGGTTTAGAACAAGATTATAAACGAATTCGGTGCTCAGTGATCACTTGACAGTTTTTTTTTTTTTTAAATATTACCCAAAATGCTCCCCAAATAAGAAATGCATCAGCTCAGTCAGTGAATACAAAAAAGGAATTATTTTTCCCTTTGAGGGTCTTTTATACATCTCTCCTCCAACCCCACCCTCTATTCTGTTTCTTCCTCCTCACATGGGGGTACACATACACAGCTTCCTCTTTTGGTTCCATCCTTACCACCACACCACACGCACACTCCACATGCCCAGCAGAGTGGCACTTGGTGGCCAGAAAGTGTGAGCCTCATGATCTGCTGTCTGTAGTTCTGTGAGCTCAGGTCCCTCAAAGGCCTCGGAGCACCCCCTTCCTTGTGACTGAGCCAGGGCCTGCATTTTTGGTTTTCCCCACCCCACACATTCTCAACCATAGTCCTTCTAACAATACCAATAGCTAGGACCCGGCTGCTGTGCACTGGGACTGGGGATTCCACATGTTTGCCTTGGGAGTCTCAAGCTGGACTGCCAGCCCCTGTCCTCCCTTCACCCCCATTGCGTATGAGCATTTCAGAACTCCAAGGAGTCACAGGCATCTTTATAGTTCACGTTAACATATAGACACTGTTGGAAGCAGTTCCTTCTAAAAGGGTAGCCCTGGACTTAATACCAGCCGGATACCTCTGGCCCCCACCCCATTACTGTACCTCTGGAGTCACTACTGTGGGTCGCCACTCCTCTGCTACACAGCACGGCTTTTTCAAGGCTGTATTGAGAAGGGAAGTTAGGAAGAAGGGTGTGCTGGGCTAACCAGCCCACAGAGCTCACATTCCTGTCCCTTGGGTGAAAAATACATGTCCATCCTGATATCTCCTGAATTCAGAAATTAGCCTCCACATGTGCAATGGCTTTAAGAGCCAGAAGCAGGGTTCTGGGAATTTTGCAAGTTACCTGTGGCCAGGTGTGGTCTCGGTTACCAAATACGGTTACCTGCAGCTTTTTAGTCCTTTGTGCTCCCACGGGTCTACAGAGTCCCATCTGCCCAAAGGTCTTGAAGCTTGACAGGATGTTTTCGATTACTCAGTCTCCCAGGGCACTACTGGTCCGTAGGATTCGATTGGTCGGGGTAGGAGAGTTAAACAACATTTAAACAGAGTTCTCTCAAAAATGTCTAAAGGGATTGTAGGTAGATAACATCCAATCACTGTTTGCACTTATCTGAAATCTTCCCTCTTGGCTGCCCCCAGGTATTTACTGTGGAGAACATTGCATAGGAATGTCTGGAAAAAGCTTCTACAACTTGTTACAGCCTTCACATTTGTAGAAGCTTT(SEQ ID NO.:5)

In another preferred example, in the fusion nucleic acid with the sequence shown in SEQ ID NO. 6, the position from 1bp to 84bp is the non-optimized COX10 sequence (total 84 bp); the position from 85bp to 1464bp is an unoptimized ND4 gene, namely the nucleic acid (1380 bp in total) for coding the human NADH dehydrogenase subunit 4 protein, and the position from 1465bp to 2889bp is an UTR sequence (1425 bp in total, also called 3' UTR). COX10 sequence guides ND4 protein to enter mitochondria to play its physiological function; the 3' UTR is a non-coding sequence designed to be behind the ND4 protein and serves to stabilize mitochondrial targeting sequences and expression of ND 4.

