CN111057756A

CN111057756A - Detection reagent for aspirin gene polymorphism multiple fluorescent probe dissolution curve PCR method

Info

Publication number: CN111057756A
Application number: CN201911222051.8A
Authority: CN
Inventors: 杜睿
Original assignee: Individual
Current assignee: Individual
Priority date: 2019-12-03
Filing date: 2019-12-03
Publication date: 2020-04-24

Abstract

The invention relates to the technical field of in-vitro nucleic acid detection, in particular to a reagent consisting of a specific primer and a fluorescent probe, wherein the specific primer and the fluorescent probe are used for detecting 6 related genetic polymorphic sites of aspirin personalized medicine by adopting an asymmetric PCR (polymerase chain reaction) technology and a fluorescent probe dissolution curve technology. The invention provides a specific primer and a fluorescent probe set reagent for detecting 6 related gene polymorphic sites of aspirin personalized medicine, wherein the 6 related genes are GPIIIa PlA1/A2, PEAR1, PTGS1, GP1BA, GSTP1 and LTC4S gene polymorphisms. The reagent has high sensitivity, and can accurately detect genomic DNA as low as 0.1 ng/mu L; the specificity is good, and the genomic DNA up to 300 ng/muL cannot generate non-specific amplification; the whole fluorescent PCR detection process can be completed in only 90 minutes, and the detection result is visual and easy to interpret.

Description

Detection reagent for aspirin gene polymorphism multiple fluorescent probe dissolution curve PCR method

Technical Field

The invention relates to the technical field of in-vitro nucleic acid detection, in particular to a detection reagent for aspirin gene polymorphism by a multiplex fluorescent probe dissolution curve PCR method.

Background

Aspirin is widely used in clinic and is a common non-steroidal anti-inflammatory drug, and low-dose aspirin can inhibit the formation of platelets and arterial thrombosis and play an anticoagulant role. Studies have demonstrated that aspirin has a large individual variation in its anticoagulant effect, aspirin resistance is present in patients undergoing coronary bypass surgery, in myocardial infarction survivors and even in healthy young volunteers, and aspirin resistance is present in 30-40% of patients with stroke or peripheral vascular disease and these patients are at a risk of re-developing cardiovascular events of up to 80% within 2 years compared to non-aspirin resistant patients. At present, the cause of such individual difference cannot be completely explained, but gene polymorphism is one of the most important influencing factors. Genetic polymorphisms of glycoprotein IIb/IIIa receptor complex (GP III) (PIA 1/PIA 2) are important factors for aspirin resistance, and GP III receptors are key receptors on the final pathway of platelet aggregation, so that any change of GP III receptors can cause the change of reactivity of various antiplatelet drugs including aspirin. A plurality of GP III receptor polymorphic sites have been discovered, more commonly rs5918(Leu33Pro), with the site encoding Leu being designated as PlA1 and the site encoding Pro being designated as PlA 2. Studies have shown that patients carrying the PlA2 allele have an increased platelet production capacity with simultaneous activation and a reduced threshold for granule release and fibrinogen binding, and require a higher dose of aspirin to effectively achieve anticoagulation. Also, the carriers of the PlA2/PlA2 genotype were 4 times more at risk of developing ischemic heart disease than the PlA1/PlA1 and PlA1/PlA2 patients. The gene polymorphism rs12041331 of the platelet endothelial aggregation receptor-1 (PEAR1) is closely related to the antiplatelet therapy reactivity of the patient. Compared with GG homozygotes, the risk of cardiovascular events and the mortality of A allele carriers are obviously increased no matter aspirin alone or aspirin combined with clopidogrel double-resistant treatment. The urticaria is a common adverse reaction caused by taking aspirin, and researches prove that gene polymorphism rs730012(-444A & gtC) of leukotriene C4 synthetase (LTC4S) can be used as a biomarker for inducing urticaria by aspirin, and patients with hypersensitivity reaction of C allele carriers after taking aspirin is obviously higher than those of A allele carriers.

The aspirin combined medication individualized treatment comprises the following steps:

if the gene is not mutated, the gene can be used according to normal dosage.

