CN111068052A

CN111068052A - Methods of modulating calcium channel activity and uses thereof

Info

Publication number: CN111068052A
Application number: CN201811230866.6A
Authority: CN
Inventors: 王世强; 李晓晨; 范雪新; 王礼鹏
Original assignee: Peking University
Current assignee: Peking University
Priority date: 2018-10-22
Filing date: 2018-10-22
Publication date: 2020-04-28

Abstract

The invention provides a method for regulating calcium ion influx of myocardial cells by modifying the combination of any one or more amino acid residues in ESSE (amino acid sequence) 2061-position 2064 in the amino acid sequence of the L-type calcium channel protein of a mammal with SEQ ID No.1, and a calcium channel regulator. The invention also provides a pharmaceutical composition for treating cardiovascular diseases, which comprises a modulator of any one or more amino acid residues in ESSE with 2061-2064 in the amino acid sequence of SEQ ID No.1 corresponding to the mammalian L-type calcium channel protein. The invention also provides a method for screening potential substances for treating cardiovascular diseases.

Description

Methods of modulating calcium channel activity and uses thereof

Technical Field

The present invention relates to the fields of molecular biology and disease treatment and medicine. In particular, the invention relates to calcium channel modulating methods and modulators, and methods and pharmaceutical compositions thereof for treating calcium channel-associated diseases.

Background

The L-type calcium ion channel is a voltage-gated calcium ion channel, is mainly distributed on cardiac muscle cells and cardiovascular smooth muscle cells, and is a main path of calcium ion inflow during stimulation of the cardiac muscle cells. The contraction of the heart is mediated by a process called excitation-contraction coupling of the cardiomyocytes. The specific process is that the sinoatrial node of the heart generates an electrical excitation-action potential which is transmitted through a cell membrane, an L-shaped calcium ion channel on a ventricular muscle cell membrane is open by sensing the action potential, extracellular calcium ions enter cells through the channel and activate the calcium ion channel on a sarcoplasmic reticulum of the muscle cells, so that a large amount of calcium ions are released from the sarcoplasmic reticulum, namely a calcium ion storage reservoir, and the concentration of the calcium ions in cytoplasm is increased. Calcium ions released into the cytoplasm slide myocytes myofilaments to produce cell contraction, thereby causing contraction of the heart.

There are various modes of regulation of L-type calcium ion channels in which the carboxy terminus of the channel is an important part of the regulation of the open activity of the channel and the magnitude of the current. It has been shown that L-type calcium channels regulate the activity of the channel by modulating the level of post-translational modifications, such as phosphorylation, under physiological conditions. Under the conditions of oxidative stress and the like, the L-type calcium ion channel phosphorylation modification level is improved under the regulation and control of a G protein-coupled receptor (GPCR), and the calcium ion influx of cells is increased. Therefore, under the condition of oxidative stress, such as myocardial ischemia, infarction or load-type cardiac hypertrophy caused by hypertension, heart failure and other pathological conditions, the activity of the L-type calcium ion channel is increased, so that calcium ion influx is increased, and calcium ion overload in myocardial cells is caused. Calcium ion overload triggers a series of severe myocardial cell injuries.

Due to the above-mentioned important effects, the L-type calcium ion channel is currently the most pharmacologically significant channel. Different L-type calcium ion channel regulation modes are found and clinically used for treating cardiovascular diseases such as hypertension, coronary heart disease, angina and the like. However, the existing treatment methods and drugs have the problem that the concentration of calcium ions in cells may change suddenly, which may cause severe cases such as myocardial infarction and apoplexy due to the rapid change of blood pressure.

The regulatory mechanisms of L-type calcium ion channels are not fully understood, and their active centers and involved mechanisms remain to be studied intensively. There is also a need in the art for new methods and drugs that effectively modulate L-type calcium ion channels.

Disclosure of Invention

Through intensive research, the inventor of the application discovers for the first time that the core region of the negative charge amino acid cluster (2061ESSE2064) at the 2061-position 2064 of the carboxyl terminal of the L-type calpain protein has important significance on the activity of the L-type calpain protein, and the existence of the conserved sequence has important effect on the regulation and control of the activity of the L-type calpain protein. The inventor further proves that the modification affecting phosphorylation of the sequence by adjusting the property of the sequence aiming at rat 2009 serine (corresponding to human 2063 serine) can greatly affect calcium ion influx controlled by L-type calpain by changing the charging property of negative charge amino acid cluster. The inventor provides a method and a medicament for regulating the L-type calpain by changing the self charge property of the negative charge amino acid cluster at positions 2061 to 2064 of the carboxyl terminal of the L-type calpain and changing the phosphorylation level of serine in the L-type calpain, influencing the activity of a calcium ion channel and further treating cardiovascular diseases.

Specifically, the invention provides a method for regulating calcium ion influx in myocardial cells of mammals, which comprises modifying one amino acid residue or the combination of any plurality of amino acid residues in ESSE with the 2061-2064 position of the amino acid sequence with the corresponding sequence of SEQ ID No.1 of an L-type calcium channel protein. In one aspect of the invention, the modification is to modify serine (S) at position 2062 and/or position 2063 in the amino acid sequence corresponding to the L-type calpain protein of SEQ ID No. 1.

L-type calcium channel protein (Voltage-dependent L-type calcium channel) is widely distributed in different cells such as smooth muscle cells, cardiac muscle cells and neurons, and is a main channel protein for regulating and controlling calcium ion inflow. In the myocardial cells, it is responsible for calcium release and regulates myocardial cell contraction and heart rate. In mammals, the protein sequence and the coding nucleic acid sequence of L-type calpain are well conserved. The human L-type calpain (UniProt ID: Q13936) is (Ensembl: ENST 00000344100). The gene encoding rat L-type calpain (UniProt ID: P22002) is (Ensembl: ENSRNOG 00000007090). The coding gene of mouse L-type calcium channel protein (UniProt ID: Q01815) is (Ensembl: ENSMUST 00000075591). In the L-type calpain, the ESSE amino acid cluster corresponding to the 2061-position 2064 in the amino acid sequence of human SEQ ID No.1 is highly conserved among species. The ESSE amino acid cluster is at position 2007-2010 in the amino acid sequence of SEQ ID No.2 of the corresponding rat.

In one aspect of the invention, the modification in the above method is an alteration in the charged properties of the amino acid residue of the ESSE at position 2061-2064. Methods known in the art for altering the charge properties of one or more amino acid residues on a protein, such as chemical modifications including acid-based modifications, substitutions of amino acid residues, etc., can be used.

In one aspect of the present invention, the modification in the above method is phosphorylation modification, especially phosphorylation modification of the serine at position 2062 and/or 2063. It can be modified by methods known in the art for phosphorylating an amino acid on a protein. Phosphorylation modifications include phosphorylation with protein kinases (kinases) or dephosphorylation with phosphatases (phosphatases). Phosphorylation by protein kinases is catalyzed by the protein kinases to transfer the phosphate group of ATP to the serine residue of the substrate protein. Dephosphorylation with a phosphatase refers to the process by which phosphorylated serine removes phosphate groups under the hydrolysis of the phosphatase.

In one aspect of the invention, the kinase phosphorylating modification of ESSE at position 2061-2064, in particular phosphorylating serine at position 2062 and/or 2063, is oxikinase (oxidative stress protein kinase).

In one aspect of the invention, the dephosphorylation modification of the ESSE at position 2061-2064, in particular the dephosphorylation phosphatase of the serine at position 2062 and/or 2063, is an oxiphatase (oxidative stress phosphatase).

In this patent, oxikinase refers to a kinase that regulates phosphorylation of amino acid residues in the core region of the negatively charged amino acid cluster (2061ESSE2064) at position 2061-2064 of the carboxyl terminal of L-type calcium channel protein under oxidative stress.

In this patent, oxiphatase refers to a phosphatase that regulates dephosphorylation of amino acid residues in the core region of the negative charge amino acid cluster at position 2061-2064 (2061ESSE2064) at the carboxy terminal of L-type calcium channel protein under oxidative stress.

In one aspect of the invention, the method further comprises modulating the kinase or phosphatase by:

a. a kinase or phosphatase inhibitor, e.g. an interfering RNA or precursor thereof interfering with the expression of said kinase or phosphatase, or an antibody specific for said kinase or phosphatase, or a mutant kinase or phosphatase protein or coding sequence thereof resulting in a reduced activity;

b. the kinase or phosphatase agonist; or

c. Overexpresses the kinase or phosphatase.

By kinase or phosphatase inhibitor is meant an agent capable of affecting the activity of the kinase or phosphatase and thus the activity of the L-type calcium channel. The reagent comprises small molecular compounds or complexes, or macromolecular active ingredients such as proteins and nucleic acids.

In yet another aspect of the invention, the kinase or phosphatase inhibitor is an interfering RNA that interferes with expression or a precursor thereof. Interfering RNA induces efficient and specific degradation of homologous mRNA through double-stranded RNA (dsRNA), so that the expression of a target gene is reduced or even eliminated. One way of administering interfering RNA in vivo is via its precursors, such as short hairpin RNA (shRNA) comprising two short inverted repeats.

In yet another aspect of the invention, the kinase or phosphatase inhibitor is a mutant kinase or phosphatase protein or a coding sequence thereof that results in a decrease or loss of activity. The mutant protein may compete with the normal protein to reduce the activity exerted by the normal protein. The mutein can be expressed in a target tissue or cell by administering a vector expressible in the target tissue or cell (the vector carries an expressible mutein gene and/or an expression factor thereof), or the like.