ATGGCCGCCTCTCCACACACACTGAGTAGCAGACTGCTGACCGGCTGTGTTGGCGGCTCTGTGTGGTATCTGGAACGGCGGACAATGCTGAAGCTGATCGTGCCCACCATCATGCTGCTGCCTCTGACCTGGCTGAGCAAGAAACACATGATCTGGATCAACACCACCACGCACAGCCTGATCATCAGCATCATCCCTCTGCTGTTCTTCAACCAGATCAACAACAACCTGTTCAGCTGCAGCCCCACCTTCAGCAGCGACCCTCTGACAACACCTCTGCTGATGCTGACCACCTGGCTGCTGCCCCTCACAATCATGGCCTCTCAGAGACACCTGAGCAGCGAGCCCCTGAGCCGGAAGAAACTGTACCTGAGCATGCTGATCTCCCTGCAGATCTCTCTGATCATGACCTTCACCGCCACCGAGCTGATCATGTTCTACATCTTTTTCGAGACAACGCTGATCCCCACACTGGCCATCATCACCAGATGGGGCAACCAGCCTGAGAGACTGAACGCCGGCACCTACTTTCTGTTCTACACCCTCGTGGGCAGCCTGCCACTGCTGATTGCCCTGATCTACACCCACAACACCCTGGGCTCCCTGAACATCCTGCTGCTGACACTGACAGCCCAAGAGCTGAGCAACAGCTGGGCCAACAATCTGATGTGGCTGGCCTACACAATGGCCTTCATGGTCAAGATGCCCCTGTACGGCCTGCACCTGTGGCTGCCTAAAGCTCATGTGGAAGCCCCTATCGCCGGCTCTATGGTGCTGGCTGCAGTGCTGCTGAAACTCGGCGGCTACGGCATGATGCGGCTGACCCTGATTCTGAATCCCCTGACCAAGCACATGGCCTATCCATTTCTGGTGCTGAGCCTGTGGGGCATGATTATGACCAGCAGCATCTGCCTGCGGCAGACCGATCTGAAGTCCCTGATCGCCTACAGCTCCATCAGCCACATGGCCCTGGTGGTCACCGCCATCCTGATTCAGACCCCTTGGAGCTTTACAGGCGCCGTGATCCTGATGATTGCCCACGGCCTGACAAGCAGCCTGCTGTTTTGTCTGGCCAACAGCAACTACGAGCGGACCCACAGCAGAATCATGATCCTGTCTCAGGGCCTGCAGACCCTCCTGCCTCTTATGGCTTTTTGGTGGCTGCTGGCCTCTCTGGCCAATCTGGCACTGCCTCCTACCATCAATCTGCTGGGCGAGCTGAGCGTGCTGGTCACCACATTCAGCTGGTCCAATATCACCCTGCTGCTCACCGGCCTGAACATGCTGGTTACAGCCCTGTACTCCCTGTACATGTTCACCACCACACAGTGGGGAAGCCTGACACACCACATCAACAATATGAAGCCCAGCTTCACCCGCGAGAACACCCTGATGTTCATGCATCTGAGCCCCATTCTGCTGCTGTCCCTGAATCCTGATATCATCACCGGCTTCTCCAGCTGAGAGCACTGGGACGCCCACCGCCCCTTTCCCTCCGCTGCCAGGCGAGCATGTTGTGGTAATTCTGGAACACAAGAAGAGAAATTGCTGGGTTTAGAACAAGATTATAAACGAATTCGGTGCTCAGTGATCACTTGACAGTTTTTTTTTTTTTTAAATATTACCCAAAATGCTCCCCAAATAAGAAATGCATCAGCTCAGTCAGTGAATACAAAAAAGGAATTATTTTTCCCTTTGAGGGTCTTTTATACATCTCTCCTCCAACCCCACCCTCTATTCTGTTTCTTCCTCCTCACATGGGGGTACACATACACAGCTTCCTCTTTTGGTTCCATCCTTACCACCACACCACACGCACACTCCACATGCCCAGCAGAGTGGCACTTGGTGGCCAGAAAGTGTGAGCCTCATGATCTGCTGTCTGTAGTTCTGTGAGCTCAGGTCCCTCAAAGGCCTCGGAGCACCCCCTTCCTTGTGACTGAGCCAGGGCCTGCATTTTTGGTTTTCCCCACCCCACACATTCTCAACCATAGTCCTTCTAACAATACCAATAGCTAGGACCCGGCTGCTGTGCACTGGGACTGGGGATTCCACATGTTTGCCTTGGGAGTCTCAAGCTGGACTGCCAGCCCCTGTCCTCCCTTCACCCCCATTGCGTATGAGCATTTCAGAACTCCAAGGAGTCACAGGCATCTTTATAGTTCACGTTAACATATAGACACTGTTGGAAGCAGTTCCTTCTAAAAGGGTAGCCCTGGACTTAATACCAGCCGGATACCTCTGGCCCCCACCCCATTACTGTACCTCTGGAGTCACTACTGTGGGTCGCCACTCCTCTGCTACACAGCACGGCTTTTTCAAGGCTGTATTGAGAAGGGAAGTTAGGAAGAAGGGTGTGCTGGGCTAACCAGCCCACAGAGCTCACATTCCTGTCCCTTGGGTGAAAAATACATGTCCATCCTGATATCTCCTGAATTCAGAAATTAGCCTCCACATGTGCAATGGCTTTAAGAGCCAGAA GCAGGGTTCTGGGAATTTTGCAAGTTACCTGTGGCCAGGTGTGGTCTCGGTTACCAAATACGGTTACCTGCAGCTTTTTAGTCCTTTGTGCTCCCACGGGTCTACAGAGTCCCATCTGCCCAAAGGTCTTGAAGCTTGACAGGATGTTTTCGATTACTCAGTCTCCCAGGGCACTACTGGTCCGTAGGATTCGATTGGTCGGGGTAGGAGAGTTAAACAACATTTAAACAGAGTTCTCTCAAAAATGTCTAAAGGGATTGTAGGTAGATAACATCCAATCACTGTTTGCACTTATCTGAAATCTTCCCTCTTGGCTGCCCCCAGGTATTTACTGTGGAGAACATTGCATAGGAATGTCTGGAAAAAGCTTCTACAACTTGTTACAGCCTTCACATTTGTAGAAGCTTT(SEQ ID NO.:6)

The invention relates to a drug combination, a drug box, application and a drug administration mode thereof

The pharmaceutical combination of the present invention as described in the first aspect of the present invention comprises:

(B) a second drug, the second drug being mejole.

According to a second aspect of the invention, a kit of the invention comprises:

(B) a second formulation which is alterole.

The composition may further include a pharmaceutically acceptable carrier, if necessary. As used herein, the term "pharmaceutically acceptable" ingredient refers to a substance that is suitable for use in humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response), i.e., at a reasonable benefit/risk ratio.

As used herein, the term "effective amount" refers to an amount that produces a function or activity in and is acceptable to humans and/or animals.

As used herein, the term "prophylactically and/or therapeutically effective amount" refers to an amount that produces a prophylactic effect and/or therapeutic function or activity on a human and/or animal and is acceptable to a human and/or animal.

As used herein, the term "pharmaceutically acceptable carrier" refers to a carrier for administration of a therapeutic agent, including various excipients and diluents. The term refers to such pharmaceutical carriers: they are not essential active ingredients per se and are not unduly toxic after administration. Suitable carriers are well known to those of ordinary skill in the art.

So that when administering the pharmaceutical combination or kit of the invention, a safe and effective amount of the composition, combination of active ingredients or pharmaceutical composition of the invention is administered to the mammal. The specific dosage will also take into account factors such as the route of administration, the health of the patient, etc., which are within the skill of the skilled practitioner. The first drug (or first formulation) and the first drug (or first formulation) in the pharmaceutical combination and kit of the present invention are administered simultaneously or sequentially by different routes, respectively, including but not limited to: oral administration, injection administration, intratumoral administration, implantation administration, intracavity administration, anal administration, transdermal administration and internal and external application;

for the present invention, preferred dosage forms include: various dosage forms, implants and injections for oral administration.

For the first drug (or first formulation), the preferred mode of administration by injection is intraocular or intravitreal injection;

for the second drug (or second formulation), the preferred mode of administration is oral.