(II) if a mutation occurs, in particular homozygous for the mutation

1. GP IIIa PIA 2(T > C) CC genotype, after stenting, the incidence rate of subacute thrombotic events is 5 times that of TT type, and the anticoagulation effect can be achieved by increasing the dose of aspirin. (since high doses of aspirin increase the risk of bleeding and once it is indicated as being mishandled, it is preferred to use standard doses of dipyridamole in place of cilostazol for treatment with a compromised antiplatelet strength.) drugs that enhance gastric mucosal barrier function, such as misoprostol, or H2 receptor blockers, such as famotidine or PPI drugs (the PPI class of drugs is preferred). It is recommended to pay attention to data such as platelet aggregation.

2. PEAR1(G > A): the GG allele has good anti-platelet response to aspirin; the GA type can be used but should be closely focused on platelet detection, such as resistance, and timely protocol adjustment. AA genotype, aspirin myocardial infarction and dipyridamole with high mortality rate. If the anticoagulation effect can not be achieved, the cilostazol can be added for double treatment.

3. PTGS1(-842A > G): PTGS 1: GG genotype, high risk of aspirin resistance (HR: 10), and high incidence of cardiovascular events (HR: 2.55). The treatment effect of aspirin should be closely concerned in AG genotype risks and the like; AA genotype aspirin is more sensitive and the incidence of cardiophotoperiod events is lower. The same is suggested as above if mutations occur.

4. GP1 BA: CC genotype, increased resistance of aspirin to wind; CT and TT types, reduced risk of resistance.

The mutation-generating medication is recommended as above

5. GSTP 1: the risk of digestive tract hemorrhage of GG and AG types, which are treated by aspirin, is 2.08 times of that of AA types, such as gene mutation and allergy, PPI medicines should be taken simultaneously when aspirin is used for a long time, so as to prevent digestive system hemorrhage.

6. LTC 4S: AA genotype, the risk of urticaria using aspirin is lower than that of AC and CC types. Patients with mutations should be cautioned about the development of drug-induced rashes.

At present, there are many technologies for detecting gene polymorphism, and the most commonly used technologies include polymerase chain reaction-restriction fragment length polymorphism analysis, sequence specificity PCR, first-generation sequencing, second-generation sequencing and the like, but the technologies have respective application defects, some technologies have complex operation and long detection period, and high-throughput multi-site simultaneous detection cannot be performed, so that the existing technology is not ideal for polymorphism detection in clinic and cannot meet the clinical detection requirements all the time.

A multiplex fluorescent probe PCR combined high-resolution melting curve method is a novel Single Nucleotide Polymorphism (SNP) analysis technology, is improved on the basis of a high-resolution melting curve technology, a saturated dye in a high-resolution melting curve is replaced by a multiplex fluorescent probe, the position of the probe design is on an SNP site, so that the detection result is more direct and specific, the biggest advantage is that typing detection can be carried out, one probe distinguishes all polymorphism conditions of one SNP site, and combined with multicolor fluorescence detection, the detection flux is greatly improved, while one fluorescence channel of the traditional fluorescent probe PCR method can only detect one genotype, if the multiplex fluorescent probe melting curve method is adopted, one channel can detect 9 genotypes of 3 genes or even more, so that the flux is amplified by n times, and what is needed is to say that the interference among subtypes is faced by adopting a conventional fluorescent PCR method, therefore, most methods adopting the Ct value difference are interpreted, so that the detection result becomes unstable.

Disclosure of Invention

The invention aims to provide a reagent for guiding gene detection of aspirin personalized medication and application thereof, and the reagent comprises reagents for respectively detecting 6 gene polymorphisms such as GPIIIaPlu 1/A2, PEAR1, PTGS1, GP1BA, GSTP1, LTC4S and the like.

The invention provides a detection reagent for aspirin gene polymorphism multiplex fluorescent probe dissolution curve PCR method, comprising at least one group of primer pairs or probes of 6 groups of primer pairs or 6 fluorescent probes:

the primer pair and the probe of the GPIIIaPIA 1/A2 gene are as follows:

an upstream primer: 5'-AAGTGGTAGGGCCTGCAGGAGGTAGAG-3', respectively;

a downstream primer: 5'-CCTTCAGCAGATTCTCCTTCAG-3', respectively;

a fluorescent probe: FAM-GCCCTGCCTCCGGGCTCAC-BHQ 1;

the PEAR1 gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-CAGAGAAGCTGGAAGGGAGCCCGTG-3'