In one aspect of the invention, the modification of the combination of any one or more of the ESSE residues at position 2061-2064 in the amino acid sequence corresponding to the L-type calpain protein of SEQ ID No.1 refers to point mutation of the amino acid residues. Methods known in the art for point mutation of an amino acid in a protein can be used. For example, a desired change, such as addition/alteration of a base to encode a desired amino acid residue in a DNA fragment (which may be a genome or a plasmid) encoding the desired amino acid residue by PCR or the like, is introduced, and the modified DNA fragment is introduced into a desired cell or tissue to add a new protein or substitute for a wild-type protein.

In yet another aspect of the invention, said modification is a point mutation of said serine at position 2062 and/or 2063 of L-type calpain. The point mutation is a mutation of the serine to an amino acid of a non-negative electric property, such as an amino acid changed to be neutral or positive electric property (i.e., a non-polar amino acid or a basic amino acid), including glycine (Gly), alanine (Ala), valine (Val), leucine (Leu), isoleucine (Ile), phenylalanine (Phe), tryptophan (Trp), tyrosine (Tyr), and methionine (Met), and the like. Preferably, the serine is mutated to alanine or isoleucine. For example, a mutant L-type calpain protein having isoleucine at position 2062 and/or 2063 of L-type calpain protein can be introduced into a target cell by cloning to obtain a plasmid containing a nucleic acid fragment encoding serine at position 2062 and/or 2063 of L-type calpain protein, substituting TCT, which is a base encoding serine, with ATT, and then transfecting the plasmid into the target cell.

In the present invention, the mammal may be any mammal, including and not limited to, the order rodentia (e.g., yellow mouse, and rat), the order lagomorpha (rabbit), the order carnivora (feline and canine), the order artiodactyla (bovine and porcine), the order mirabilis (equine), or the order primates and simian (human or monkey). The mammal is preferably a human or a mouse or a rat.

The method for regulating calcium ion inflow of the myocardial cells of the mammals can be used for an in vitro method, and comprises the regulation of cells or tissues in vitro.

The invention also provides application of the reagent for modifying one amino acid residue or the combination of any plurality of amino acid residues in ESSE at the 2061-position 2064 of the amino acid sequence with the corresponding sequence of SEQ ID No.1 in preparing the medicament for regulating the calcium ion influx of the myocardial cells of the mammals. In one aspect of the invention, the agent is an agent that modifies serine at position 2062 and/or 2063 therein.

In one aspect of the present invention, the above methods and uses, the agent for modifying ESSE at position 2061-2064 of the amino acid sequence of SEQ ID No.1 corresponding to L-type calpain, particularly modifying serine at position 2062 and/or 2063 thereof is an agent specifically modifying said site. Specific modifying agents are agents which modify only said site or agents which do not have said modifying activity or have a modifying activity significantly less than said modifying activity of a serine at position 2062 and/or 2063 to an amino acid residue at another site, particularly to a serine residue at another site. For example, it is an enzyme that specifically affects the phosphorylation or dephosphorylation of serine at position 2062 and/or 2063 or the level thereof. As another example, it is a reaction used for point mutation of serine at position 2062 (e.g., a primer for obtaining a nucleic acid fragment containing a mutation, a plasmid containing a nucleic acid fragment containing a mutation, etc.).

In yet another aspect of the invention, the reagent in the above-mentioned use is a reagent that alters the charged properties of the amino acid residue of the ESSE at position 2061-2064, e.g., a reagent that performs chemical modifications including acid-based chemistry at the amino acid residue.

In yet another aspect of the invention, the agent in the above use is a phosphorylation modifying agent, in particular an agent which modifies the phosphorylation of the serine at position 2062 and/or 2063, such as a protein kinase (kinase) or a phosphatase (phosphatase). In yet another aspect of the invention, the agent is an oxikinase (oxidative stress protein kinase) which phosphorylates ESSE at position 2061-2064, in particular serine at position 2062 and/or 2063. In yet another aspect of the invention, the agent is an oxiphatase (oxidative stress phosphatase) dephosphorylation-modified ESSE at position 2061-2064. In yet another aspect of the invention, the agent is:

b. a kinase or phosphatase agonist; or

c. Reagents for over-expressing the kinase or phosphatase.

In one aspect of the present invention, there is provided an L-type calcium channel modulator which is an agent for specifically modifying one amino acid residue or a combination of any plurality of amino acid residues in ESSE having the amino acid sequence 2061-2064 of the corresponding sequence of SEQ ID No.1 in an L-type calcium channel protein. In yet another aspect of the invention, the L-type calcium channel modulator is an agent that specifically modifies serine at position 2062 and/or 2063 in the amino acid sequence corresponding to the L-type calcium channel protein of SEQ ID No. 1.

In yet another aspect of the present invention, the aforementioned L-type calcium channel modulator is a specific phosphorylation modifying agent, particularly an agent specifically phosphorylating serine at position 2062 and/or 2063, such as oxikinase (oxidative stress protein kinase) or oxiphatase (oxidative stress phosphatase). In yet another aspect of the invention, the agent is:

b. a kinase or phosphatase agonist; or

c. The kinase or phosphatase overexpressed.

In still another aspect of the present invention, the above-mentioned L-type calcium channel modulator is a mammalian L-type calcium channel protein in which either or both of the serines at positions 2062 and 2063 of the amino acid sequence (human source) having the corresponding sequence of SEQ ID No.1 are mutated to a nonpolar amino acid. In one aspect of the invention, the serine at position 2062 and 2063 of the amino acid sequence corresponding to SEQ ID No.1 is mutated to a nonpolar amino acid or a basic amino acid, preferably to isoleucine or alanine.

Thus, in one aspect of the present invention, there is provided a mammalian L-type calpain protein mutated to a non-polar amino acid at either or both of the serines at positions 2062 and 2063 of the amino acid sequence corresponding to SEQ ID No.1 (of human origin). In one aspect of the invention, the serine at position 2062 and 2063 of the amino acid sequence corresponding to SEQ ID No.1 is mutated to a nonpolar amino acid or a basic amino acid, preferably to isoleucine or alanine.

The invention also provides a method for treating cardiovascular diseases by modifying one amino acid residue or the combination of any plurality of amino acid residues in ESSE with the amino acid sequence 2061-2064 of the corresponding sequence of the L-type calcium channel protein of the mammal as SEQ ID No. 1. The invention also provides the application of the reagent for modifying one amino acid residue or the combination of any plurality of amino acid residues in ESSE with the amino acid sequence 2061-2064 position of the corresponding sequence of the L-type calpain protein of the mammal in preparing the medicine for treating cardiovascular diseases.

The invention also provides a pharmaceutical composition for treating cardiovascular diseases. The present invention provides a novel pharmaceutical composition for treating cardiovascular diseases, which comprises a therapeutically effective amount of an agent for modifying one or any combination of amino acid residues in ESSE having the amino acid sequence 2061-2064 of SEQ ID No.1 in a mammal.

The above-described agents for modifying the property of ESSE at position 2061-2064 of the amino acid sequence of SEQ ID No.1 corresponding to L-type calpain in mammals, which is used for treating cardiovascular diseases, according to the present invention, include agents for modifying serine at position 2062 and/or position 2063 of the amino acid sequence of SEQ ID No.1 corresponding to L-type calpain, particularly specifically modifying agents, as defined above.

In the present invention, the cardiovascular disease is selected from: atrial and ventricular arrhythmias, heart failure (including congestive heart failure, diastolic heart failure, systolic heart failure, acute heart failure), prinzmelto (variant) angina, stable and unstable angina, exercise-induced angina, congestive heart disease, ischemia, recurrent ischemia, reperfusion injury, myocardial infarction, acute coronary syndrome, peripheral arterial disease, pulmonary hypertension.

The present invention also provides a method of screening for potential substances for the treatment of cardiovascular disease, comprising the steps of:

(1) obtaining mammalian cells expressing L-type calpain, and applying a test substance to be screened; and

(2) detecting whether the L-type calcium channel protein of the mammalian cell has phosphorylation modification on the 2062 th serine and/or the 2063 rd serine of the amino acid sequence with the sequence of SEQ ID No. 1.

In the method for screening a potential substance for treating a cardiovascular disease, if a phosphorylation modification of serine at position 2062 and/or 2063 in a mammalian cell is found in the method, it indicates that the test substance is a potential substance for treating a cardiovascular disease.

In one aspect of the invention, the method further comprises the steps of: (3) detecting the calcium ion flux of said mammalian cell.

In the method for screening potential substances for treating cardiovascular diseases, if the serine at 2062 and/or 2063 of mammalian cells is found to be modified by phosphorylation and the calcium ion current of the mammalian cells is changed in the method, the test substance is a potential substance for treating cardiovascular diseases.

The present invention also provides a method of screening mammals for oxigaidase or oxishotase comprising the steps of:

(1) obtaining mammalian cells expressing L-type calc channel protein and a kinase or phosphatase to be tested; and

(2) detecting whether the expression of the kinase or the phosphatase is changed or not under the condition of hypoxia, and whether the serine at the 2062 th position and/or the 2063 rd position of the amino acid sequence of the L-type calcium channel protein with the corresponding sequence of SEQ ID No.1 is subjected to phosphorylation modification or not.

In the method for screening for mammalian oxikease or oxiphotase, if a modification of the phosphorylation of serine at position 2062 and/or 2063 in mammalian cells is found in the method, it is indicated that the kinase or phosphatase to be tested is an oxikease or oxiphotase of potential hypoxia stress.

In the method for screening for an oxidaise or an oxishotase, if a phosphorylation modification of serine at 2062 and/or 2063 of a mammalian cell is found in the method and a change in calcium ion current of the mammalian cell is found, it indicates that the kinase or phosphatase to be tested is an oxidaise or an oxishotase which is a potential hypoxia stress.

