CN111067894A

CN111067894A - Application of miconazole in preparation of anti-squamous-lung-carcinoma drug and cisplatin sensitizer

Info

Publication number: CN111067894A
Application number: CN202010038096.6A
Authority: CN
Inventors: 刘冰; 张伟楠; 张陆勇
Original assignee: Guangdong Pharmaceutical University
Current assignee: Guangdong Pharmaceutical University
Priority date: 2020-01-14
Filing date: 2020-01-14
Publication date: 2020-04-28

Abstract

The invention discloses an application of an antifungal drug miconazole in preparing an anti-squamous-lung-carcinoma drug and a cisplatin sensitizer. Because patients with squamous cell lung carcinoma have poor response to common chemotherapeutic drugs and lack of drugs for clinically treating squamous cell lung carcinoma, the development of effective therapeutic drugs is urgently needed. The invention combines the new concept of old medicine, screens the azole antifungal medicines commonly used in clinic and selects the miconazole with the best effect for research. Repeated experiments show that miconazole can reduce active oxygen in cells by inhibiting a PI3K/Akt/NOX4 channel so as to induce apoptosis of squamous cell carcinoma cells and sensitize cisplatin. Meanwhile, in vivo experiments of nude mice also prove that the miconazole has the function of resisting squamous cell lung carcinoma and the effect of sensitizing cisplatin. The invention provides a certain reference for the clinical administration of patients with squamous cell lung carcinoma, and clarifies a mechanism of miconazole for treating squamous cell lung carcinoma.

Description

Application of miconazole in preparation of anti-squamous-lung-carcinoma drug and cisplatin sensitizer

Technical Field

The invention relates to application of miconazole in preparing an anti-squamous-lung-carcinoma medicament, and also relates to application of miconazole in preparing a cis-platinum sensitizer, belonging to the technical field of medicaments.

Background

Lung cancer is one of the most common human malignancies in the world today, with morbidity and mortality among the many cancers. Lung cancer is mainly classified into Small Cell Lung Cancer (SCLC) and non-small cell lung cancer (NSCLC), in which non-small cell lung cancer accounts for 85% of diagnosed lung cancer and squamous cell carcinoma accounts for 30% thereof. However, patients with squamous cell lung carcinoma have consistently poor therapeutic response to conventional targeted and chemotherapeutic drugs. Because of the lack of drugs for clinically treating squamous cell lung carcinoma, the development of effective therapeutic drugs is urgently needed.

The new strategy of old drugs is a shortcut for the current drug research and development, which can not only ensure the safety of the drugs, but also avoid the long development and screening cycle of new drugs. The latest review of the study published in the journal of clinical pharmacy (J Clin Pharm therm., IF 8.060) indicates that: with the development of pharmacology and genomics, many old drugs have activity on novel anti-cancer targets, and non-anti-tumor old drugs which are applied for a long time in clinic are applied to the new anti-tumor field, so that effective drugs can be safely and effectively screened.

In recent years, many studies have shown that antifungal drugs have certain effects on tumor treatment. A recent article published in the journal of Experimental Medicine states that: itraconazole, an antifungal drug, is effective in treating colon cancer. And as early as 2016 in Molecular Cancer Therapeutics indicated that the antifungal drug posaconazole was able to fight the growth of basal cell carcinoma. Itraconazole and posaconazole are third-generation azole antifungals which are commonly used clinically, but whether other azole antifungals have antitumor activity is still to be explored.

Based on the research background and the lack of the medicines for clinically treating the lung squamous carcinoma, the miconazole is selected for research and the in-vivo and in-vitro anti-tumor activity and the related mechanism thereof are deeply discussed by screening azole antifungal medicines, so that the medicines for clinically treating the lung squamous carcinoma are expected to be increased.

Disclosure of Invention

In view of the above, the invention provides application of miconazole in preparing anti-squamous-lung-carcinoma drugs and cisplatin sensitizers.

The invention not only expands the application range of the miconazole as the antifungal drug, but also supplements the drugs for treating the squamous cell lung carcinoma clinically.

The miconazole can inhibit the survival of the lung squamous carcinoma cells, and reduce active oxygen in the cells through a PI3K/Akt/NOX4 channel so as to induce the apoptosis of the lung squamous carcinoma cells. The invention screens the miconazole with the activity of resisting the lung squamous carcinoma from azole antifungal drugs for the first time, and sensitizes the cisplatin which is a lung squamous carcinoma resisting drug by discussing the mechanism of the miconazole.