A downstream primer: 5-GAGTTCCTGGTGGACAAGAGGATCC-3'

A fluorescent probe: HEX-TCTCACTTCCGTCACCCTTAC-BHQ 1;

the PTGS1 gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-CCAGCCCTGGAATCTGAGTTCAGAGATC-3'

A downstream primer: 5-ATCCCAGAGGGTGGTTGTAAGATT-3'

A fluorescent probe: cy5-ACTACATGCTGGACACTGCACC-BHQ 1;

the GP1BA gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-GCGTGGTCTTGGCGAACTCCAAGAG-3'

A downstream primer: 5-AGCTCAGTCAAGTTGTTGTTAG-3'

A fluorescent probe: FAM-AGGGCTCCTGACGCCCACA-BHQ 1;

the GSTP1 gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-GGCAGCCCTGGTGGACATGGTGAATG-3'

A downstream primer: 5-GCACAAGAAGCCCCTTTCTTTGTTC-3'

A fluorescent probe: HEX-CTGCAAATACATCTCCCTCAT-BHQ 1;

LTC4S gene primer pair and fluorescent probe are as follows:

an upstream primer: 5-AGGGTTTGGCAGGGGTTGCCAG-3'

A downstream primer: 5-ACATCATGCTGGAGCCAGCCCCAG-3'

A fluorescent probe: CY5-TGGGGACAGGGAACAGAT-BHQ 1.

As a further improvement of the invention, the primer group comprises 6 groups of primer pairs and 6 groups of probes.

The invention further provides a reagent for detecting aspirin gene polymorphism by a multiplex fluorescent probe dissolution curve PCR method, which comprises the primer group, the fluorescent probe and 6 gene polymorphism plasmid positive standard substances, wherein the standard substance has the following sequence:

GPIIIaPIA 1/A2 standard sequence:

GPIIIaPIA 1/A2 mutant:

5’-CAGGAAAGACCACAACAATTTGTTTATGCTCCAATGTACGGGGTAAACTCTTAGCTATTG GGAAGTGGTAGGGCCTGCAGGAGGTAGAGAGTCGCCATAGCTCTGATTGCTGGACTTCTCTTTGGGCTC CTGTCTTACAGGCCCTGCCTCTGGGCTCACCTCGCTGTGACCTGAAGGAGAATCTGCTGAAGGATAACT GTGCCCCAGAATCCATCGAGTTCCCAGTGAGTGAGGCCCGAGTACTAGAGGACAGGCCCCTCAGCGACA AGGG-3’；

GPIIIaPIA 1/A wild type:

5’-CAGGAAAGACCACAACAATTTGTTTATGCTCCAATGTACGGGGTAAACTCTTAGCTA TTGGGAAGTGGTAGGGCCTGCAGGAGGTAGAGAGTCGCCATAGCTCTGATTGCTGGACTTCTC TTTGGGCTCCTGTCTTACAGGCCCTGCCTCCGGGCTCACCTCGCTGTGACCTGAAGGAGAATCTGCTGA AGGATAACTGTGCCCCAGAATCCATCGAGTTCCCAGTGAGTGAGGCCCGAGTACTAGAGGACAGGCCCC TCAGCGACAAGGG-3’；

PEAR1 standard sequence:

PEAR1 mutant:

5’-GCTTGAACTTGGGCAGGGGTTGGGGGTGCAGAGGTGAGGGGTTATCCTATGCTACATGAC TTCCCAGAGAAGCTGGAAGGGAGCCCGTGGGGAAGTCCCTTCTGCTGTCTCACTTCCGTCACCCTTACT CTCTGCTTTCTATAGAAATGGATCCTCTTGTCCACCAGGAACTCTAATCCCCCCCACCCCTGCTCCCCTAGAGCCCACACTCAATTCCTTCCTCCT-3’；

PEAR1 wild type:

5’-GCTTGAACTTGGGCAGGGGTTGGGGGTGCAGAGGTGAGGGGTTATCCTATGCTACATGACT TCCCAGAGAAGCTGGAAGGGAGCCCGTGGGGAAGTCCCTTCTGCTGTCTCACTTCCATCACCCTTACTC TCTGCTTTCTATAGAAATGGATCCTCTTGTCCACCAGGAACTCTAATCCCCCCCACCCCTGCTCCCCTAGAGCCCACACTCAATTCCTTCCTCCT-3’；