The contribution of the invention is as follows:

through intensive research, the inventor firstly discovers that the core region of the 2007-2010 negative charge amino acid cluster (2007ESSE2010) at the carboxyl terminal of the L-type calpain has important significance on the activity of the L-type calpain. The carboxyl terminal of the L-type calcium channel protein is an important structural domain for regulating the function of the L-type calcium channel protein, and phosphokinase, phosphatase and interaction sites of regulating proteins are widely distributed on the L-type calcium channel protein. The inventors found that the ESSE amino acid cluster corresponding to 2061-2064 position of human L-type calcium channel protein has high conservation among species by analyzing the protein sequence of the carboxyl terminal of the L-type calcium channel protein. The 2061-position 2064 amino acid is an amino acid with negative charge under physiological conditions. Specifically, glutamic acid (E) at positions 2007 and 2010 is an acidic amino acid, i.e., the side chain carboxyl group of glutamic acid is dissociated under physiological conditions to carry negative charges. Serine (S) at

positions

2008 and 2009 are important phosphorylation modification sites, and the side chain of the phosphorylation modified serine is also negatively charged under physiological conditions. The 2007-2010 site is thus a conserved amino acid cluster with four consecutive negative properties. The existence of the conserved sequence plays an important role in the regulation of the activity of the L-type calpain.

Based on the above research, the inventors further found that adjusting the property of the 2009 th serine in the sequence, especially mutating the serine to affect phosphorylation modification changes the charging property of the negatively charged amino acid cluster, and can greatly affect the calcium ion influx mediated by the L-type calcuin channel protein. Specifically, serine at position 2009 is mutated into isoleucine, and since isoleucine is uncharged nonpolar amino acid (hydrophobic amino acid), the mutation not only deprives the negative side chain of the originally phosphorylated serine at the position, but also changes the distribution of four continuous negative charges at the whole 2007-2010 position, i.e., changes the charge property of the conservative negative charge amino acid cluster. After the electrification property of the negative electricity cluster is changed, the L-type calcium channel protein channel is not easy to activate, and the activity is inhibited. The inventor therefore provides a method for regulating L-type calcium channel protein by changing the charge property of the negative charge amino acid cluster from 2007 to 2010 at the carboxyl terminal of the L-type calcium channel protein and changing the phosphorylation level of serine in the L-type calcium channel protein to influence the activity of a calcium ion channel, and further provides a method and a medicament for treating cardiovascular diseases.

The L-type calcium channel is widely distributed on the cell surface of the cardiovascular system, so that the L-type calcium channel becomes an excellent cardiovascular disease drug target. At present, the drugs for treating hypertension and coronary heart disease are widely used clinically, such as a horizon drug, the active ingredient of the drug is an inhibitor of an L-type calcium channel, the action mechanism is that the inhibitor is combined with a pore channel area of the L-type calcium channel to directly weaken the calcium ion inflow, and the inhibitor does not influence the activation and inactivation activity of the channel, namely does not change the voltage sensitivity of the channel. However, the broad inhibition of L-type calcium channels by calcium ion inhibitors also causes a series of problems. Since the calcium ion drug inhibitor directly reduces the influx of calcium ions into cells, it is necessary to gradually perform the initial administration and dose reduction of the drug to prevent severe cases such as myocardial infarction and stroke due to the abrupt change in the intracellular calcium ion concentration and the abrupt change in blood pressure.

The invention provides a treatment scheme aiming at the change of the activation property of the L-type calcium channel, so that the treatment scheme is different from the traditional calcium ion inhibitor drug treatment, and the adjustability of the intracellular calcium ion concentration is improved. Because most pathological states, such as hypertension, coronary heart disease, myocardial ischemia and the like, make myocardial cells in an oxidation stress state, at the moment, an L-type calcium ion channel is obviously activated, namely, in a resting state, the open probability of the channel is higher, the leakage of cell calcium is increased, the background calcium ion concentration of the cells is increased, and diseases are caused. Therefore, if the channel sensitivity of the L-type calcium channel can be regulated and controlled at the moment, rather than simply reducing the size of calcium ions flowing in the channel, the intracellular calcium ion concentration can be regulated and controlled more effectively and safely, so that the treatment effect is achieved.

Because the current regulation and control research aiming at the L-type calcium ion channel focuses on regulating and controlling the channel current (the number of calcium ions entering cells through the internal flow of the channel), the change of the channel activation property is influenced through the regulation and control of the negative amino acid cluster at the carboxyl terminal of the L-type calcium ion channel, and a brand-new, controllable, more effective and safer cardiovascular disease treatment mechanism and direction are provided.

Drawings

FIG. 1 is a graph showing the alignment of the structure and the inter-species primary sequence analysis of L-type calcium channel protein the protein sequences of α subunits derived from human, rat and mouse are all derived from the Uniprot database.

FIG. 2 is a graph of ESSE primary sequence phosphorylation analysis of the L-type calcium channel amino acid cluster.

FIG. 3 shows a comparison of the activation curves of wild-type and mutant L-type calcium channel over-expressed by HEK239T cells. Conductance (G) under different voltages (V) is calculated by calcium current-voltage data, the conductance and the corresponding maximum conductance (Gmax) are normalized, a Moziman equation G/Gmax is fitted to all points, the value is 1/(1+ exp ((Vhalf-V)/k)), and half activation voltage (Vhalf) is calculated, namely the corresponding voltage value when G/Gmax in a curve is equal to 0.5. The half-activation voltage of the wild type (indicated by white circles) L-type calcium channel was-10 mV, and the half-activation voltage of the mutant L-type calcium channel, in which the 2009 th serine was mutated to isoleucine (S2009I) in the amino acid sequence corresponding to SEQ ID No.2, was-4 mV, i.e., the activation curve of the mutant channel was shifted to the right (toward depolarization direction) as compared with the wild type. This indicates that at the same voltage, the wild-type channel is more easily activated and the channel is more open than the mutant channel, and more calcium ions enter the cell via the channel at the same time.

Detailed Description

The spirit and advantages of the present invention will be further illustrated by the following examples, which are provided by way of illustration and are not intended to be limiting. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the laboratory Manual (New York: Cold Spring harbor laboratory Press,1989), or according to the manufacturer's recommendations.

Example 1 materials and methods

Animal material

Sprague Dawley rats were purchased from Wintolite Beijing Wintolite laboratory animal technology, Inc., and the experimental rats were adult male rats weighing 200-. All animal experiments were approved by the welfare and use committee of laboratory animals of the university of beijing.

Gene cloning and vector construction

The nucleotide sequence of the coding region of rat L-type calpain α subunit (subunit shown in figure 1) and β subunit (expression auxiliary subunit) is amplified from a cDNA library of rat cardiac muscle cells by using chain amplification reaction (PCR). α subunit nucleotide sequence is connected to pIRES-EGFP vector through NheI/XhoI enzyme cutting site, β subunit nucleotide sequence is connected to pIRES-TdTdTomoto vector through NheI/XhoI enzyme cutting site of endonuclease (New England Biolabs, UK).

The overexpression vector pIRES-EGFP was obtained by inserting the IRES nucleic acid sequence EcoRI/BamHI into pEGFP-C1(Clontech, USA), and the pIRES-EGFP vector was obtained by replacing the EGFP nucleic acid sequence part NheI/BsrGI double enzyme with TdTomoto nucleic acid sequence.

The rat L-type calcium channel protein α subunit is mutated from 2009 th serine to isoleucine in the amino acid sequence of SEQ ID No.2 by overlapping PCR, the 2009-encoding serine codon TCT is replaced by ATT, and point mutation is introduced by synthesizing primer.

The sequences of the primers involved in the above clones are as follows:

l-type calcium channel α subunit forward (F) reverse (R) primer:

F：CTAGCTAGCATGATTCGGGCCTTCGCTCAG

R：CCGCTCGAGCTACAGGTTGCTGACATAGGACCTGC

primer sequences for point mutations:

S2009I_F：CGGAGTCCATTGAGAAACTCAACAGCAG

S2009I_R：AGTTTCTCAATGGACTCCGCCCCCTC

l-type calcium channel β subunit forward (F) reverse (R) primer:

F：CTAGCTAGCATGCTTGACAGGCAGTTGGTGTCTTC

R：ACGCGTCGACTCATTGGCGGATGTATACATCCCTG

cell culture and protein overexpression

HEK293T cells were cultured in DMEM (ThermoFisher Scientific, USA) containing 10% fetal bovine serum, with 5% carbon dioxide in the culture environment 1h prior to transfection, the cells were transferred to serum-free medium opti-MEM (GibcoBRL, USA), the transfection reagent was Lipo2000(ThermoFisher Scientific USA), pIRES-EGFP containing α subunits was co-transfected with pIRES-Tdtomato plasmids containing β subunits, the transfection amount of each plasmid was 2. mu.g, 8 h after transfection, the cells were changed to serum-containing medium and cultured for further 24 h for subsequent experiments.

Electrophysiology

In the experiment, an Axon 200B patch clamp amplifier, a Digidata1440A digital-to-analog converter and Clampex6 software are adopted to realize the acquisition and recording of electrophysiological stimulation and signals, the environmental temperature is 25 ℃, the liquid entrance resistance of a glass electrode adopted in the experiment is 2-4M omega, cells which all express LCC alpha subunit (containing EGFP) and β subunit (containing td-tomato) are selected under a Zeiss LSM710 confocal microscope for recording, and the liquid formula of cell recording is (mM): 120CsCl, 20TEA-Cl, 5EGTA, 10HEPES and 1 MgCl2.6HgHg2.6HgM₂O, 5MgATP, CsOH to adjust the pH value to 7.2. The external liquid formula is (mM): 137NaCl, 5.4KCl, 1.2MgCl₂·6H₂O，20HEPES，1.2NaH₂PO₄·2H₂O，10BaCl₂10glucose, NaOH to adjust the pH value to 7.3-7.4. After the electrode is immersed in the liquid, the negative pressure attachment method is used to make the electrode and the cell reach high resistance (>G omega) sealing. Then, the membrane is broken by applying weak positive pressure to the inside of the electrode tube. After membrane rupture, the cell membrane potential is clamped at-70 mV, and the stimulation is from-70 mV to 70mV, and 10mV is used as a step. The acquisition frequency of the current signal is 2 kHz. Data were analyzed using pClamp 10.2 software.