In a preferred embodiment of the present invention, restoring or enhancing the function of the optic nerve or retinal cell means restoring or enhancing the vision of the subject by restoring or enhancing the ability of the optic nerve or retinal cell to receive and transmit optical signals by treating or improving optic nerve or retinal (cell) disorders. Thus, the optic nerve or retina will have an increased ability to receive light signals and transmit such signals, the increase may be any amount, as compared to an optic nerve or retina that is not treated with a method as described herein.

As used herein, restoring vision in a subject means that the subject exhibits improved vision compared to prior to treatment, e.g., using a vision test as described herein. Recovery includes any degree of improvement, including complete restoration of vision to perfect or near perfect vision.

As used herein, treating an ocular disease means administering a recombinant adeno-associated virus as described herein to ameliorate or reduce one or more symptoms of a disease selected from the group consisting of: optic neuropathy, glaucoma, retinitis pigmentosa, macular degeneration, retinoschisis, leber's congenital amaurosis, diabetic retinopathy, achromatopsia or achromatopsia, degenerative diseases of the retina, or combinations thereof. The improvement or reduction can result in an improvement in peripheral or central vision, and/or daytime or nighttime vision.

Compared with the prior art, the invention has the main advantages that:

compared with the prior art, the invention greatly improves the effectiveness and safety, especially the safety, of the gene therapy of eye diseases (such as Leber diseases), and effectively reduces the complications (such as uveitis and the like) of the gene therapy of the eye diseases. The improvement of the safety of the gene therapy Leber disease by the method is a great breakthrough in the field of gene therapy.

The features mentioned above with reference to the invention, or the features mentioned with reference to the embodiments, can be combined arbitrarily. All the features disclosed in this specification may be combined in any combination, and each feature disclosed in this specification may be replaced by alternative features serving the same, equivalent or similar purpose. Thus, unless expressly stated otherwise, the features disclosed are merely generic examples of equivalent or similar features.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In addition, any methods and materials similar or equivalent to those described herein can be used in the methods of the present invention. The preferred embodiments and materials described herein are intended to be exemplary only.

Example 1 preparation of recombinant adeno-associated virus

The present invention is exemplified by recombinant adeno-associated virus carrying the ND4 coding sequence, but is not limited thereto.

The recombinant adeno-associated virus rAAV2/2-ND4 was prepared by the method described in example 1 with reference to CN 102634527B.

1.1 plasmid preparation: the fusion nucleic acid shown in SEQ ID No. 6 is synthesized by Chengdu Kangxi Biotechnology Limited. The full-length gene was amplified by PCR, a cohesive end was formed on the fusion gene by EcoRI/SalI cleavage, and the fusion gene was inserted into an adeno-associated virus vector pSNaV, pSNaV/rAAV2/2-ND4 (hereinafter abbreviated as pAAV2-ND4) having an EcoRI/SalI cleavage site. The screening and identification procedures of the recombinants are the same as CN102634527B, and are briefly described as follows: taking LB plate cultured at 37 ℃, and generating blue spots and white spots, wherein white is recombinant clone. White colonies were picked and added to LB liquid medium containing Amp at 100mg/L, and cultured at 37 ℃ and 200rpm for 8 hours. After the culture, the plasmid was extracted from the culture broth, and the plasmid was identified by digestion with EcoRI/SalI according to the Biomiga protocol.

1.2 cell transfection: the day before transfection, HEK293 cells were seeded at 225cm²In a cell culture flask, the inoculation density is 3.0 × 10⁷cells/mL, DMEM + 10% bovine serum in culture medium, 5% CO at 37 ℃₂Was cultured overnight in an incubator. The day of transfection, the medium was changed and the culture was continued in fresh DMEM medium containing 10% bovine serum. When the cells grew to 80-90%, the medium was discarded and pAAV2-ND4 was transfected using the plasmid Transs II (VGTC) transfection kit (see CN102634527B example 1 for specific transfection procedures). Cells were harvested 48h after transfection.

1.3 collection, concentration and purification of recombinant adeno-associated virus:

1.3.1 Collection of viruses: 1) preparing a dry ice ethanol bath (or liquid nitrogen) and a water bath at 37 ℃; 2) collecting the toxigenic cells and the culture medium into a 15ml centrifuge tube; 3)1000rpm/min, centrifugation for 3 minutes, separation of cells and supernatant, additional storage of supernatant, cells with 1ml PBS heavy suspension; 4) transferring the cell suspension in dry ice ethanol bath and 37 deg.C water bath repeatedly, freezing and thawing for four times, freezing and thawing for 10 min, and shaking slightly after each thawing.

1.3.2 concentration of virus: 1) centrifuging at 10,000g to remove cell debris, and transferring the centrifuged supernatant to a new centrifuge tube; 2) filtering with 0.45 μm filter to remove impurities; 3) adding 1/2 volumes of 1M NaCl and 10% PEG8000 solution, mixing, and standing overnight at 4 deg.C; 4) centrifuging at 12,000rpm for 2h, discarding the supernatant, dissolving the virus precipitate with appropriate amount of PBS solution, and filtering and sterilizing with 0.22 μm filter after completely dissolving; 5) residual plasmid DNA (final concentration of 50U/ml) was removed by digestion with Benzonase nuclease. Close the tube lid and invert several times to mix well. Incubation at 37 ℃ for 30 min; 6) filtering with 0.45 μm filter head to obtain filtrate, i.e. concentrated rAAV2 virus.

1.3.3 purification of Virus: 1) adding solid CsCl to the virus concentrate until the density is 1.41g/ml (refractive index 1.372); 2) adding the sample into an ultracentrifuge tube, and filling the residual space of the centrifuge tube with a pre-prepared 1.41g/ml CsCl solution; 3) centrifugation was carried out at 175,000g for 24 hours to form a density gradient. Samples of different densities were collected in sequential steps and sampled for titre determination. Collecting fractions enriched in rAAV2 particles; 4) the above process is repeated once. The virus was packed into 100kDa dialysis bags and desalted by dialysis at 4 ℃ overnight.