PTGS1 standard sequence:

PTGS1 mutant:

5’-GATTCTATAAATTCGGCGGTGGATGTGAGTCTAGCTACAGCATGGACCCTGGCCAGCCCT GGAATCTGAGTTCAGAGATCTTTGAAAAAATGCCTTCCGATAACTGAGCACCTACTACATGCTGGGCAC TGCACCAGGAGATTTGTGTGCATTCCCTCATTGAATCTTACAACCACCCTCTGGGATGGTTTTTGCT ATTAAGCCGATTTTATAGATGAGAATACTGAGGGCTAGAAAAGATAAGTACCTTGTCCAAGGTGACACG -3’；

PTGS1 wild type:

5’-GATTCTATAAATTCGGCGGTGGATGTGAGTCTAGCTACAGCATGGACCCTGGCCAGCCCT GGAATCTGAGTTCAGAGATCTTTGAAAAAATGCCTTCCGATAACTGAGCACCTACTACATGCTGGACAC TGCACCAGGAGATTTGTGTGCATTCCCTCATTGAATCTTACAACCACCCTCTGGGATGGTTTTTGCT ATTAAGCCGATTTTATAGATGAGAATACTGAGGGCTAGAAAAGATAAGTACCTTGTCCAAGGTGACACG -3’

GP1BA standard sequence:

GP1BA mutant:

5’-TGGACGTCTCCTTCAACCGGCTGACCTCGCTGCCTCTTGGTGCCCTGCGTGGTCTTGGCGA ACTCCAAGAGCTCTACCTGAAAGGCAATGAGCTGAAGACCCTGCCCCCAGGGCTCCTGATGCCCACACC CAAGCTGGAGAAGCTCAGTCTGGCTAACAACAACTTGACTGAGCTCCCCGCTGGGCTCCTGAATGGGCT GGAGAATCTCGACACCCTTCTCCTCCAAGAGAACTCGCTGTA-3’；

GP1BA wild type:

5’-TGGACGTCTCCTTCAACCGGCTGACCTCGCTGCCTCTTGGTGCCCTGCGTGGTCTTGGCG AACTCCAAGAGCTCTACCTGAAAGGCAATGAGCTGAAGACCCTGCCCCCAGGGCTCCTGACGCCCACAC CCAAGCTGGAGAAGCTCAGTCTGGCTAACAACAACTTGACTGAGCTCCCCGCTGGGCTCCTGAATGGGC TGGAGAATCTCGACACCCTTCTCCTCCAAGAGAACTCGCTGTA-3’；

GSTP1 standard sequence:

GSTP1 mutant:

5’-CCAACCCCAGGGCTCTATGGGAAGGACCAGCAGGAGGCAGCCCTGGTGGACATGGTGAAT GACGGCGTGGAGGACCTCCGCTGCAAATACGTCTCCCTCATCTACACCAACTATGTGAGCATCTGCACC AGGGTTGGGCACTGGGGGCTGAACAAAGAAAGGGGCTTCTTGTGCCCTCACCCCCCTTACCCCTCAGGT GGCTTGGGCTGACCCCTTCTTGGGTCAGGGTGCAGGGGCTGGGTCAGCTCTGG-3’；

GSTP1 wild type:

5’-CCAACCCCAGGGCTCTATGGGAAGGACCAGCAGGAGGCAGCCCTGGTGGACATGGTGAAT GACGGCGTGGAGGACCTCCGCTGCAAATACATCTCCCTCATCTACACCAACTATGTGAGCATCTGCACC AGGGTTGGGCACTGGGGGCTGAACAAAGAAAGGGGCTTCTTGTGCCCTCACCCCCCTTACCCCTCAGGT GGCTTGGGCTGACCCCTTCTTGGGTCAGGGTGCAGGGGCTGGGTCAGCTCTGG-3’；

LTC4S standard sequence:

LTC4S mutant:

5’-TTTCCTGAAGGAGAAAGAGCTTGTGGGGCCCAGTGTGGCTGGGGGGGCGCTGGGACTCCA TTCTGAAGCCAAAGGCACTGGGAAGGGCTTCCGCAGAGGAGGGTTTGGCAGGGGTTGCCAGGAACAGCC TGGATGGGGACAGGGAACAGATAAGGTGGGTGGAGGAGTTAGCCGGGAGCCTGGGGCTGGCTCCAGCAT GATGTGGGGGTCTGCAAGGCCCTGGAGAAAGTGGGGTGGTGCAGCAGGGGGCACACCCACAGCTGGAGC TGACCCAGATGGACAGCTTGGGCTCTGCCACGCGGGACTAGGCAAGGAAGGGGC-3’；

LTC4S wild type:

5’-TTTCCTGAAGGAGAAAGAGCTTGTGGGGCCCAGTGTGGCTGGGGGGGCGCTGGGACTCCA TTCTGAAGCCAAAGGCACTGGGAAGGGCTTCCGCAGAGGAGGGTTTGGCAGGGGTTGCCAGGAACAGCC TGGATGGGGACCGGGAACAGATAAGGTGGGTGGAGGAGTTAGCCGGGAGCCTGGGGCTGGCTCCAGCAT GATGTGGGGGTCTGCAAGGCCCTGGAGAAAGTGGGGTGGTGCAGCAGGGGGCACACCCACAGCTGGAGC TGACCCAGATGGACAGCTTGGGCTCTGCCACGCGGGACTAGGCAAGGAAGGGGC-3’。

the invention further protects the application of the primer group and the fluorescent probe in the detection of aspirin medication genes.

The invention further protects the application of the 6 gene polymorphism plasmid positive standard substance in detecting aspirin medication genes.

The invention further provides a reagent for detecting aspirin gene polymorphism by a multiplex fluorescent probe dissolution curve PCR method, which comprises the following steps:

(1) collecting clinical blood samples, and directly using the samples after dilution by sample diluent;

(2) PCR reaction solution 1 was prepared from GPIIIaPlA1/A2, PEAR1, PTGS1 primer, probe set and PCR reaction reagent, and PCR reaction solution 2 was prepared from GP1BA, GSTP1, LTC4S primer, probe set and PCR reaction reagent, and the total amplification volume was 20. mu.l, wherein the sample volume was 2. mu.l.

(3) Setting a PCR amplification program and a melting program;

(4) and (4) judging results, namely directly judging different polymorphic sites corresponding to melting peaks with different Tm values.

As a further improvement of the present invention, the sample diluent is one of the following:

(1) sodium hydroxide solution with concentration of 0.01M-0.1M;

(2) DMSO and sodium hydroxide solution, wherein the concentration of the DMSO solution is 1-10%, and the concentration of the sodium hydroxide solution is 0.01-0.1M;

(3) betaine and sodium hydroxide solution, wherein the concentration of the betaine is 1M-5M, and the concentration of the sodium hydroxide solution is 0.01M-0.1M;

(4) mannitol and sodium hydroxide solution, wherein the concentration of the mannitol is 1% -5%, and the concentration of the sodium hydroxide solution is 0.01M-0.1M.

As a further improvement of the invention, the dilution factor is between 5 and 40.

As a further improvement of the invention, the PCR reaction solution comprises the following components:

PCR reaction solution 1: tris buffer 20mmol/L, KCl50mmol/L, MgCl₂2mmol/L, dNTPs 2mmol/L, polymerase 20000U/L, GPIIIaPlA1/A2 upstream primer 50nmol/L, GPIIIaPlA1/A2 downstream primer 300nmol/L, GPIIIaPlA1/A2 fluorescent probe 100 nmol/L; the upstream primer 50nmol of the PEAR1 is/L, PEAR1, the downstream primer is 300nmol/L, PEAR1, and the fluorescent probe is 100 nmol/L; PTGS1 upstream primer 50nmol/L, PTGS1 downstream primer 300nmol/L, PTGS1 fluorescent probe 100 nmol/L.

PCR reaction solution 2: tris buffer 20mmol/L, KCl50mmol/L, MgCl₂2mmol/L, dNTPs 2mmol/L, polymerase 20000U/L, GP1BA upstream primer 50nmol/L, GP1BA downstream primer 300nmol/L, GP1BA fluorescent probe 100 nmol/L; GSTP1 upstream primer 50nmol/L, GSTP1 downstream primer 300nmol/L, GSTP1 fluorescent probe 100 nmol/L; 50nmol of LTC4S upstream primer/L, LTC4S downstream primer/300 nmol/L, LTC4S fluorescent probe/100 nmol/L.