Example 2 sequence analysis of L-type calpain

Protein structures and primary sequences of L-type calpain proteins were analyzed in human, rat and mouse. As shown in FIG. 1, the four subunits of the L-type calcium channel are denoted by I-IV, each subunit comprises six cell membrane-penetrating helices, denoted by 1-6, and the coiled (loop) portion between the fifth and sixth helices is a voltage-sensing portion. The carboxy-terminal part is located intracellularly, and the domain is abbreviated dCT. The ESSE of the amino acid cluster corresponding to position 2061-2064 in the amino acid sequence of human SEQ ID No.1 (corresponding to position 2007-2010 in the amino acid sequence of rat SEQ ID No. 2) is at the carboxy-terminus of the channel. The ESSE of the amino acid cluster is conserved among human, rat and mouse through primary sequence analysis.

Example 3 analysis of ESSE Primary sequence phosphorylation of the L-type calcium channel amino acid cluster.

The primary protein sequence for the rat L-type calcium channel carboxy-terminal domain (amino acids 1506-2169) was derived from Uniprot and was analyzed using the "sequence and structure based protein phosphorylation analysis" algorithm (NetPhos 2.0).

As shown in fig. 2, primary sequence analysis showed that there was a higher degree of phosphorylation of serine at positions 2008 and 2009 (corresponding to the amino acid sequence of SEQ ID No. 2), with scores of 0.722 and 0.784. Score values above 0.2 indicate that the physiological state has a low level of phosphorylation.

Example 4 cell model shows the effect of the mutation of the 2009 th serine to isoleucine in the amino acid sequence of the rat corresponding to SEQ ID No.2 on the activity of L-type calcium channels

The gene of the rat L-type calcium channel is inserted into an expression vector, and is overexpressed in HEK209T cells, and the activation curve of the L-type calcium channel is detected by using a whole-cell patch clamp technology. As the voltage increases, the channels open and extracellular calcium ions flow through the channels into the cytosol, and the channels activate. The number of activated channels is different under different voltages of the voltage-gated channels.

As shown in fig. 3. Fig. 3 is a conductance curve of L-type calcium channel as a function of voltage, i.e., a channel activation curve. With the increase of voltage, the channels in the open state on the cell membrane are gradually increased, and the conductance is increased. The S2009I (mutation of serine to isoleucine at 2009) mutant channel activation curve shifted to the right.

This indicates that when serine in position 2009 is mutated to isoleucine, the channel requires a higher voltage to activate the channel, that is, the mutant channel has a smaller probability of opening than the wild type at the same voltage, and the channel activity is inhibited.

Example 5 cell model shows the effect of mutation of serine to alanine at position 2009 in the amino acid sequence of the rat corresponding to SEQ ID No.2 on L-type calcium channel Activity

Using the same method as in example 5, it was found through testing that the S2009A (mutation of serine to alanine at position 2009) mutant channel activation curve was shifted to the right, similar to the activation curve of the S2009I mutant. This indicates that when serine at position 2009 is mutated to alanine, the mutant channel has a smaller probability of opening than the wild type at the same voltage, and the channel activity is inhibited.

Therefore, in the 2007-2010 electronegative amino acid cluster, phosphorylated serine is mutated into nonpolar amino acid alanine with a smaller side chain, the electronegative property of the amino acid cluster is changed, and the channel activity is inhibited.

Conclusion

After intensive research, the inventor firstly discovers that the 2007-2010 site (corresponding to the 2061-2064 site of the human L-type calcium channel protein) of the rat is a conserved amino acid cluster with four continuous negative properties. The existence of the conserved sequence plays an important role in the regulation of the activity of the L-type calpain.

Based on the above studies, the inventors further found and demonstrated that adjusting the properties of serine in position 2009, especially mutating it to affect phosphorylation modification changes the charging properties of negatively charged amino acid clusters, which greatly affects calcium ion influx. The inventor provides a method and a medicament for regulating the L-type calcium channel protein by changing the charge property of the carboxyl-terminal negative charge amino acid cluster of the L-type calcium channel protein and changing the phosphorylation level of serine in the L-type calcium channel protein, influencing the activity of a calcium ion channel and further treating cardiovascular diseases.

The invention provides a treatment scheme aiming at the change of the activation property of the L-type calcium channel, which is different from the traditional calcium ion inhibitor drug treatment, and improves the adjustability of the intracellular calcium ion concentration. Because most pathological states, such as hypertension, coronary heart disease, myocardial ischemia and the like, make myocardial cells in an oxidation stress state, at the moment, an L-type calcium ion channel is obviously activated, namely, in a resting state, the open probability of the channel is higher, the leakage of cell calcium is increased, the background calcium ion concentration of the cells is increased, and diseases are caused. Therefore, if the channel sensitivity of the L-type calcium channel can be regulated and controlled at the moment, rather than simply reducing the size of calcium ions flowing in the channel, the intracellular calcium ion concentration can be regulated and controlled more effectively and safely, so that the treatment effect is achieved.

Because the current regulation and control research aiming at the L-type calcium ion channel focuses on regulating and controlling the channel current (the number of calcium ions entering cells through the internal flow of the channel), the regulation and control of the negative amino acid cluster at the carboxyl terminal of the L-type calcium ion channel is discovered in the invention, so that the change of the channel activation property is influenced, and a brand-new controllable, more effective and safer disease treatment mechanism and direction are provided.

The foregoing is illustrative of the present invention and is not to be construed as limiting thereof. The practice of the present invention will employ, unless otherwise indicated, conventional techniques of organic chemistry, polymer chemistry, biotechnology and the like, and it will be apparent that the invention may be practiced otherwise than as specifically described in the foregoing description and examples. Other aspects and modifications within the scope of the invention will be apparent to those skilled in the art to which the invention pertains. Many modifications and variations are possible in light of the above teaching and are therefore within the scope of the invention.

The unit "degree" of temperature as used herein refers to degrees celsius, i.e., degrees celsius, unless otherwise indicated.

Sequence listing

<110> Beijing university

<120> methods of modulating calcium ion channel activity and uses thereof

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>2221

<212>PRT

<213> person ()