Thus, the concentrated and purified recombinant adeno-associated virus rAAV2-ND4 is obtained.

Example 2 Gene therapy LHON Pre-treatment, treatment and post-treatment, and efficacy profiles

Firstly, pre-treatment regulation:

1. research site

The research is a clinical test, and the gene diagnosis is completed in a hospital gene diagnosis center; the ophthalmic examination is completed by the same type of equipment in the ophthalmic examination room of the same-institution hospital; the whole body examination (part) is completed by appointed personnel and appointed equipment in the clinical laboratory; all procedures were performed in a laminar flow surgery suite dedicated to ophthalmology; the postoperative reexamination and follow-up visit are completed by special designated personnel and equipment of a team.

2. Design of clinical trials

The study employed a multicenter, prospective clinical trial. The subject met the Leber hereditary optic neuropathy diagnostic criteria:

2.1 patient admission Specification:

1. the person who is supposed to receive the LHON eye gene therapy needs to be diagnosed as the LHON patient through gene detection;

2. the person who is supposed to receive the LHON eye gene therapy needs to be observed for at least three months and has no obvious self-healing tendency;

3. people who are supposed to receive LHON eye gene therapy need to exclude other fatal disease history and past eye disease history;

4. for people who are supposed to receive LHON eye gene therapy, people who may have necessary drug allergy in the treatment process need to be excluded;

5. the person who is supposed to receive LHON eye gene therapy needs to receive a humoral immune response experiment, and the positive person is eliminated;

6. those who are to receive LHON ocular gene therapy need to sign Leber's consent for gene therapy and vitreous cavity injection consent.

2.2 perioperative period regulation:

1, medical care personnel who are planned to participate in LHON eye gene therapy activities need to fully establish trust relationship with a patient before an operation, know the thought dynamics of the patient in time and do psychological dispersion and appeasing work;

2, medical care personnel who are supposed to participate in LHON eye gene therapy activities need to take a high degree of responsibility and consanguinity to participate in the medical activities;

3, medical care personnel who are planned to participate in LHON eye gene therapy activities need to make disinfection of an operating room and medical supplies before an operation and prepare consumables in the operation;

4 during LHON eye gene therapy activity, medical care personnel need to strictly follow the operation grading system and the aseptic operation principle.

2.3 preoperative examination

1. Those who are intended to receive LHON ocular gene therapy sign Leber's informed consent for gene therapy;

2. the person who is supposed to receive LHON eye gene therapy makes a journey plan, and takes an identity card, a medical insurance card and complete previous medical history data;

3. and (3) whole body examination: blood analysis, urine analysis, liver and kidney function, blood coagulation function, infectious disease screening, immune complete set (cellular immunity: CD3, CD4, CD 8; humoral immunity: IgA, IgM, IgG); electrocardiogram, chest fluoroscopy;

4. eye special examination: vision, intraocular pressure, slit lamp examination and fundus examination; fundus photography, optic nerve OCT, visual field examination, VEP, and the series of examinations no less than three times in 6 months; photographing the anterior segment of the eye before operation;

5. humoral immune response: AAV2 humoral immune test;

6. the mutation site for gene detection is mtDNA 11778 point mutation.

2.4 Pre-operative pretreatment

1, determining a person who receives LHON ocular gene therapy, taking oral hormone (meluole) 7 days before an operation once a day, wherein the dose of each time is 32mg/60 kg;

2, humoral immune response: AAV2 humoral immune test, confirming that rAAV2 immunity is at low levels prior to patient administration;

3 applying antibiotic eye drops and eye ointments to wash conjunctival sac of lacrimal passage one day before operation.

2.5 intravitreal injection

1. A disinfection measure and operation consumable preparation are made in the laminar flow operation room;

2. performing routine disinfection before operation, paving a towel, performing facial and eye disinfection, and performing eye operation marking;

3. the gene medicine is kept by a special person. Before the medicines are taken, the information of patients is checked, the medicine package is determined to be complete and pollution-free, and the external medicine package is strictly disinfected; when the medicine is sucked, the operation is slowly and stably carried out, the medicine suction is finished at one time, repeated suction and touching of the bottle wall are avoided, and the medicine pollution is avoided; after the medicine is sucked, the injection is completed within half an hour. After injection, the drug package and the remaining drug were retained and stored at-20 ℃ for future reference. (Note: absolutely sterile operation is required in the drug extraction process, such as dropping the drug on the ground, or touching the contaminated area with the suction needle, the drug is discarded, and any drug with contamination risk cannot be injected into the vitreous cavity of the patient.)

4. The specific operating specification of the vitreous cavity injection is as follows: instruments, medicines and the like are fully prepared before injection, and the assistant is well done with routine vitreous cavity injection operations such as disinfection and drape. The gene medicine is taken out from the dry ice by an assistant, and is held tightly by the palm for 2-3min until the medicine is melted from solid to liquid, and the whole process is carried out aseptically. Then, the gauze is soaked in the iodophor for 2 times, and then the sterile bottle cap and the body are wiped dry by using dry gauze, wherein the gauze is clockwise, so that the opening of the bottle mouth is prevented, and the iodophor is prevented from permeating. After the sterilization, the bottle cap is opened, and the operator sucks the medicine with an insulin needle, and the volume is adjusted to 0.05 ml. The assistant prepares injection of eye anesthesia, disinfection, eyelid opening and the like at the same time, 0.5 percent povidone iodine washes the conjunctival sac for 3 times, and the vitreous cavity injection is carried out according to the vitreous cavity injection specification. Immediately after pulling out the needle, the injection site was pressed with a cotton swab and massaged for 10 seconds to prevent leakage of the drug.

5. After the medicine injection is finished, the antibiotic eye ointment is applied to the operated eye, the operated eye is covered by sterile gauze, and the patient returns to a ward after lying for 20 min; advising not to rub eyes;

6. after the injection, the gene medicine is recovered.