As a further improvement of the invention, the pH value of the Tris buffer is 8.5.

The invention can easily distinguish different mutation types through the Tm value difference generated by the difference of different bases. The invention can see that the total 6 genes relate to 18 subtypes, the invention can easily complete the detection process through 2 reaction tubes, and meanwhile, the detection process does not need the nucleic acid extraction process, thereby simplifying the operation steps and simplifying the interpretation method.

The invention has the following beneficial effects:

1) the operation is simple and quick, a nucleic acid purification process is not needed, and the time is saved.

2) The sample and the reagent are operated in a micro-scale manner, so that the environment is protected, the resources are saved, and the environment is protected.

3) High sensitivity, and can detect nucleic acid as low as 0.5 ng.

4) The primary detection flux is large: not only 18 subtypes of 6 alleles are covered, but also the number of required reaction tubes is small.

5) The interpretation is intuitive: different subtypes can be distinguished according to the difference of Tm values, and the instrument automatically interprets.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to these drawings without creative efforts.

FIG. 1 is a GPIIIaPIA 1/A2-FAM dissolution curve;

FIG. 2 is a PEAR1-HEX dissolution curve;

FIG. 3 is a PTGS1-Cy5 dissolution curve;

FIG. 4 is the GP1BA-FAM dissolution profile;

FIG. 5 is a GSTP1-HEX dissolution curve;

FIG. 6 is a graph of LTC4S-Cy5 dissolution profiles.

Detailed Description

The technical solutions in the embodiments of the present invention will be clearly and completely described below with reference to the drawings in the embodiments of the present invention, and it is obvious that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

Example 1:

1. preparation of reaction solution

1) Preparation of reaction solution 1

Adding 20 mmol/L200 mu L, KCl50mmol/L Tris buffer solution into a2 ml freezing tube respectively, and adding 200 mu L, MgCl mmol/L Tris buffer solution into the tube ₂2 mmol/L200 mu L, dNTPs 2 mmol/L40 mu L, polymerase 36U, GPIIIaPlA1/A2 upstream primer 50 nmol/L18 mu L, GPIIIaPlA1/A2 downstream primer 300 nmol/L18 mu L, GPIIIaPlA1/A2 fluorescent probe 100 nmol/L36 mu L, PEAR1 upstream primer 50 nmol/L18 mu L, PEAR1 downstream primer 300 nmol/L18 mu L, PEAR1 fluorescent probe 100 nmol/L36 mu L, PTGS1 upstream primer 50 nmol/L18 mu L, PTGS1 downstream primer 300 nmol/L18 mu L, PTGS1 fluorescent probe 100 nmol/L36 mu L. Make up volume to 1.8ml with purified water.

Fully and uniformly mixing, freezing and storing for later use.

2) Preparation of reaction solution 2

Taking 2 ml of a frozen tube, taking 20 mmol/L200 mu L, KCl50 mmol/L200 mu L, MgCl mmol/L Tris buffer solution ₂2 mmol/L200 mu L, dNTPs 2 mmol/L40 mu L, polymerase 36U, GP1BA upstream primer 50 nmol/L18 mu L, GP1BA downstream primer 300 nmol/L18 mu L, GP1BA fluorescent probe 100 nmol/L36 mu L, GSTP1 upstream primer 50 nmol/L18 mu L, GSTP1 downstream primer 300 nmol/L18 mu L, GSTP1 fluorescent probe 100 nmol/L36 mu L, LTC4S upstream primer 50 nmol/L18 mu L, LTC4S downstream primer 300 nmol/L18 mu L, LTC4S fluorescent probe 100 nmol/L38 mu L. And (5) adding purified water to make up the volume to 1.8ml, fully mixing uniformly, and freezing and storing for later use.

3) Preparation of sample diluent

Preparing sodium hydroxide solution with the concentration of 0.04mol/L, subpackaging in a2 ml freezing tube, and storing at room temperature for later use.

4) Negative control preparation

Purified water was used and the resulting solution was dispensed in 0.5mL portions into 2 mL freezing tubes and stored at room temperature for further use.