<400>1

Met Val Asn Glu Asn Thr Arg Met Tyr Ile Pro Glu Glu Asn His Gln

1 5 10 15

Gly Ser Asn Tyr Gly Ser Pro Arg Pro Ala His Ala Asn Met Asn Ala

20 25 30

Asn Ala Ala Ala Gly Leu Ala Pro Glu His Ile Pro Thr Pro Gly Ala

35 40 45

Ala Leu Ser Trp Gln Ala Ala Ile Asp Ala Ala Arg Gln Ala Lys Leu

50 55 60

Met Gly Ser Ala Gly Asn Ala Thr Ile Ser Thr Val Ser Ser Thr Gln

65 70 75 80

Arg Lys Arg Gln Gln Tyr Gly Lys Pro Lys Lys Gln Gly Ser Thr Thr

85 90 95

Ala Thr Arg Pro Pro Arg Ala Leu Leu Cys Leu Thr Leu Lys Asn Pro

100 105 110

Ile Arg Arg Ala Cys Ile Ser Ile Val Glu Trp Lys Pro Phe Glu Ile

115 120 125

Ile Ile Leu Leu Thr Ile Phe Ala Asn Cys Val Ala Leu Ala Ile Tyr

130 135 140

Ile Pro Phe Pro Glu Asp Asp Ser Asn Ala Thr Asn Ser Asn Leu Glu

145 150 155 160

Arg Val Glu Tyr Leu Phe Leu Ile Ile Phe Thr Val Glu Ala Phe Leu

165 170 175

Lys Val Ile Ala Tyr Gly Leu Leu Phe His Pro Asn Ala Tyr Leu Arg

180 185 190

Asn Gly Trp Asn Leu Leu Asp Phe Ile Ile Val Val Val Gly Leu Phe

195 200 205

Ser Ala Ile Leu Glu Gln Ala Thr Lys Ala Asp Gly Ala Asn Ala Leu

210 215 220

Gly Gly Lys Gly Ala Gly Phe Asp Val Lys Ala Leu Arg Ala Phe Arg

225 230 235 240

Val Leu Arg Pro Leu Arg Leu Val Ser Gly Val Pro Ser Leu Gln Val

245 250 255

Val Leu Asn Ser Ile Ile Lys Ala Met Val Pro Leu Leu His Ile Ala

260 265 270

Leu Leu Val Leu Phe Val Ile Ile Ile Tyr Ala Ile Ile Gly Leu Glu

275 280 285

Leu Phe Met Gly Lys Met His Lys Thr Cys Tyr Asn Gln Glu Gly Ile

290 295 300

Ala AspVal Pro Ala Glu Asp Asp Pro Ser Pro Cys Ala Leu Glu Thr

305 310 315 320

Gly His Gly Arg Gln Cys Gln Asn Gly Thr Val Cys Lys Pro Gly Trp

325 330 335

Asp Gly Pro Lys His Gly Ile Thr Asn Phe Asp Asn Phe Ala Phe Ala

340 345 350

Met Leu Thr Val Phe Gln Cys Ile Thr Met Glu Gly Trp Thr Asp Val

355 360 365

Leu Tyr Trp Val Asn Asp Ala Val Gly Arg Asp Trp Pro Trp Ile Tyr

370 375 380

Phe Val Thr Leu Ile Ile Ile Gly Ser Phe Phe Val Leu Asn Leu Val

385 390 395 400

Leu Gly Val Leu Ser Gly Glu Phe Ser Lys Glu Arg Glu Lys Ala Lys

405 410 415

Ala Arg Gly Asp Phe Gln Lys Leu Arg Glu Lys Gln Gln Leu Glu Glu

420 425 430

Asp Leu Lys Gly Tyr Leu Asp Trp Ile Thr Gln Ala Glu Asp Ile Asp

435 440 445

Pro Glu Asn Glu Asp Glu Gly Met Asp Glu Glu Lys Pro Arg Asn Met

450 455 460

Ser Met Pro ThrSer Glu Thr Glu Ser Val Asn Thr Glu Asn Val Ala

465 470 475 480

Gly Gly Asp Ile Glu Gly Glu Asn Cys Gly Ala Arg Leu Ala His Arg

485 490 495

Ile Ser Lys Ser Lys Phe Ser Arg Tyr Trp Arg Arg Trp Asn Arg Phe

500 505 510

Cys Arg Arg Lys Cys Arg Ala Ala Val Lys Ser Asn Val Phe Tyr Trp

515 520 525

Leu Val Ile Phe Leu Val Phe Leu Asn Thr Leu Thr Ile Ala Ser Glu

530 535 540

His Tyr Asn Gln Pro Asn Trp Leu Thr Glu Val Gln Asp Thr Ala Asn

545 550 555 560

Lys Ala Leu Leu Ala Leu Phe Thr Ala Glu Met Leu Leu Lys Met Tyr

565 570 575

Ser Leu Gly Leu Gln Ala Tyr Phe Val Ser Leu Phe Asn Arg Phe Asp

580 585 590

Cys Phe Val Val Cys Gly Gly Ile Leu Glu Thr Ile Leu Val Glu Thr

595 600 605

Lys Ile Met Ser Pro Leu Gly Ile Ser Val Leu Arg Cys Val Arg Leu

610 615 620

Leu Arg Ile Phe Lys IleThr Arg Tyr Trp Asn Ser Leu Ser Asn Leu

625 630 635 640

Val Ala Ser Leu Leu Asn Ser Val Arg Ser Ile Ala Ser Leu Leu Leu

645 650 655

Leu Leu Phe Leu Phe Ile Ile Ile Phe Ser Leu Leu Gly Met Gln Leu

660 665 670

Phe Gly Gly Lys Phe Asn Phe Asp Glu Met Gln Thr Arg Arg Ser Thr

675 680 685

Phe Asp Asn Phe Pro Gln Ser Leu Leu Thr Val Phe Gln Ile Leu Thr

690 695 700

Gly Glu Asp Trp Asn Ser Val Met Tyr Asp Gly Ile Met Ala Tyr Gly

705 710 715 720

Gly Pro Ser Phe Pro Gly Met Leu Val Cys Ile Tyr Phe Ile Ile Leu

725 730 735

Phe Ile Cys Gly Asn Tyr Ile Leu Leu Asn Val Phe Leu Ala Ile Ala

740 745 750

Val Asp Asn Leu Ala Asp Ala Glu Ser Leu Thr Ser Ala Gln Lys Glu

755 760 765

Glu Glu Glu Glu Lys Glu Arg Lys Lys Leu Ala Arg Thr Ala Ser Pro

770 775 780

Glu Lys Lys Gln Glu Leu Val GluLys Pro Ala Val Gly Glu Ser Lys

785 790 795 800

Glu Glu Lys Ile Glu Leu Lys Ser Ile Thr Ala Asp Gly Glu Ser Pro

805 810 815

Pro Ala Thr Lys Ile Asn Met Asp Asp Leu Gln Pro Asn Glu Asn Glu

820 825 830

Asp Lys Ser Pro Tyr Pro Asn Pro Glu Thr Thr Gly Glu Glu Asp Glu

835 840 845

Glu Glu Pro Glu Met Pro Val Gly Pro Arg Pro Arg Pro Leu Ser Glu

850 855 860

Leu His Leu Lys Glu Lys Ala Val Pro Met Pro Glu Ala Ser Ala Phe

865 870 875 880

Phe Ile Phe Ser Ser Asn Asn Arg Phe Arg Leu Gln Cys His Arg Ile

885 890 895

Val Asn Asp Thr Ile Phe Thr Asn Leu Ile Leu Phe Phe Ile Leu Leu

900 905 910

Ser Ser Ile Ser Leu Ala Ala Glu Asp Pro Val Gln His Thr Ser Phe

915 920 925

Arg Asn His Ile Leu Phe Tyr Phe Asp Ile Val Phe Thr Thr Ile Phe

930 935 940

Thr Ile Glu Ile Ala Leu Lys Ile Leu GlyAsn Ala Asp Tyr Val Phe

945 950 955 960

Thr Ser Ile Phe Thr Leu Glu Ile Ile Leu Lys Met Thr Ala Tyr Gly

965 970 975

Ala Phe Leu His Lys Gly Ser Phe Cys Arg Asn Tyr Phe Asn Ile Leu

980 985 990

Asp Leu Leu Val Val Ser Val Ser Leu Ile Ser Phe Gly Ile Gln Ser

995 1000 1005

Ser Ala Ile Asn Val Val Lys Ile Leu Arg Val Leu Arg Val Leu Arg

1010 1015 1020

Pro Leu Arg Ala Ile Asn Arg Ala Lys Gly Leu Lys His Val Val Gln

1025 1030 1035 1040

Cys Val Phe Val Ala Ile Arg Thr Ile Gly Asn Ile Val Ile Val Thr

1045 1050 1055

Thr Leu Leu Gln Phe Met Phe Ala Cys Ile Gly Val Gln Leu Phe Lys

1060 1065 1070

Gly Lys Leu Tyr Thr Cys Ser Asp Ser Ser Lys Gln Thr Glu Ala Glu

1075 1080 1085

Cys Lys Gly Asn Tyr Ile Thr Tyr Lys Asp Gly Glu Val Asp His Pro

1090 1095 1100

Ile Ile Gln Pro ArgSer Trp Glu Asn Ser Lys Phe Asp Phe Asp Asn

1105 1110 1115 1120

Val Leu Ala Ala Met Met Ala Leu Phe Thr Val Ser Thr Phe Glu Gly

1125 1130 1135