2.6 postoperative administration:

1, whole body medication: (1) creatine phosphate sodium ivdrip, 2g/60kg, Qd x 3d (including the day of surgery)

(2) Methylprednisolone ivdrip, 80mg/60kg, Qd x 3d (including operation day)

(3) On the third day after operation, the methylprednisolone is changed into meizhuole, po, 40mg/60 kg; qd 4 d;

in the second week after operation, the dose of mejole is reduced, po, 32mg/60 kg; qd 7 d;

in the third week after operation, the dose of meluole is reduced, po, 24mg/60 kg; qd 7 d;

in the fourth postoperative period, the dose of meluole is reduced, po is 16mg/60 kg; qd 7 d;

in the fifth week after operation, the dose of meluole is reduced, po is 8mg/60 kg; qd 7 d;

in the sixth week after operation, the dose of meluole is reduced, po is 6mg/60 kg; qd 7 d;

in the seventh postoperative week, the dose of meluole is reduced, po is 4mg/60 kg; qd 7 d.

2, local application:

(1) tobramycin dexamethasone eye drops: eye drop surgery, Qid 1 week;

(2) tobramycin dexamethasone eye ointment: eye drop surgery, Qn x1 week;

2.7 postoperative examination:

1 day after surgery: vision, intraocular pressure, slit lamp, fundus; anterior segment photography and fundus photography.

The following day after the operation: vision, intraocular pressure, slit lamp, fundus;

the third day after operation: vision, intraocular pressure, slit lamp, fundus oculi.

2, after the postoperative examination needs to be operated by professional staff, all examination reports can be informed to the patient after being audited and signed by doctors with the subsidiary job title; non-professionals or medical personnel not familiar with the field are prohibited from adept at examining or addressing the condition for the patient;

attention is paid to the following components: the postoperative examination should not be too much, and the content of the preoperative special examination item should not be exceeded; before all examinations, the contact part of the instrument and the patient needs to be wiped by alcohol; after the examination is finished, an antibiotic eye drop needs to be given for eye dropping; the contaminated eye drops and eye ointments are prohibited from dripping into the conjunctival sac.

2.8 postoperative review:

1. informing all the people who receive LHON ocular gene therapy to go to a hospital for a further diagnosis at the time appointed by a doctor;

2. all the people receiving LHON ocular gene therapy are informed to see a doctor at any time if any discomfort exists.

Dosage form, dosage, administration route, administration method, administration frequency, treatment course and regulation related to combined administration of test medicines

1 the clinical grade rAAV2-ND4 dosage form used in the research is injection; the recombinant adeno-associated virus rAAV2-ND4 is prepared in example 1 and contains the fusion nucleic acid shown in SEQ ID No. 6.

2 doses of 0.2 ml;

3 administration route: injecting in a cavity;

4, administration method: injecting 0.05ml of medicine into the vitreous cavity under the local anesthesia;

5 times of administration: single use;

three results

1 study of effectiveness

And (3) evaluating the curative effect: the international standard guidelines for vision improvement show a significant improvement in vision of 0.3logMAR (15 letters) and an improvement of 0.2logMAR (10 letters). An increase of less than 0.1logMAR (5 letters) is no increase

145 patients were treated as of 2018, 6 and 27 days. The results observed 3 days after treatment showed: there were 24 cases (16.55%) of significant increase in 0.3logMAR and 6 cases (4.14%) of increase in 0.2logMAR on day 1, with a total effective rate of 20.69% and a decrease of 2 cases (1.38%). There were 35 cases (24.14%) of significant increase in 0.3logMAR the next day, 12 cases (8.22%) of increase in 0.2logMAR, and a total effective rate of 32.41%. There were 42 cases (28.96%) of the 0.3logMAR increase, 11 cases (7.59%) of the 0.2logMAR increase, and the total effective rate was 36.55% on the third day.

TABLE 1145 analysis of the efficacy of the patients within 3 days of treatment

129 patients completed a month review and had a significant improvement in vision of 55 cases (42.66%) for 0.3logMAR and 16 cases (12.40%) for 0.2 logMAR. The total effective rate of improving vision after one month of reexamination is 55.04%, and the vision is degraded by 9 cases (6.98%). After the 67 patients are reviewed after 3 months, the vision is remarkably improved by 37 cases (55.22%) of 0.3logMAR, improved by 8 cases (11.94%) of 0.2logMAR, the total effective rate of the three-month review is improved by 67.16%, and the total effective rate is reduced by 4 cases (5.97%).

TABLE 2 post-treatment review efficacy analysis of patients

2 safety study

Three days, one month and three months of postoperative adverse reactions to the eyes were detected, respectively. Three days after surgery except 21 patients with mild ocular hypertension, there were no other obvious complications. After one month of examination, only 17 cases of high intraocular pressure are detected, and only 5 cases are left after three months of operation, and no other adverse reaction exists.

TABLE 3 statistics of common complications occurring in patients with Leber's gene therapy

3. Security result comparison

143 patients were treated as of 2018, 6 and 5 days, and 7 of the patients were also treated as of Argentina international patients, with the onset time divided into groups of 2 years or less and groups of 2 years or more, and safety checks were performed periodically. We detected three days, one month and three months of postoperative adverse ocular reactions, respectively. Except 21 patients with slight ocular hypertension in three days after operation, the traditional Chinese medicine composition belongs to mild complications and can recover by self without obvious other serious complications. After operation, 17 cases of ocular hypertension were examined in one month, and only 5 cases remained in three months after operation, without other adverse reactions (see table 1). Safety examination was performed on 7 Argentina patients at 5 months and 13 days, and the results showed that all patients were safe, only 1 patient had slight ocular hypertension, and the patients recovered to normal after drug treatment. Similar work was done by the french Gensight company, but they were divided into patients under clinical treatment trials of 6 months and 6 to 12 months depending on the time of onset. Generally, patients with shorter onset times have less damage to the optic ganglion cells and the prognosis of gene therapy is best. The worse the prognosis, the longer the onset time. In addition to 10 ocular hypertension, 15 patients treated by them developed 2 episodes of selective cataract extraction, 2 episodes of severe anterior chamber inflammation and vitreous inflammation, and various adverse reactions such as keratitis, vitreous hemorrhage, allergic conjunctivitis, ophthalmalgia, etc. (see table 1). 15 patients are clinically treated by the Guy professor in the United states, the patients are divided into a group with the disease onset time of more than 12 months and a group with the disease onset time of less than 12 months, and adverse reactions such as 2 cases of uveitis, 1 case of keratitis, 1 case of ophthalmalgia, 1 case of ocular hypertension and the like are treated. From the above data, it can be seen that the safety of the gene therapy of the present invention is significantly higher than that of the french Gensight company and the us professor Guy.