Due to the long-term clinical application of miconazole, the safety and the pharmacy of the medicine must be ensured to a certain extent.

Drawings

Fig. 1 is a graph showing the effect of miconazole treatment for 48 hours on cell viability in H226 and SK-MES-1 measured by MTT method (n-3);

fig. 2 is a fluorescence micrograph of H520 and H226 cells after Hochest staining for 24 hours with different concentrations of miconazole (0, 2, 4, 8 μ M) (significantly different from the non-drug-added group,. p <0.01, n ═ 3);

FIG. 3 is a graph showing the results of flow cytometry analysis of H520 and H226 cells treated with miconazole at various concentrations for 24 hours;

fig. 4 is a graph of the effect of flow cytometry on active oxygen after 12 hours of treatment of H520 and H226 cells with different concentrations of miconazole (0, 2, 4, 8 μ M) (significantly different from the non-drug-added drug group,. p <0.05,. p <0.01, n ═ 3);

FIG. 5 is a graph of the effect of flow cytometry analysis of miconazole (6. mu.M) on the increase in active oxygen by H520 and H226 intracellular hydrogen peroxide (500. mu.M) (significantly different from control group, # p <0.05, # p < 0.01; significantly different from hydrogen peroxide group, # p <0.05, and n-3);

figure 6 is a graph of the effect of flow cytometry on apoptosis of H520 and H226 intracellular miconazole (6 μ M) in combination with hydrogen peroxide (500 μ M) (significant difference p <0.01 compared to control group; significant difference # p <0.01 compared to hydrogen peroxide group, n ═ 3);

figure 7 is a graph of the change in NOX4mRNA levels after 4 hours of Q-PCR analysis of H520 and H226 cells treated with different concentrations of miconazole (0, 2, 4, 8 μ M) (significant differences p <0.05, p <0.01, n ═ 3 compared to the non-dosed group);

FIG. 8 is a graph showing the change of NOX4 protein levels in Western blotting analysis of the change of H520 and H226 cells after treatment with different concentrations of miconazole (0, 2, 4, 8. mu.M);

FIG. 9 is a graph showing the effect of miconazole (0, 2, 4, 8 μ M) on the phosphorylation levels of Akt in H520 and H226 cells by Western Blotting analysis;

FIG. 10 is a graph of the effect of miconazole (6 μ M) on NOX4 protein levels after Western Blotting using LY294002(25 μ M), an inhibitor of PI 3K;

FIG. 11 is a graph of the effect of miconazole (6 μ M) on NOX4 protein levels after Western Blotting using Wortmannin (10 μ M), an inhibitor of PI 3K;

FIG. 12 is a graph of the effect of flow cytometry on cellular active oxygen in H520 and H226 cells in combination with the NOX4 inhibitor, GKT137831(20 μ M) (significant difference p < 0.01; no significant difference n 3, compared to the GKT group);

FIG. 13 is a graph of the effect of miconazole (6. mu.M) on apoptosis in H520 and H226 cells when combined with the NOX4 inhibitor, GKT137831 (25. mu.M), by flow cytometry (significant differences p <0.01 compared to control; no significant difference n 3 compared to GKT);

fig. 14 is a graph of IC50 after 48 hours of treatment in H520 and H226 with MTT assay to detect various concentrations of cisplatin (0-16 μ M) (n-3);

FIG. 15 is a graph of the effect of Western Blotting analysis on Akt phosphorylation after cisplatin in H520 and H226 and miconazole against cisplatin-induced Akt phosphorylation;

figure 16 is a graph of MTT assay effect on cell survival in H520 and H226 of miconazole (2.5 μ M) in combination with cisplatin (2 μ M, 4 μ M) (significant difference compared to control, # p <0.05, # p < 0.01; significant difference compared to MIC 2.5, # p < 0.01; significant difference compared to CIS 2, $ p < 0.05; significant difference compared to CIS 4, # p ═ 0.01, and n ═ 3);

FIG. 17 is a graph of the effect of flow cytometry on apoptosis in H520 and H226 cells in combination with miconazole (6. mu.M) and cisplatin (10. mu.M) (significantly different, # p < 0.01; and n ═ 3; compared to the CIS group);

FIG. 18 is a graph of tumor growth in groups 4 of mice after 28 days of different dosing conditions;

FIG. 19 is an immunohistopathological fluorescence microscopy of NOX4, p-Akt and TUNEL against subcutaneous tumors in nude mice.