Trp Pro Glu Leu Leu Tyr Arg Ser Ile Asp Ser His Thr Glu Asp Lys

1140 1145 1150

Gly Pro Ile Tyr Asn Tyr Arg Val Glu Ile Ser Ile Phe Phe Ile Ile

1155 1160 1165

Tyr Ile Ile Ile Ile Ala Phe Phe Met Met Asn Ile Phe Val Gly Phe

1170 1175 1180

Val Ile Val Thr Phe Gln Glu Gln Gly Glu Gln Glu Tyr Lys Asn Cys

1185 1190 1195 1200

Glu Leu Asp Lys Asn Gln Arg Gln Cys Val Glu Tyr Ala Leu Lys Ala

1205 1210 1215

Arg Pro Leu Arg Arg Tyr Ile Pro Lys Asn Gln His Gln Tyr Lys Val

1220 1225 1230

Trp Tyr Val Val Asn Ser Thr Tyr Phe Glu Tyr Leu Met Phe Val Leu

1235 1240 1245

Ile Leu Leu Asn Thr Ile Cys Leu Ala Met Gln His Tyr Gly Gln Ser

1250 1255 1260

Cys Leu Phe Lys Ile Ala Met Asn Ile Leu Asn Met Leu Phe Thr Gly

1265 1270 1275 1280

Leu Phe Thr Val Glu Met Ile Leu Lys Leu Ile Ala Phe Lys Pro Lys

1285 1290 1295

Gly Tyr Phe Ser Asp Pro Trp Asn Val Phe Asp Phe Leu Ile Val Ile

1300 1305 1310

Gly Ser Ile Ile Asp Val Ile Leu Ser Glu Thr Asn His Tyr Phe Cys

1315 1320 1325

Asp Ala Trp Asn Thr Phe Asp Ala Leu Ile Val Val Gly Ser Ile Val

1330 1335 1340

Asp Ile Ala Ile Thr Glu Val Asn Pro Ala Glu His Thr Gln Cys Ser

1345 1350 1355 1360

Pro Ser Met Asn Ala Glu Glu Asn Ser Arg Ile Ser Ile Thr Phe Phe

1365 1370 1375

Arg Leu Phe Arg Val Met Arg Leu Val Lys Leu Leu Ser Arg Gly Glu

1380 1385 1390

Gly Ile Arg Thr Leu Leu Trp Thr Phe Ile Lys Ser Phe Gln Ala Leu

1395 1400 1405

Pro Tyr Val Ala Leu Leu Ile Val Met Leu Phe Phe Ile Tyr Ala Val

1410 1415 1420

Ile Gly Met Gln Val Phe Gly Lys Ile Ala Leu Asn Asp Thr Thr Glu

1425 1430 1435 1440

Ile Asn Arg Asn Asn Asn Phe Gln Thr Phe Pro Gln Ala Val Leu Leu

1445 1450 1455

Leu Phe Arg Cys Ala Thr Gly Glu Ala Trp Gln Asp Ile Met Leu Ala

1460 1465 1470

Cys Met Pro Gly Lys Lys Cys Ala Pro Glu Ser Glu Pro Ser Asn Ser

1475 1480 1485

Thr Glu Gly Glu Thr Pro Cys Gly Ser Ser Phe Ala Val Phe Tyr Phe

1490 1495 1500

Ile Ser Phe Tyr Met Leu Cys Ala Phe Leu Ile Ile Asn Leu Phe Val

1505 1510 1515 1520

Ala Val Ile Met Asp Asn Phe Asp Tyr Leu Thr Arg Asp Trp Ser Ile

1525 1530 1535

Leu Gly Pro His His Leu Asp Glu Phe Lys Arg Ile Trp Ala Glu Tyr

1540 1545 1550

Asp Pro Glu Ala Lys Gly Arg Ile Lys His Leu Asp Val Val Thr Leu

1555 1560 1565

Leu Arg Arg Ile Gln Pro Pro Leu Gly Phe Gly Lys Leu Cys Pro His

15701575 1580

Arg Val Ala Cys Lys Arg Leu Val Ser Met Asn Met Pro Leu Asn Ser

1585 1590 1595 1600

Asp Gly Thr Val Met Phe Asn Ala Thr Leu Phe Ala Leu Val Arg Thr

1605 1610 1615

Ala Leu Arg Ile Lys Thr Glu Gly Asn Leu Glu Gln Ala Asn Glu Glu

1620 1625 1630

Leu Arg Ala Ile Ile Lys Lys Ile Trp Lys Arg Thr Ser Met Lys Leu

1635 1640 1645

Leu Asp Gln Val Val Pro Pro Ala Gly Asp Asp Glu Val Thr Val Gly

1650 1655 1660

Lys Phe Tyr Ala Thr Phe Leu Ile Gln Glu Tyr Phe Arg Lys Phe Lys

1665 1670 1675 1680

Lys Arg Lys Glu Gln Gly Leu Val Gly Lys Pro Ser Gln Arg Asn Ala

1685 1690 1695

Leu Ser Leu Gln Ala Gly Leu Arg Thr Leu His Asp Ile Gly Pro Glu

1700 1705 1710

Ile Arg Arg Ala Ile Ser Gly Asp Leu Thr Ala Glu Glu Glu Leu Asp

1715 1720 1725

Lys Ala Met Lys Glu Ala Val Ser Ala Ala Ser Glu Asp Asp Ile Phe

1730 1735 1740

Arg Arg Ala Gly Gly Leu Phe Gly Asn His Val Ser Tyr Tyr Gln Ser

1745 1750 1755 1760

Asp Gly Arg Ser Ala Phe Pro Gln Thr Phe Thr Thr Gln Arg Pro Leu

1765 1770 1775

His Ile Asn Lys Ala Gly Ser Ser Gln Gly Asp Thr Glu Ser Pro Ser

1780 1785 1790

His Glu Lys Leu Val Asp Ser Thr Phe Thr Pro Ser Ser Tyr Ser Ser

1795 1800 1805

Thr Gly Ser Asn Ala Asn Ile Asn Asn Ala Asn Asn Thr Ala Leu Gly

1810 1815 1820

Arg Leu Pro Arg Pro Ala Gly Tyr Pro Ser Thr Val Ser Thr Val Glu

1825 1830 1835 1840

Gly His Gly Pro Pro Leu Ser Pro Ala Ile Arg Val Gln Glu Val Ala

1845 1850 1855

Trp Lys Leu Ser Ser Asn Arg Glu Arg His Val Pro Met Cys Glu Asp

1860 1865 1870

Leu Glu Leu Arg Arg Asp Ser Gly Ser Ala Gly Thr Gln Ala His Cys

1875 1880 1885

Leu Leu Leu Arg Lys Ala Asn Pro Ser Arg Cys His Ser Arg Glu Ser

1890 1895 1900

Gln Ala Ala Met Ala Gly Gln Glu Glu Thr Ser Gln Asp Glu Thr Tyr

1905 1910 1915 1920

Glu Val Lys Met Asn His Asp Thr Glu Ala Cys Ser Glu Pro Ser Leu

1925 1930 1935

Leu Ser Thr Glu Met Leu Ser Tyr Gln Asp Asp Glu Asn Arg Gln Leu

1940 1945 1950

Thr Leu Pro Glu Glu Asp Lys Arg Asp Ile Arg Gln Ser Pro Lys Arg

1955 1960 1965

Gly Phe Leu Arg Ser Ala Ser Leu Gly Arg Arg Ala Ser Phe His Leu

1970 1975 1980

Glu Cys Leu Lys Arg Gln Lys Asp Arg Gly Gly Asp Ile Ser Gln Lys

1985 1990 1995 2000

Thr Val Leu Pro Leu His Leu Val His His Gln Ala Leu Ala Val Ala

2005 2010 2015

Gly Leu Ser Pro Leu Leu Gln Arg Ser His Ser Pro Ala Ser Phe Pro

2020 2025 2030

Arg Pro Phe Ala Thr Pro Pro Ala Thr Pro Gly Ser Arg Gly Trp Pro

2035 2040 2045

Pro Gln Pro Val Pro Thr LeuArg Leu Glu Gly Val Glu Ser Ser Glu

2050 2055 2060

Lys Leu Asn Ser Ser Phe Pro Ser Ile His Cys Gly Ser Trp Ala Glu

2065 2070 2075 2080

Thr Thr Pro Gly Gly Gly Gly Ser Ser Ala Ala Arg Arg Val Arg Pro

2085 2090 2095

Val Ser Leu Met Val Pro Ser Gln Ala Gly Ala Pro Gly Arg Gln Phe

2100 2105 2110

His Gly Ser Ala Ser Ser Leu Val Glu Ala Val Leu Ile Ser Glu Gly

2115 2120 2125

Leu Gly Gln Phe Ala Gln Asp Pro Lys Phe Ile Glu Val Thr Thr Gln

2130 2135 2140

Glu Leu Ala Asp Ala Cys Asp Met Thr Ile Glu Glu Met Glu Ser Ala

2145 2150 2155 2160

Ala Asp Asn Ile Leu Ser Gly Gly Ala Pro Gln Ser Pro Asn Gly Ala

2165 2170 2175

Leu Leu Pro Phe Val Asn Cys Arg Asp Ala Gly Gln Asp Arg Ala Gly

2180 2185 2190

Gly Glu Glu Asp Ala Gly Cys Val Arg Ala Arg Gly Arg Pro Ser Glu

2195 2200 2205

Glu Glu Leu Gln Asp Ser Arg Val Tyr Val Ser Ser Leu

2210 2215 2220

<210>2

<211>2169

<212>PRT

<213> rat ()