TABLE 4 statistics of the common complications of Leber's disease patients treated with the gene of the invention and comparison with the results of Gensight corporation of France and professor Guy of USA

Mild complications (self-recovery), and severe complications, requiring intervention.

The etiology of uveitis is various, and the clinical manifestations, the development rules and the treatment time of each type are different, so doctors need to make an individual treatment scheme suitable for patients according to the specific conditions of the patients.

Many types of uveitis may be associated with systemic infection and immune diseases, and require long-term treatment, some of which may even take more than 2-3 years, and patients need to know the complexity, difficulty and long-term property of treating the diseases and have enough tolerance and confidence to be positively matched with the treatment of doctors to obtain better treatment effect.

Many types of uveitis often require treatment with hormones and immunosuppressive agents. In the west, approximately one-fourth of uveitis patients require systemic treatment with hormones and immunosuppressants, and even so, 35% of patients have visual disability. In addition, no matter how good the physician is, how optimal and individual the treatment is, some side effects will inevitably occur during the course of treatment. Common side effects of immunosuppressive agents include impairment of liver and kidney functions, increase of blood sugar, hypertension, infertility, abnormalities of the nervous and mental systems, nausea, vomiting, weakness and the like.

The high intraocular pressure belongs to mild complications and is the most common complication in ophthalmic surgery, and a patient can recover to a normal level by himself under a general condition, and the intraocular pressure can be reduced to the normal level by using an intraocular pressure reducing eye drop.

In conclusion, the treatment method of the present invention can effectively treat eye diseases (such as Leber hereditary optic neuropathy) without associated complications such as uveitis, etc., and has little side effect and high safety.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> Wuhan Newcastle Biotechnology Ltd