Detailed Description

The following is a further illustration of the invention with reference to specific examples and experimental examples. These examples are only illustrative and not intended to limit the scope of the present invention. The experimental methods of the following examples, in which specific experimental conditions are not specified, are generally performed according to conventional conditions.

Materials and methods:

material

Miconazole (# S2536, CAS No.: 22916-47-8), LY294002(# S1105, CAS No.: 154447-36-6), Wortmannin (# S2758, CAS No.: 19545-26-7), GKT137831(# S7171, CAS No.: 1218942-37-0), purchased from Selleck. Cell culture reagents were purchased from Gibco. Other reagents were purchased from Sigma Chemical co.

Cell culture

Human squamous cell lung carcinoma cells H520 and H226 were both from American type culture Collection (ATCC, Rockville, Md., USA). All cells were cultured in Institute-1640 medium (RPMI-1640, Gibco-BRL, Gaithersburg, Md., USA) and supplemented with 10% fetal bovine serum. The cells were incubated at 37 ℃ with 5% CO₂In a standard humidified incubator (ThermoFisher Scientific, Waltham, Mass.).

Cell viability assay

The MTT method was used to examine the effect of miconazole on the survival of squamous cell lung carcinoma cells. H520, H226 cells were separately digested and counted, and 5000 cells per well were seeded into 96-well plates. After cell attachment, cells were treated with miconazole (0-10. mu.M) at various concentrations for 48 hours. After the end of the administration, MTT was added at a concentration of 0.5mg/ml, 20. mu.L per well and incubated at 37 ℃ for 4 hours in the absence of light. Finally, the liquid was aspirated from the 96-well plate, 150. mu.L of DMSO was added to each well, and the OD of each well was measured at 570 nm. Cell viability ═ (experimental OD value-control OD value)/control OD value 100%.

Flow cytometer analysis of reactive oxygen species levels

Intracellular reactive oxygen species levels were detected by labeling cells with a 2, 7-dichlorofluorescent yellow diacetate (DCFH-DA, Sigma Chemical Co, 35845) probe. H520, H226 cells were seeded in 60mm dishes and treated with miconazole (0, 2, 4, 8. mu.M) at various concentrations for 12 hours after the cells were adherent. After incubation of DCFH-DA with a final concentration of 25. mu.M, intracellular reactive oxygen species were detected, and incubation was carried out at 37 ℃ for 30 minutes in the absence of light. PBS was resuspended 3 times and analyzed by flow cytometry (Thermo Scientific. TM., AttunnxT, USA) at an excitation wavelength of 488nm and an emission wavelength of 525 nm.

Flow cytometry analysis of apoptosis

Apoptosis was detected by flow cytometry using a double staining assay kit (BD, PharMingen, SanDiego, Calif.) for apoptosis annexin V-FITC and Propidium Iodide (PI). H520 and H226 cells were seeded in a 60mm dish and treated with miconazole (0, 2, 4, 8. mu.M) at different concentrations for 24 hours after the cells were attached. After dosing, cells were trypsinized and harvested, resuspended twice in PBS, and then AnnexinV binding buffer was added and incubated with 5 μ LAnnexinV-FITC for 15 min in the dark. Finally 5. mu.L of PI were added and incubated for 5 minutes in the dark. The samples were analyzed by flow cytometry.

Real-time fluorescent quantitative PCR (RT-qPCR) for detecting mRNA expression

H520, H226 cells were digested and seeded in 6-well plates, and miconazole (0, 2, 4, 8 μ M) was added at a concentration after the cells adhered. After 4 hours, total RNA was extracted from the cells using Trizol (Invitrogen), and complementary DNA (cDNA) was synthesized using ReverTra Ace reverse transcriptase (TOYOBO, Japan, FSQ-301) according to the instructions. Real-time RT-PCR was performed on an iCycler (Bio-Rad) according to SYBRGreen real-time PCR premix (TOYOBO, Japan, QPK-201). The primer sequences are as follows:

NOx4 upstream primer: CCCTCGGTCCTCGCTCAGC, respectively;

NOX4 downstream primer: TCCTCCAGGACACAGCCATGC, respectively;

GAPDH upstream primer: GGCACCGTCAAGGCTGAGAAC, respectively;

GAPDH downstream primer: CATGGTGGTGAAGACGCCAGTG are provided.