<400>2

Met Ile Arg Ala Phe Ala Gln Pro Ser Thr Pro Pro Tyr Gln Pro Leu

1 5 10 15

Ser Ser Cys Leu Ser Glu Asp Thr Glu Arg Lys Phe Lys Gly Lys Val

20 25 30

Val His Glu Ala Gln Leu Asn Cys Phe Tyr Ile Ser Pro Gly Gly Ser

35 40 45

Asn Tyr Gly Ser Pro Arg Pro Ala His Ala Asn Met Asn Ala Asn Ala

50 55 60

Ala Ala Gly Leu Ala Pro Glu His Ile Pro Thr Pro Gly Ala Ala Leu

65 70 75 80

Ser Trp Leu Ala Ala Ile Asp Ala Ala Arg Gln Ala Lys Leu Met Gly

85 90 95

Ser Ala Gly Asn Ala Thr Ile Ser Thr Val Ser Ser Thr Gln Arg Lys

100 105 110

Arg Gln Gln Tyr Gly Lys Pro Lys Lys Gln Gly Gly Thr Thr Ala Thr

115120 125

Arg Pro Pro Arg Ala Leu Leu Cys Leu Thr Leu Lys Asn Pro Ile Arg

130 135 140

Arg Ala Cys Ile Ser Ile Val Glu Trp Lys Pro Phe Glu Ile Ile Ile

145 150 155 160

Leu Leu Thr Ile Phe Ala Asn Cys Val Ala Leu Ala Ile Tyr Ile Pro

165 170 175

Phe Pro Glu Asp Asp Ser Asn Ala Thr Asn Ser Asn Leu Glu Arg Val

180 185 190

Glu Tyr Leu Phe Leu Ile Ile Phe Thr Val Glu Ala Phe Leu Lys Val

195 200 205

Ile Ala Tyr Gly Leu Leu Phe His Pro Asn Ala Tyr Leu Arg Asn Gly

210 215 220

Trp Asn Leu Leu Asp Phe Ile Ile Val Val Val Gly Leu Phe Ser Ala

225 230 235 240

Ile Leu Glu Gln Ala Thr Lys Ala Asp Gly Ala Asn Ala Leu Gly Gly

245 250 255

Lys Gly Ala Gly Phe Asp Val Lys Ala Leu Arg Ala Phe Arg Val Leu

260 265 270

Arg Pro Leu Arg Leu Val Ser Gly Val Pro Ser Leu Gln Val Val Leu

275 280285

Asn Ser Ile Ile Lys Ala Met Val Pro Leu Leu His Ile Ala Leu Leu

290 295 300

Val Leu Phe Val Ile Ile Ile Tyr Ala Ile Ile Gly Leu Glu Leu Phe

305 310 315 320

Met Gly Lys Met His Lys Thr Cys Tyr Asn Gln Glu Gly Ile Ile Asp

325 330 335

Val Pro Ala Glu Glu Asp Pro Ser Pro Cys Ala Leu Glu Thr Gly His

340 345 350

Gly Arg Gln Cys Gln Asn Gly Thr Val Cys Lys Pro Gly Trp Asp Gly

355 360 365

Pro Lys His Gly Ile Thr Asn Phe Asp Asn Phe Ala Phe Ala Met Leu

370 375 380

Thr Val Phe Gln Cys Ile Thr Met Glu Gly Trp Thr Asp Val Leu Tyr

385 390 395 400

Trp Met Gln Asp Ala Met Gly Tyr Glu Leu Pro Trp Val Tyr Phe Val

405 410 415

Ser Leu Val Ile Phe Gly Ser Phe Phe Val Leu Asn Leu Val Leu Gly

420 425 430

Val Leu Ser Gly Glu Phe Ser Lys Glu Arg Glu Lys Ala Lys Ala Arg

435 440445

Gly Asp Phe Gln Lys Leu Arg Glu Lys Gln Gln Leu Glu Glu Asp Leu

450 455 460

Lys Gly Tyr Leu Asp Trp Ile Thr Gln Ala Glu Asp Ile Asp Pro Glu

465 470 475 480

Asn Glu Asp Glu Gly Met Asp Glu Asp Lys Pro Arg Asn Met Ser Met

485 490 495

Pro Thr Ser Glu Thr Glu Ser Val Asn Thr Glu Asn Val Ala Gly Gly

500 505 510

Asp Ile Glu Gly Glu Asn Cys Gly Ala Arg Leu Ala His Arg Ile Ser

515 520 525

Lys Ser Lys Phe Ser Arg Tyr Trp Arg Arg Trp Asn Arg Phe Cys Arg

530 535 540

Arg Lys Cys Arg Ala Ala Val Lys Ser Asn Val Phe Tyr Trp Leu Val

545 550 555 560

Ile Phe Leu Val Phe Leu Asn Thr Leu Thr Ile Ala Ser Glu His Tyr

565 570 575

Asn Gln Pro His Trp Leu Thr Glu Val Gln Asp Thr Ala Asn Lys Ala

580 585 590

Leu Leu Ala Leu Phe Thr Ala Glu Met Leu Leu Lys Met Tyr Ser Leu

595 600 605

Gly Leu Gln Ala Tyr Phe Val Ser Leu Phe Asn Arg Phe Asp Cys Phe

610 615 620

Ile Val Cys Gly Gly Ile Leu Glu Thr Ile Leu Val Glu Thr Lys Ile

625 630 635 640

Met Ser Pro Leu Gly Ile Ser Cys Trp Arg Cys Val Arg Leu Leu Arg

645 650 655

Ile Phe Lys Ile Thr Arg Tyr Trp Asn Ser Leu Ser Asn Leu Val Ala

660 665 670

Ser Leu Leu Asn Ser Leu Arg Ser Ile Ala Ser Leu Leu Leu Leu Leu

675 680 685

Phe Leu Phe Ile Ile Ile Phe Ser Leu Leu Gly Met Gln Leu Phe Gly

690 695 700

Gly Lys Phe Asn Phe Asp Glu Met Gln Thr Arg Arg Ser Thr Phe Asp

705 710 715 720

Asn Phe Pro Gln Ser Leu Leu Thr Val Phe Gln Ile Leu Thr Gly Glu

725 730 735

Asp Trp Asn Ser Val Met Tyr Asp Gly Ile Met Ala Tyr Gly Gly Pro

740 745 750

Ser Phe Pro Gly Met Leu Val Cys Ile Tyr Phe Ile Ile Leu Phe Ile

755 760 765

Ser Pro Asn Tyr Ile Leu Leu Asn Leu Phe Leu Ala Ile Ala Val Asp

770 775 780

Asn Leu Ala Asp Ala Glu Ser Leu Thr Ser Ala Gln Lys Glu Glu Glu

785 790 795 800

Glu Glu Lys Glu Arg Lys Lys Leu Ala Arg Thr Ala Ser Pro Glu Lys

805 810 815

Lys Gln Glu Val Met Glu Lys Pro Ala Val Glu Glu Ser Lys Glu Glu

820 825 830

Lys Ile Glu Leu Lys Ser Ile Thr Ala Asp Gly Glu Ser Pro Pro Thr

835 840 845

Thr Lys Ile Asn Met Asp Asp Leu Gln Pro Ser Glu Asn Glu Asp Lys

850 855 860

Ser Pro His Ser Asn Pro Asp Thr Ala Gly Glu Glu Asp Glu Glu Glu

865 870 875 880

Pro Glu Met Pro Val Gly Pro Arg Pro Arg Pro Leu Ser Glu Leu His

885 890 895

Leu Lys Glu Lys Ala Val Pro Met Pro Glu Ala Ser Ala Phe Phe Ile

900 905 910

Phe Ser Pro Asn Asn Arg Phe Arg Leu Gln Cys His Arg Ile Val Asn

915 920 925

Asp Thr Ile Phe Thr Asn Leu Ile Leu Phe Phe Ile Leu Leu Ser Ser

930 935 940

Ile Ser Leu Ala Ala Glu Asp Pro Val Gln His Thr Ser Phe Arg Asn

945 950 955 960

His Ile Leu Phe Tyr Phe Asp Ile Val Phe Thr Thr Ile Phe Thr Ile

965 970 975

Glu Ile Ala Leu Lys Met Thr Ala Tyr Gly Ala Phe Leu His Lys Gly

980 985 990

Ser Phe Cys Arg Asn Tyr Phe Asn Ile Leu Asp Leu Leu Val Val Ser

995 1000 1005

Val Ser Leu Ile Ser Phe Gly Ile Gln Ser Ser Ala Ile Asn Val Val

1010 1015 1020

Lys Ile Leu Arg Val Leu Arg Val Leu Arg Pro Leu Arg Ile Asn Arg

1025 1030 1035 1040

Ala Lys Gly Leu Lys His Val Val Gln Cys Val Phe Val Ala Ile Arg

1045 1050 1055

Thr Ile Gly Asn Ile Val Ile Val Thr Thr Leu Leu Gln Phe Met Phe

1060 1065 1070

Ala Cys Ile Gly Val Gln Leu Phe Lys Gly Lys Leu Tyr Thr Cys Ser

1075 1080 1085

Asp Ser Ser Lys Gln Thr Glu Ala Glu Ser Lys Gly Asn Tyr Ile Thr

1090 1095 1100

Tyr Lys Thr Gly Glu Val Asp His Pro Ile Ile Gln Pro Arg Ser Trp

1105 1110 1115 1120

Glu Asn Ser Lys Phe Asp Phe Asp Asn Val Leu Ala Ala Met Met Ala

1125 1130 1135

Leu Phe Thr Val Ser Thr Phe Glu Gly Trp Pro Glu Leu Leu Tyr Arg

1140 1145 1150

Ser Ile Asp Ser His Thr Glu Asp Lys Gly Pro Ile Tyr Asn Tyr Arg

1155 1160 1165

Val Glu Ile Ser Ile Phe Phe Ile Ile Tyr Ile Ile Ile Ile Ala Phe

1170 1175 1180

Phe Met Met Asn Ile Phe Val Gly Phe Val Ile Val Thr Phe Gln Glu

1185 1190 1195 1200

Gln Gly Glu Gln Glu Tyr Lys Asn Cys Glu Leu Asp Lys Asn Gln Arg

1205 1210 1215

Gln Cys Val Glu Tyr Ala Leu Lys Ala Arg Pro Leu Pro Arg Tyr Ile

1220 1225 1230

Pro Lys Asn Gln His Gln Tyr Lys Val Trp Tyr Val Val Asn Ser Thr

12351240 1245

Tyr Phe Glu Tyr Leu Met Phe Val Leu Ile Leu Leu Asn Thr Ile Cys

1250 1255 1260

Leu Ala Met Gln His Tyr Gly Gln Ser Cys Leu Phe Lys Ile Ala Met

1265 1270 1275 1280

Asn Ile Leu Asn Met Leu Phe Thr Gly Leu Phe Thr Val Glu Met Ile

1285 1290 1295

Leu Lys Leu Ile Ala Phe Lys Pro Lys His Tyr Phe Cys Asp Ala Trp

1300 1305 1310

Asn Thr Phe Asp Ala Leu Ile Val Val Gly Ser Ile Val Asp Ile Ala

1315 1320 1325

Ile Thr Glu Val His Pro Ala Glu His Thr Gln Cys Ser Pro Ser Met

1330 1335 1340

Ser Ala Glu Glu Asn Ser Arg Ile Ser Ile Thr Phe Phe Arg Leu Phe

1345 1350 1355 1360

Arg Val Met Arg Leu Val Lys Leu Leu Ser Arg Gly Glu Gly Ile Arg

1365 1370 1375

Thr Leu Leu Trp Thr Phe Ile Lys Ser Phe Gln Ala Leu Pro Tyr Val

1380 1385 1390

Ala Leu Leu Ile Val Met Leu Phe Phe Ile Tyr Ala Val Ile Gly Met

1395 1400 1405

Gln Val Phe Gly Lys Ile Ala Leu Asn Asp Thr Thr Glu Ile Asn Arg

1410 1415 1420

Asn Asn Asn Phe Gln Thr Phe Pro Gln Ala Val Leu Leu Leu Phe Arg

1425 1430 1435 1440

Cys Ala Thr Gly Glu Ala Trp Gln Asp Ile Met Leu Ala Cys Met Pro

1445 1450 1455

Gly Lys Lys Cys Ala Pro Glu Ser Glu Pro Ser Asn Ser Thr Glu Gly

1460 1465 1470

Glu Thr Pro Cys Gly Ser Ser Phe Ala Val Phe Tyr Phe Ile Ser Phe

1475 1480 1485

Tyr Met Leu Cys Ala Phe Leu Ile Ile Asn Leu Phe Val Ala Val Ile

1490 1495 1500

Met Asp Asn Phe Asp Tyr Leu Thr Arg Asp Trp Ser Ile Leu Gly Pro

1505 1510 1515 1520

His His Leu Asp Glu Phe Lys Arg Ile Trp Ala Glu Tyr Asp Pro Glu

1525 1530 1535

Ala Lys Gly Arg Ile Lys His Leu Asp Val Val Thr Leu Leu Arg Arg

1540 1545 1550

Ile Gln Pro Pro Leu Gly Phe Gly Lys Leu Cys Pro His Arg Val Ala

1555 1560 1565

Cys Lys Arg Leu Val Ser Met Asn Met Pro Leu Asn Ser Asp Gly Thr

1570 1575 1580

Val Met Phe Asn Ala Thr Leu Phe Ala Leu Val Arg Thr Ala Leu Arg

1585 1590 1595 1600

Ile Lys Thr Glu Gly Asn Leu Glu Gln Ala Asn Glu Glu Leu Arg Ala

1605 1610 1615

Ile Ile Lys Lys Ile Trp Lys Arg Thr Ser Met Lys Leu Leu Asp Gln

1620 1625 1630

Val Val Pro Pro Ala Gly Asp Asp Glu Val Thr Val Gly Lys Phe Tyr

1635 1640 1645

Ala Thr Phe Leu Ile Gln Glu Tyr Phe Arg Lys Phe Lys Lys Arg Lys

1650 1655 1660