<120> Gene therapy for Leber genetic optic neuropathy

<130>P2018-1933

<160>7

<170>PatentIn version 3.5

<210>1

<211>87

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>1

atgtccgtcc tgacgcgcct gctgctgcgg ggcttgacac ggctcggctc ggcggctcca 60

gtgcggcgcg ccagaatcca ttcgttg 87

<210>2

<211>84

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>2

atggccgcct ctccacacac actgagtagc agactgctga ccggctgtgt tggcggctct 60

gtgtggtatc tggaacggcg gaca 84

<210>3

<211>84

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>3

atggccgcat ctccgcacac tctctcctca cgcctcctga caggttgcgt aggaggctct 60

gtctggtatc ttgaaagaag aact 84

<210>4

<211>266

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>4

gtgctgcccg cctagaaagg gtgaagtggt tgtttccgtg acggactgag tacgggtgcc 60

tgtcaggctc ttgcggaagt ccatgcgcca ttgggagggc ctcggccgcg gctctgtgcc 120

cttgctgctg agggccactt cctgggtcat tcctggaccg ggagccgggc tggggctcac 180

acgggggctc ccgcgtggcc gtctcggcgc ctgcgtgacc tccccgccgg cgggatgtgg 240

cgactacgtc gggccgctgt ggcctg 266

<210>5

<211>2889

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>5

atggccgcct ctccacacac actgagtagc agactgctga ccggctgtgt tggcggctct 60

gtgtggtatc tggaacggcg gacaatgctg aagctgatcg tgcccaccat catgctgctg 120

cctctgacct ggctgagcaa gaaacacatg atctggatca acaccaccac gcacagcctg 180

atcatcagca tcatccctct gctgttcttc aaccagatca acaacaacct gttcagctgc 240

agccccacct tcagcagcga ccctctgaca acacctctgc tgatgctgac cacctggctg 300

ctgcccctca caatcatggc ctctcagaga cacctgagca gcgagcccct gagccggaag 360

aaactgtacc tgagcatgct gatctccctg cagatctctc tgatcatgac cttcaccgcc 420

accgagctga tcatgttcta catctttttc gagacaacgc tgatccccac actggccatc 480

atcaccagat ggggcaacca gcctgagaga ctgaacgccg gcacctactt tctgttctac 540

accctcgtgg gcagcctgcc actgctgatt gccctgatct acacccacaa caccctgggc 600

tccctgaaca tcctgctgct gacactgaca gcccaagagc tgagcaacag ctgggccaac 660

aatctgatgt ggctggccta cacaatggcc ttcatggtca agatgcccct gtacggcctg 720

cacctgtggc tgcctaaagc tcatgtggaa gcccctatcg ccggctctat ggtgctggct 780

gcagtgctgc tgaaactcgg cggctacggc atgatgcggc tgaccctgat tctgaatccc 840

ctgaccaagc acatggccta tccatttctg gtgctgagcc tgtggggcat gattatgacc 900

agcagcatct gcctgcggca gaccgatctg aagtccctga tcgcctacag ctccatcagc 960

cacatggccc tggtggtcac cgccatcctg attcagaccc cttggagctt tacaggcgcc 1020

gtgatcctga tgattgccca cggcctgaca agcagcctgc tgttttgtct ggccaacagc 1080

aactacgagc ggacccacag cagaatcatg atcctgtctc agggcctgca gaccctcctg 1140

cctcttatgg ctttttggtg gctgctggcc tctctggcca atctggcact gcctcctacc 1200

atcaatctgc tgggcgagct gagcgtgctg gtcaccacat tcagctggtc caatatcacc 1260

ctgctgctca ccggcctgaa catgctggtt acagccctgt actccctgta catgttcacc 1320

accacacagt ggggaagcct gacacaccac atcaacaata tgaagcccag cttcacccgc 1380

gagaacaccc tgatgttcat gcatctgagc cccattctgc tgctgtccct gaatcctgat 1440

atcatcaccg gcttctccag ctgagagcac tgggacgccc accgcccctt tccctccgct 1500

gccaggcgag catgttgtgg taattctgga acacaagaag agaaattgct gggtttagaa 1560

caagattata aacgaattcg gtgctcagtg atcacttgac agtttttttt ttttttaaat 1620

attacccaaa atgctcccca aataagaaat gcatcagctc agtcagtgaa tacaaaaaag 1680

gaattatttt tccctttgag ggtcttttat acatctctcc tccaacccca ccctctattc 1740

tgtttcttcc tcctcacatg ggggtacaca tacacagctt cctcttttgg ttccatcctt 1800

accaccacac cacacgcaca ctccacatgc ccagcagagt ggcacttggt ggccagaaag 1860

tgtgagcctc atgatctgct gtctgtagtt ctgtgagctc aggtccctca aaggcctcgg 1920

agcaccccct tccttgtgac tgagccaggg cctgcatttt tggttttccc caccccacac 1980

attctcaacc atagtccttc taacaatacc aatagctagg acccggctgc tgtgcactgg 2040

gactggggat tccacatgtt tgccttggga gtctcaagct ggactgccag cccctgtcct 2100

cccttcaccc ccattgcgta tgagcatttc agaactccaa ggagtcacag gcatctttat 2160

agttcacgtt aacatataga cactgttgga agcagttcct tctaaaaggg tagccctgga 2220

cttaatacca gccggatacc tctggccccc accccattac tgtacctctg gagtcactac 2280

tgtgggtcgc cactcctctg ctacacagca cggctttttc aaggctgtat tgagaaggga 2340

agttaggaag aagggtgtgc tgggctaacc agcccacaga gctcacattc ctgtcccttg 2400

ggtgaaaaat acatgtccat cctgatatct cctgaattca gaaattagcc tccacatgtg 2460

caatggcttt aagagccaga agcagggttc tgggaatttt gcaagttacc tgtggccagg 2520

tgtggtctcg gttaccaaat acggttacct gcagcttttt agtcctttgt gctcccacgg 2580

gtctacagag tcccatctgc ccaaaggtct tgaagcttga caggatgttt tcgattactc 2640

agtctcccag ggcactactg gtccgtagga ttcgattggt cggggtagga gagttaaaca 2700

acatttaaac agagttctct caaaaatgtc taaagggatt gtaggtagat aacatccaat 2760

cactgtttgc acttatctga aatcttccct cttggctgcc cccaggtatt tactgtggag 2820

aacattgcat aggaatgtct ggaaaaagct tctacaactt gttacagcct tcacatttgt 2880

agaagcttt 2889

<210>6

<211>2889

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>6

atggccgcat ctccgcacac tctctcctca cgcctcctga caggttgcgt aggaggctct 60

gtctggtatc ttgaaagaag aactatgcta aaactaatcg tcccaacaat tatgttacta 120

ccactgacat ggctttccaa aaaacacatg atttggatca acacaaccac ccacagccta 180

attattagca tcatccctct actatttttt aaccaaatca acaacaacct atttagctgt 240

tccccaacct tttcctccga ccccctaaca acccccctcc taatgctaac tacctggctc 300

ctacccctca caatcatggc aagccaacgc cacttatcca gtgaaccact atcacgaaaa 360

aaactctacc tctctatgct aatctcccta caaatctcct taattatgac attcacagcc 420

acagaactaa tcatgtttta tatcttcttc gaaaccacac ttatccccac cttggctatc 480

atcacccgat ggggcaacca gccagaacgc ctgaacgcag gcacatactt cctattctac 540

accctagtag gctcccttcc cctactcatc gcactaattt acactcacaa caccctaggc 600

tcactaaaca ttctactact cactctcact gcccaagaac tatcaaactc ctgggccaac 660

aacttaatgt ggctagctta cacaatggct tttatggtaa agatgcctct ttacggactc 720

cacttatggc tccctaaagc ccatgtcgaa gcccccatcg ctgggtcaat ggtacttgcc 780

gcagtactct taaaactagg cggctatggt atgatgcgcc tcacactcat tctcaacccc 840

ctgacaaaac acatggccta ccccttcctt gtactatccc tatggggcat gattatgaca 900

agctccatct gcctacgaca aacagaccta aaatcgctca ttgcatactc ttcaatcagc 960