The gene expression level for each amplification was calculated using the Δ Δ Ct method and normalized to mRNA for GAPDH.

Protein content analysis by western blotting method

Protein immunoblotting to detect P-Akt and NOX4 contents in cells H520, H226 cells were plated in 6-well plates, after the cells were attached to the plates, miconazole (0, 2, 4, 8 μ M) was given for treatment, after 12H, cell lysis buffer (CellSignaling Technology, Beverly, MA, USA) and 0.5% protease inhibitor cocktail (Sigma, Louis, MO, USA) were added to obtain whole cell extracts, after electrophoresis, electrotransformation and blocking, the antibodies were incubated overnight at 4 ℃ respectively.

Miconazole in vivo antitumor test

SPF-grade female BALB/c-nu/nu nude mice 6-8 weeks old were used for the experiments. The animal is from the Guangdong province medical experiment animal center, and the license number is as follows: SCXK (Yue) 2018-. H520 cells (about 5X 10)⁶Individual cells) were inoculated subcutaneously into the right underarm of nude mice. When the tumor volume grows to 100mm²-110mm²The tumor-forming nude mice were divided into 4 groups, namely a normal saline group, a miconazole treatment group (40mg/kg, once every two days, intraperitoneal administration), a cisplatin treatment group (2mg/kg, once every two days, intraperitoneal administration), a miconazole and cisplatin treatment group (40mg/kg +2mg/kg, once every two days, intraperitoneal administration), and 6 mice in each group. Tumor size (mm) was calculated by the following formula³) Canna edulis (tumor length x tumor width)²) X 0.5, tumor volume was measured every other day. Tumor volume and tumor weight were measured in nude mice 28 days after the administration. Mice were sacrificed and tumors were harvested and immunohistochemical analysis was performed for P-Akt and NOX4 expression.

Animal handling and procedures have been approved by the institutional animal care and use committee of the health sciences center of the university of cantonese medical science. All animal experiments were in accordance with the guidelines of the national institutes of health of the United states for the care and use of experimental animals (NIH publication No. 8023, revised 1978).

TUNEL staining

TUNEL staining was performed with a cell death kit (Roche, Basel, Switzerland). Sections were incubated with proteinase K (20mg/mL) for 15 min at room temperature and 2% H after incubation₂O₂Sections were treated for 5 min to block endogenous peroxidase. After incubation with terminal deoxynucleotidyl transferase (TdT) for 2 hours at 37 deg.C, incubation with antioxidant peroxidase solution was carried out for 30 minutes. After all incubations were completed, staining with Diaminobenzidine (DAB) for 2 min, followed by counterstaining with hematoxylin and taking pictures under the microscope.

3.10 statistical analysis

The measured data such as the data obtained by the experiment are repeated 3 times and are described by mean +/-standard deviation, the GraphPadprism7 software is applied to measure the measured data between two groups to carry out Student's test, the statistics of the measured data between the groups adopts One-way ANOVA, and p <0.05 is considered to have statistical significance and is expressed by a symbol.

Results of the experiment

Azole antifungal agent can inhibit the survival of squamous cell carcinoma of lung and has optimal effect of miconazole

As shown in table 1, after screening azole antifungal drugs in H520 cells by MTT method, posaconazole, itraconazole, terconazole, isaconazole, clotrimazole, bifonazole, tioconazole, miconazole, fenticonazole nitrate, sulconazole nitrate, sertaconazole nitrate, nafticonazole hydrochloride, and butoconazole nitrate were found to exhibit certain antitumor effects after 48 hours of drug treatment, wherein miconazole was most effective (half inhibitory concentration IC50 was 4.95 ± 0.33 μ M).

TABLE 1 semi-inhibitory concentrations of various azole antifungals on H520 cells

Miconazole structure:

as shown in FIG. 1, in different H226 and SK-MES-1 lung squamous carcinoma cells, after 48 hours of treatment with miconazole, the survival of tumor cells was dose-dependently inhibited at a concentration of 0-10. mu.M, and IC50 was 5.45. + -. 0.33. mu.M and 5.88. + -. 0.42. mu.M.