Glu Gln Gly Leu Val Gly Lys Pro Ser Gln Arg Asn Ala Leu Ser Leu

1665 1670 1675 1680

Gln Ala Gly Leu Arg Thr Leu His Asp Ile Gly Pro Glu Ile Arg Arg

1685 1690 1695

Ala Ile Ser Gly Asp Leu Thr Ala Glu Glu Glu Leu Asp Lys Ala Met

1700 1705 1710

Lys Glu Ala Val Ser Ala Ala SerGlu Asp Asp Ile Phe Arg Arg Ala

1715 1720 1725

Gly Gly Leu Phe Gly Asn His Val Ser Tyr Tyr Gln Ser Asp Ser Arg

1730 1735 1740

Ser Asn Phe Pro Gln Thr Phe Ala Thr Gln Arg Pro Leu His Ile Asn

1745 1750 1755 1760

Lys Thr Gly Asn Asn Gln Ala Asp Thr Glu Ser Pro Ser His Glu Lys

1765 1770 1775

Leu Val Asp Ser Thr Phe Thr Pro Ser Ser Tyr Ser Ser Thr Gly Ser

1780 1785 1790

Asn Ala Asn Ile Asn Asn Ala Asn Asn Thr Ala Leu Gly Arg Phe Pro

1795 1800 1805

His Pro Ala Gly Tyr Ser Ser Thr Val Ser Thr Val Glu Gly His Gly

1810 1815 1820

Pro Pro Leu Ser Pro Ala Val Arg Val Gln Glu Ala Ala Trp Lys Leu

1825 1830 1835 1840

Ser Ser Lys Arg Cys His Ser Arg Glu Ser Gln Gly Ala Thr Val Ser

1845 1850 1855

Gln Asp Met Phe Pro Asp Glu Thr Arg Ser Ser Val Arg Leu Ser Glu

1860 1865 1870

Glu Val Glu Tyr Cys Ser Glu Pro Ser Leu Leu Ser Thr Asp Ile Leu

1875 1880 1885

Ser Tyr Gln Asp Asp Glu Asn Arg Gln Leu Thr Cys Leu Glu Glu Asp

1890 1895 1900

Lys Arg Glu Ile Gln Pro Cys Pro Lys Arg Ser Phe Leu Arg Ser Ala

1905 1910 1915 1920

Ser Leu Gly Arg Arg Ala Ser Phe His Leu Glu Cys Leu Lys Arg Gln

1925 1930 1935

Lys Asp Gln Gly Gly Asp Ile Ser Gln Lys Thr Ala Leu Pro Leu His

1940 1945 1950

Leu Val His His Gln Ala Leu Ala Val Ala Gly Leu Ser Pro Leu Leu

1955 1960 1965

Gln Arg Ser His Ser Pro Ser Thr Phe Pro Arg Pro Arg Pro Thr Pro

1970 1975 1980

Pro Val Thr Pro Gly Ser Arg Gly Arg Pro Leu Gln Pro Ile Pro Thr

1985 1990 1995 2000

Leu Arg Leu Glu Gly Ala Glu Ser Ser Glu Lys Leu Asn Ser Ser Phe

2005 2010 2015

Pro Ser Ile His Cys Ser Ser Trp Ser Glu Glu Thr Thr Ala Cys Ser

2020 2025 2030

Gly Gly Ser Ser Met Ala Arg Arg Ala Arg Pro Val Ser Leu Thr Val

2035 2040 2045

Pro Ser Gln Ala Gly Ala Pro Gly Arg Gln Phe His Gly Ser Ala Ser

2050 2055 2060

Ser Leu Val Glu Ala Val Leu Ile Ser Glu Gly Leu Gly Gln Phe Ala

2065 2070 2075 2080

Gln Asp Pro Lys Phe Ile Glu Val Thr Thr Gln Glu Leu Ala Asp Ala

2085 2090 2095

Cys Asp Met Thr Ile Glu Glu Met Glu Asn Ala Ala Asp Asn Ile Leu

2100 2105 2110

Ser Gly Gly Ala Gln Gln Ser Pro Asn Gly Thr Leu Leu Pro Phe Val

2115 2120 2125

Asn Cys Arg Asp Pro Gly Gln Asp Arg Ala Val Val Pro Glu Asp Glu

2130 2135 2140

Ser Cys Val Tyr Ala Leu Gly Arg Gly Arg Ser Glu Glu Ala Leu Pro

2145 2150 2155 2160

Asp Ser Arg Ser Tyr Val Ser Asn Leu

2165

Claims

1. A method for regulating calcium ion influx in cardiac muscle cells of a mammal, which comprises modifying one amino acid residue or a combination of any plurality of amino acid residues in ESSE with 2061-position 2064 in the amino acid sequence with the corresponding sequence of the L-type calpain protein as SEQ ID No.1, preferably modifying serine with 2061-position and/or 2062-position in the amino acid sequence with the corresponding sequence of the L-type calpain protein as SEQ ID No. 1.

2. The method according to claim 1, wherein the modification is a change in the charge property of the amino acid residues of the ESSE at position 2061-2064, preferably a change in the electronegative property of any combination of one or more amino acid residues in the ESSE to a non-electronegative property, e.g.to charge neutrality or electropositivity.

3. The method of claim 1, wherein the modification is a phosphorylation modification,

preferably, wherein the phosphorylation modification is phosphorylation by a kinase, for example phosphorylation by oxikinase (oxidative stress protein kinase);

or

Preferably, wherein the phosphorylation modification is dephosphorylation by a phosphatase, e.g. by oxiphatase (oxidative stress phosphatase);

or

More preferably, it further comprises modulating the kinase or phosphatase by:

a. a kinase or phosphatase inhibitor, e.g. an interfering RNA or precursor thereof that interferes with the expression of said kinase or phosphatase, or an antibody specific for said kinase or phosphatase, including a polyclonal or monoclonal antibody, or a mutant kinase or phosphatase protein or a coding sequence thereof that results in a decrease in activity;

b. the kinase or phosphatase agonist; or

c. Overexpresses the kinase or phosphatase.

4. The method of claim 1, wherein the modification is a point mutation, preferably the serine is mutated to a non-polar amino acid or a basic amino acid, more preferably to isoleucine or alanine.

5. Use of an agent which modifies an amino acid residue or a combination of any more amino acid residues in ESSE having 2061-2064 in the amino acid sequence corresponding to L-type calcium channel protein of SEQ ID No.1 for the preparation of a medicament for modulating calcium ion influx in cardiac myocytes of a mammal or for treating cardiovascular diseases, preferably wherein said agent is an agent which modifies serine having 2062-position and/or 2063-position in the amino acid sequence corresponding to L-type calcium channel protein of SEQ ID No. 1.

6. The use according to claim 5, wherein the agent that modifies a combination of one or any plurality of amino acid residues in the ESSE at position 2061-2064 is an agent that specifically modifies said one or any plurality of amino acid residues.

7. The use of claim 5, wherein the agent is an agent that specifically phosphorylates the serine of L-type calcium channel protein,

preferably, the agent is a kinase, for example oxikinase;

alternatively, the first and second electrodes may be,

preferably wherein the agent is a phosphatase, for example oxiphatase;

or

More preferably, wherein the agent is:

b. a kinase or phosphatase agonist;

c. an agent that overexpresses the kinase or phosphatase.

An L-type calcium channel modulator which is an agent specifically modifying one amino acid residue or a combination of any plurality of amino acid residues in ESSE having the amino acid sequence of 2061-2064 in the corresponding sequence of the L-type calcium channel protein of SEQ ID No.1, preferably wherein said agent is an agent specifically modifying serine having the amino acid sequence of 2062-position and/or 2063-position in the corresponding sequence of the L-type calcium channel protein of SEQ ID No. 1.

9. The modulator of claim 8, wherein the agent is a kinase, such as oxikinase; or

Wherein the agent is a phosphatase, such as oxiphatase;

or

Wherein the reagent is:

a. kinase or phosphatase inhibitors, e.g. interfering RNA or precursors thereof interfering with the expression of said kinase or phosphatase, or antibodies specific for said kinase or phosphatase, including polyclonal or monoclonal antibodies;

b. an agonist of said kinase or phosphatase;

c. the kinase or phosphatase overexpressed.

10. Pharmaceutical composition for the treatment of cardiovascular diseases comprising an L-type calcium channel modulator according to claim 8 or 9, which is an agent specifically modifying the ESSE at position 2061-2064 in the amino acid sequence corresponding to the L-type calcium channel protein of SEQ ID No. 1.

11. The pharmaceutical composition of claim 10, wherein the cardiovascular disease is selected from the group consisting of: atrial and ventricular arrhythmias, heart failure (including congestive heart failure, diastolic heart failure, systolic heart failure, acute heart failure), prinzmelto (variant) angina, stable and unstable angina, exercise-induced angina, congestive heart disease, ischemia, recurrent ischemia, reperfusion injury, myocardial infarction, acute coronary syndrome, peripheral arterial disease, pulmonary hypertension.

12. A method of screening for an oxidaise or oxisphotase, comprising the steps of:

(2) detecting whether the expression of the kinase or the phosphatase is changed or not under the condition of hypoxia, and whether the serine at the 2062 th site and/or the 2063 th site of the amino acid sequence of the L-type calcium channel protein with the corresponding sequence of SEQ ID No.1 is subjected to phosphorylation modification or not;

preferably, the method further comprises the following steps: (3) detecting the calcium ion flux of said mammalian cell.