cacatggccc tcgtagtaac agccattctc atccaaaccc cctggagctt caccggcgca 1020

gtcattctca tgatcgccca cgggcttaca tcctcattac tattctgcct agcaaactca 1080

aactacgaac gcactcacag tcgcatcatg atcctctctc aaggacttca aactctactc 1140

ccactaatgg ctttttggtg gcttctagca agcctcgcta acctcgcctt accccccact 1200

attaacctac tgggagaact ctctgtgcta gtaaccacgt tctcctggtc aaatatcact 1260

ctcctactta caggactcaa catgctagtc acagccctat actccctcta catgtttacc 1320

acaacacaat ggggctcact cacccaccac attaacaaca tgaaaccctc attcacacga 1380

gaaaacaccc tcatgttcat gcacctatcc cccattctcc tcctatccct caaccccgac 1440

atcattaccg ggttttcctc ttaagagcac tgggacgccc accgcccctt tccctccgct 1500

gccaggcgag catgttgtgg taattctgga acacaagaag agaaattgct gggtttagaa 1560

caagattata aacgaattcg gtgctcagtg atcacttgac agtttttttt ttttttaaat 1620

attacccaaa atgctcccca aataagaaat gcatcagctc agtcagtgaa tacaaaaaag 1680

gaattatttt tccctttgag ggtcttttat acatctctcc tccaacccca ccctctattc 1740

tgtttcttcc tcctcacatg ggggtacaca tacacagctt cctcttttgg ttccatcctt 1800

accaccacac cacacgcaca ctccacatgc ccagcagagt ggcacttggt ggccagaaag 1860

tgtgagcctc atgatctgct gtctgtagtt ctgtgagctc aggtccctca aaggcctcgg 1920

agcaccccct tccttgtgac tgagccaggg cctgcatttt tggttttccc caccccacac 1980

attctcaacc atagtccttc taacaatacc aatagctagg acccggctgc tgtgcactgg 2040

gactggggat tccacatgtt tgccttggga gtctcaagct ggactgccag cccctgtcct 2100

cccttcaccc ccattgcgta tgagcatttc agaactccaa ggagtcacag gcatctttat 2160

agttcacgtt aacatataga cactgttgga agcagttcct tctaaaaggg tagccctgga 2220

cttaatacca gccggatacc tctggccccc accccattac tgtacctctg gagtcactac 2280

tgtgggtcgc cactcctctg ctacacagca cggctttttc aaggctgtat tgagaaggga 2340

agttaggaag aagggtgtgc tgggctaacc agcccacaga gctcacattc ctgtcccttg 2400

ggtgaaaaat acatgtccat cctgatatct cctgaattca gaaattagcc tccacatgtg 2460

caatggcttt aagagccaga agcagggttc tgggaatttt gcaagttacc tgtggccagg 2520

tgtggtctcg gttaccaaat acggttacct gcagcttttt agtcctttgt gctcccacgg 2580

gtctacagag tcccatctgc ccaaaggtct tgaagcttga caggatgttt tcgattactc 2640

agtctcccag ggcactactg gtccgtagga ttcgattggt cggggtagga gagttaaaca 2700

acatttaaac agagttctct caaaaatgtc taaagggatt gtaggtagat aacatccaat 2760

cactgtttgc acttatctga aatcttccct cttggctgcc cccaggtatt tactgtggag 2820

aacattgcat aggaatgtct ggaaaaagct tctacaactt gttacagcct tcacatttgt 2880

agaagcttt 2889

<210>7

<211>1380

<212>DNA

<213> Artificial sequence (artificial sequence)

<400>7

atgctgaagc tgatcgtgcc caccatcatg ctgctgcctc tgacctggct gagcaagaaa 60

cacatgatct ggatcaacac caccacgcac agcctgatca tcagcatcat ccctctgctg 120

ttcttcaacc agatcaacaa caacctgttc agctgcagcc ccaccttcag cagcgaccct 180

ctgacaacac ctctgctgat gctgaccacc tggctgctgc ccctcacaat catggcctct 240

cagagacacc tgagcagcga gcccctgagc cggaagaaac tgtacctgag catgctgatc 300

tccctgcaga tctctctgat catgaccttc accgccaccg agctgatcat gttctacatc 360

tttttcgaga caacgctgat ccccacactg gccatcatca ccagatgggg caaccagcct 420

gagagactga acgccggcac ctactttctg ttctacaccc tcgtgggcag cctgccactg 480

ctgattgccc tgatctacac ccacaacacc ctgggctccc tgaacatcct gctgctgaca 540

ctgacagccc aagagctgag caacagctgg gccaacaatc tgatgtggct ggcctacaca 600

atggccttca tggtcaagat gcccctgtac ggcctgcacc tgtggctgcc taaagctcat 660

gtggaagccc ctatcgccgg ctctatggtg ctggctgcag tgctgctgaa actcggcggc 720

tacggcatga tgcggctgac cctgattctg aatcccctga ccaagcacat ggcctatcca 780

tttctggtgc tgagcctgtg gggcatgatt atgaccagca gcatctgcct gcggcagacc 840

gatctgaagt ccctgatcgc ctacagctcc atcagccaca tggccctggt ggtcaccgcc 900

atcctgattc agaccccttg gagctttaca ggcgccgtga tcctgatgat tgcccacggc 960

ctgacaagca gcctgctgtt ttgtctggcc aacagcaact acgagcggac ccacagcaga 1020

atcatgatcc tgtctcaggg cctgcagacc ctcctgcctc ttatggcttt ttggtggctg 1080

ctggcctctc tggccaatct ggcactgcct cctaccatca atctgctggg cgagctgagc 1140

gtgctggtca ccacattcag ctggtccaat atcaccctgc tgctcaccgg cctgaacatg 1200

ctggttacag ccctgtactc cctgtacatg ttcaccacca cacagtgggg aagcctgaca 1260

caccacatca acaatatgaa gcccagcttc acccgcgaga acaccctgat gttcatgcat 1320

ctgagcccca ttctgctgct gtccctgaat cctgatatca tcaccggctt ctccagctga 1380

Claims

1. A pharmaceutical combination, comprising:

(B) a second drug, the second drug being mejole.

2. The pharmaceutical combination of claim 1, wherein the polypeptide is selected from the group consisting of: ND1, ND4, ND6, or a combination thereof.

3. The pharmaceutical combination of claim 1, wherein the first agent is in the form of an injectable formulation; and/or the dosage form of the second medicament is preferably an oral formulation.

4. A kit, comprising:

(B) a second formulation which is alterole.

5. Use of the pharmaceutical combination according to claim 1 for the preparation of a medicament or formulation for restoring or improving vision and/or treating an ocular disease in a subject.

6. A method of treating an ocular disorder, the method comprising the steps of: administering to a subject in need thereof a pharmaceutical combination according to claim 1 or a kit according to claim 2.

7. A method of treatment, comprising the steps of: administering alterole to a subject in need thereof prior to, concurrently with, and/or after intraocular administration of a recombinant adeno-associated virus to the subject.

8. The treatment of claim 7, wherein the treatment comprises the steps of:

9. Use of mellea for the preparation of a formulation or composition for reducing the side effects or complications of intraocular administration of a recombinant adeno-associated virus.

10. The use of claim 9, wherein the side effects or complications comprise: cataract extraction, uveitis, vitritis, keratitis, anterior chamber inflammation, vitreous hemorrhage, ophthalmalgia, allergic conjunctivitis, ocular hypertension, or combinations thereof.