Miconazole induction of lung squamous carcinoma cell apoptosis

H520 and H226 cells were stained with Hochest after 24 hours of treatment with different concentrations of miconazole (0, 2, 4, 8. mu.M). The dose-dependent induction of apoptosis by miconazole as shown in FIG. 2 (FIG. 2A for H520 cells and FIG. 2B for H226 cells) is observed by fluorescence microscopy. To further verify the results, the flow cytometry analysis was performed by annexin v-FITC/PI double staining method, as shown in fig. 3 (fig. 3A corresponds to the apoptosis of H520 cells, fig. 3B corresponds to the apoptosis of H226 cells), and miconazole was able to effectively induce apoptosis of squamous cell carcinoma cells.

Miconazole reduces intracellular reactive oxygen species and induces apoptosis in squamous cell lung carcinoma cells

H520 and H226 cells were treated with miconazole (0, 2, 4, 8. mu.M) at different concentrations for 12 hours, labeled with DCFH-DA and finally analyzed by flow cytometry. As a result, miconazole was found to decrease the active oxygen in the lung squamous carcinoma cells dose-dependently, as shown in fig. 4. Furthermore, we use H₂O₂(500. mu.M) increased intracellular reactive oxygen species, as shown in FIG. 5, miconazole (6. mu.M) was effective in lowering H₂O₂The resulting active oxygen rises. And using miconazole and H₂O₂After being treated for 24 hours, the miconazole with the concentration can effectively reduce H₂O₂The induced apoptosis was shown in figure 6.

The above results show that miconazole induces apoptosis of H520 and H226 cells, probably due to the decrease of intracellular reactive oxygen species.

Miconazole reduces NOX4 expression by inhibiting PI3K/Akt pathway

To further investigate the mechanism of miconazole inducing apoptosis in squamous cell lung carcinoma cells, we consult the relevant literature to find that NOX4 is an important factor in oxidative stress. First, we treated the lung squamous carcinoma cells with miconazole (0, 2, 4, 8. mu.M) at different concentrations for 4 hours, and then examined the mRNA expression level by RT-qPCR, as shown in FIG. 7, and found that miconazole could dose-dependently reduce the NOx4mRNA expression level. As shown in fig. 8, it was also found that at the protein level, the concentration of miconazole significantly reduced the NOX4 protein content after 12 hours of treatment of H520 and H226 cells.

A number of documents indicate that PI3K/Akt is an important pathway affecting NOX4, so we considered whether miconazole inhibits NOX4 expression by affecting the PI3K/Akt pathway. Treatment of lung squamous carcinoma cells with varying concentrations of miconazole (0, 2, 4, 8 μ M) for 6 hours, as shown by the Western Blot results shown in FIG. 9, showed that miconazole dose-dependently reduced the phosphorylation levels of Akt with unchanged total Akt protein.

LY294002 is a PI3K pathway inhibitor, and we added 25 μ M alone and miconazole 6 μ M alone to H520 and H226 cells in the experiment, as shown by the Western Blot results shown in fig. 10, both were found to decrease NOX4 protein content, but NOX4 protein content did not change significantly after the two drugs were used together with LY294002 alone. The same results were also obtained with the same results shown in fig. 11 for the other PI3K inhibitor, Wantanmin, performed in H520 and H226 cells.

The above results suggest that miconazole may reduce NOX4 expression by inhibiting PI3K/Akt pathway.

Miconazole reduces reactive oxygen species levels and induces apoptosis in squamous cell lung carcinoma cells by inhibiting NOX4

This experiment is to verify that miconazole reduces reactive oxygen species in H520 and H226 cells and induces apoptosis by inhibiting NOX 4. NOX4 inhibitor (GKT137831) was used at 20. mu.M in the experiment, and changes in oxygen activity and apoptosis of squamous cell carcinoma cells were examined after treatment with miconazole and GKT 137831. The active oxygen results shown in fig. 12 show that miconazole and GKT137831, when used alone, reduced intracellular active oxygen, but the intracellular active oxygen was maintained at the same level as GKT137831 without further reduction of intracellular active oxygen when both were used in combination. As shown in fig. 13, the flow results showed that miconazole or GKT137831 induced apoptosis alone, but the apoptosis did not increase significantly when both drugs were used, but remained at the same level as GKT 137831.

From the above results, it is presumed that miconazole induced apoptosis in squamous cell lung carcinoma cells by inhibiting NOX4 to decrease intracellular reactive oxygen species.