5) Positive control preparation

A2 ml frozen tube was added with 20ng/ml GPIIIaPlA1/A2, PEAR1, PTGS1, GP1BA, GSTP1, LTC4S, each gene containing wild type and mutant type. Fully and uniformly mixing, freezing and storing for later use.

2. Sample pretreatment

A10. mu.L whole blood sample (thawed at room temperature and mixed well) was taken, 290. mu.L sample diluent was added, and mixed well for use, or an extract product was used.

3. Sample application

The total volume of a single reaction is 20 mu L, so 2 mu L of positive control, 2 mu L of negative control and 2 mu L of sample are respectively added into the PCR thin-wall tube filled with 18 mu L of reaction solution in sequence, the tube cover of the 8-tube is tightly covered, then the 8-tube is gently mixed and then is subjected to microcentrifugation, and finally the mixture is transferred to a PCR detection area. Loading can be referred to the suggested layout of 96-well plates (table 1).

Table 1: suggested layout of 96-well plate of PCR instrument

PCR amplification and fluorescence detection

The cycling conditions were set as follows.

Table 2: reaction procedure

Instrument fluorescence channel selection: both reaction solution 1 and reaction solution 2 were FAM/HEX/CY 5.

5. Analysis of results

1) And (3) negative control has no obvious melting peak, if the melting peak appears after analysis, the reagent is possibly polluted or polluted in the operation process, and the detection is carried out again after a pollution source is removed.

2) After the melting curve analysis of the positive control, each fluorescence channel of each tube has 2 melting peaks, if the positive control tube has no melting peak or only has 1 melting peak, please confirm whether the used reagent is still in the valid period, and determine whether the operation is strictly performed according to the instruction.

3) Sample interpretation method according to the standard of the following table

Table 3: target gene and positive control melting Tm value range

And according to the detection result, different melting peaks corresponding to different channels represent different subtypes.

Example 2:

1. specificity verification test of plasmid positive reference

1) Experimental samples: and finally, judging whether the dissolving temperature Tm peak value of each pre-packaged gene positive reference substance accords with the Tm value consistency theoretically predicted in the table above through melting analysis, and observing whether the dissolving curve is typical and easy to judge, so that the dissolving curve of an actual clinical sample is guided to judge the genotype of the sample.

2) Experimental sample loading

mu.L of each positive reference substance was added to each of the reaction solution 1 and the reaction solution 2.

3) The experiment was carried out as follows according to the PCR procedure

4) The detection results are shown in FIGS. 1-6:

as shown in fig. 1: TT homozygous Tm, CC homozygous Tm and TC heterozygous Tm accord with theoretical expected values in a table 3, a positive reference substance has a typical dissolution curve, a result is easy to judge, and a clinical sample dissolution curve can be guided to judge the genotype.

As shown in fig. 2: the AA homozygous Tm, the GG homozygous Tm and the AG heterozygous Tm accord with theoretical expected values in a table 3, a positive reference product dissolution curve is typical, a result is easy to judge, and a clinical sample dissolution curve can be guided to judge a genotype.

As shown in fig. 3: the AA homozygous Tm, the GG homozygous Tm and the AG heterozygous accord with theoretical expected values in a table 3, a positive reference substance dissolution curve is typical, a result is easy to judge, and a clinical sample dissolution curve can be guided to judge a genotype.

As shown in fig. 4: TT homozygous Tm, CC homozygous Tm and TC heterozygous Tm accord with theoretical expected values in a table 3, a positive reference substance has a typical dissolution curve, a result is easy to judge, and a clinical sample dissolution curve can be guided to judge the genotype.

As shown in fig. 5: the AA homozygous Tm, the GG homozygous Tm and the AG heterozygous Tm accord with theoretical expected values in a table 3, a positive reference product dissolution curve is typical, a result is easy to judge, and a clinical sample dissolution curve can be guided to judge a genotype.

As shown in fig. 6: the AA homozygous Tm, the GG homozygous Tm and the AG heterozygous Tm accord with theoretical expected values in a table 3, a positive reference product dissolution curve is typical, a result is easy to judge, and a clinical sample dissolution curve can be guided to judge a genotype.

Example 3:

1. reagent sensitivity testing

1) And (3) extracting an experimental sample and each gene subtype clinical sample, diluting the extracted product to 0.5ng of the lowest detection limit of the kit, repeatedly testing for 3 times, and judging a negative result or a positive result through final melting analysis.