Miconazole sensitization cisplatin induction lung squamous carcinoma cell apoptosis

As shown in FIG. 14, cisplatin was found to dose-dependently inhibit H520 and H226 cell survival 48 hours after cisplatin treatment, and IC50 was 5.66. + -. 0.13 and 8.26. + -. 1.10. mu.M, respectively. The Western Blot method is used for detecting the influence of 6 mu M cis-platinum and 6 mu M miconazole and the combination of the cis-platinum and the miconazole on the phosphorylation level of Akt protein in squamous cell lung carcinoma cells after 6 hours. The results shown in fig. 15 show that miconazole alone effectively inhibited Akt phosphorylation, whereas cisplatin alone increased Akt phosphorylation; after the two medicines are combined, the miconazole can effectively reverse the increase of the phosphorylation level of Akt caused by cisplatin.

As shown in FIG. 16, the sensitization of miconazole to cisplatin in H520 and H226 cells was examined by MTT method, and 2.5. mu.M miconazole was used in combination with 2. mu.M or 4. mu.M cisplatin, respectively, for 48 hours, and the results showed that low concentration (2.5. mu.M) miconazole in combination with low concentration cisplatin (2. mu.M, 4. mu.M) was effective in inhibiting the survival of squamous cell lung carcinoma cells. To further verify the results, changes in apoptosis of H520 and H226 cells were detected using flow cytometry after the combination of the two drugs. As shown in FIG. 17, the results showed that 2 μ M miconazole combined with 2 μ M cisplatin induced apoptosis in squamous cell lung carcinoma cells after 24 hours of drug treatment, and that the apoptosis rates of H520 and H226 after combined administration were significantly greater than the sum of the two drugs used alone.

The experiment shows that miconazole can inhibit the phosphorylation of Akt of H520 and H226 cells and reverse the increase of the phosphorylation of Akt caused by cisplatin treatment, thereby sensitizing cisplatin.

Miconazole inhibition of tumor growth in vivo

To further confirm that miconazole is in vivoThe antitumor effect of (1) nude mice was divided into 4 groups of 6 mice each. H520 cells (about 5X 10)⁶Individual cells) were inoculated subcutaneously into the right axilla of 6-8 week old female nude mice. When the tumor grows to 100-110mm³At this time, mice were treated separately: control group (saline, once every two days, i.p.), miconazole-administered group (40mg/kg, once every two days, i.p.), cisplatin-administered group (2mg/kg, once every two days, i.p.), and miconazole plus cisplatin-administered group (administration concentration and mode were identical to the above-mentioned single administration). Tumor volumes were measured in nude mice every other day.

Tumor volume and tumor weight were recorded in nude mice on 28 days of treatment, and as shown in fig. 18, it was found that the three administration groups inhibited tumor growth. In addition, immunohistopathological examination of subcutaneous tumors in nude mice was performed using NOX4, P-Akt and TUNEL, respectively, and immunohistochemical results showed significant reduction in NOX4 and P-Akt expression levels and enhanced staining of TUNEL in miconazole-treated groups compared to control groups, as shown in FIG. 19.

The experiment proves that the miconazole, the cisplatin and the two medicines can inhibit the growth of tumors in mice after being used together, and the combined effect on the tumor inhibition is the best.

Conclusion of the experiment

The miconazole can inhibit the survival of the lung squamous carcinoma cells, and reduce active oxygen in the cells through a PI3K/Akt/NOX4 channel so as to induce the apoptosis of the lung squamous carcinoma cells. Meanwhile, miconazole is found to sensitize cisplatin, and the effect of cisplatin on resisting squamous cell lung carcinoma is further enhanced. Thus, miconazole is likely to be a potential drug for treatment of squamous cell lung carcinoma. The invention provides a certain experimental basis for clinically using the miconazole to treat the squamous cell lung carcinoma, enlarges the application range of the medicine and provides a new treatment scheme for clinically treating the squamous cell lung carcinoma.

The embodiments described above are presented to enable those skilled in the art to make and use the invention. It will be readily apparent to those skilled in the art that various modifications to these embodiments may be made, and the generic principles described herein may be applied to other embodiments without the use of the inventive faculty. Therefore, the present invention is not limited to the embodiments described herein, and those skilled in the art should make improvements and modifications to the present invention based on the disclosure of the present invention within the protection scope of the present invention.

Claims

1. The application of miconazole in preparing medicine for treating squamous cell lung carcinoma is disclosed.

2. The application of miconazole in preparing cis-platinum sensitizer.

3. Use according to claim 1, characterized in that: miconazole reduces intracellular reactive oxygen species through PI3K/Akt/NOX4 pathway to induce apoptosis in squamous cell lung carcinoma cells.