2) Experimental sample loading

The reaction solution 1 and the reaction solution 2 were added with 2. mu.L of each sensitivity sample, and each sample was repeatedly tested 3 times to analyze the results.

3) The result of the detection

The results of the two reaction solutions for detecting the sensitive samples are positive, and the repeated results are consistent.

Table 4: sensitivity sample detection results

2. Specific sample testing

1) And (3) an experimental sample, namely verifying the specificity of the reagent by adopting a specificity sample, wherein 2 parts of the specificity sample are large intestine rod genome, 2 parts of crucian egg gene and 2 parts of soybean genome.

2) Experimental sample loading

Adding 2 mu L of specific sample into the reaction solution 1 and the reaction solution 2 respectively, setting negative and positive reference substances simultaneously, and analyzing the result after each sample is tested repeatedly for 1 time.

3) The result of the detection

The results of detecting the specific samples by the three reaction liquids are all negative, which indicates that the kit has good specificity performance.

Table 5: specific sample detection results

Sensitivity sample	Reaction solution 1	Reaction solution 2
			Escherichia coli 1	Negative of	Negative of
Escherichia coli 2	Negative of	Negative of
			Crucian egg gene 1	Negative of	Negative of
Crucian egg gene 2	Negative of	Negative of
			Soybean gene 1	Negative of	Negative of
Soybean gene 2	Negative of	Negative of

Example 4: 20 clinical samples were tested

1) Experimental samples, clinical samples, were obtained from the provincial Hospital of Nanchang, 20 samples were pretreated by the sample diluent in the reagent according to the method of example 1.

2) Experimental sample loading

The diluted clinical samples (2. mu.L) were added to the reaction solutions 1 and 2, and the results were analyzed after 1-time repetition of each sample.

3) The result of the detection

The results of detecting the sensitive samples by the three reaction solutions are positive, and the detection results are as follows:

table 6: clinical sample test results

Compared with the prior art, the method can easily distinguish different mutation types through the Tm value difference generated by the difference of different bases. The invention can see that the total 6 genes relate to 18 subtypes, the invention can easily complete the detection process through 2 reaction tubes, and meanwhile, the detection process does not need the nucleic acid extraction process, thereby simplifying the operation steps and simplifying the interpretation method.

2) High sensitivity, and can detect nucleic acid as low as 0.5 ng.

3) The primary detection flux is large: not only 18 subtypes of 6 alleles are covered, but also the number of required reaction tubes is small.

4) The interpretation is intuitive: different subtypes can be distinguished according to the difference of Tm values, and the instrument automatically interprets.

The above description is only for the purpose of illustrating the preferred embodiments of the present invention and is not to be construed as limiting the invention, and any modifications, equivalents, improvements and the like that fall within the spirit and principle of the present invention are intended to be included therein.

Claims

1. A primer group and a fluorescent probe of a reagent for detecting aspirin gene polymorphism by a multiplex fluorescent probe dissolution curve PCR method are characterized by comprising at least one group of primer pairs or probes of 6 groups of primer pairs or 6 groups of fluorescent probes:

the primer pair and the probe of the GPIIIaPIA 1/A2 gene are as follows:

an upstream primer: 5'-AAGTGGTAGGGCCTGCAGGAGGTAGAG-3', respectively;

a downstream primer: 5'-CCTTCAGCAGATTCTCCTTCAG-3', respectively;

a fluorescent probe: FAM-GCCCTGCCTCCGGGCTCAC-BHQ 1;

the PEAR1 gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-CAGAGAAGCTGGAAGGGAGCCCGTG-3'

A downstream primer: 5-GAGTTCCTGGTGGACAAGAGGATCC-3'

A fluorescent probe: HEX-TCTCACTTCCGTCACCCTTAC-BHQ 1;

the PTGS1 gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-CCAGCCCTGGAATCTGAGTTCAGAGATC-3'

A downstream primer: 5-ATCCCAGAGGGTGGTTGTAAGATT-3'

A fluorescent probe: cy5-ACTACATGCTGGACACTGCACC-BHQ 1;

the GP1BA gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-GCGTGGTCTTGGCGAACTCCAAGAG-3'

A downstream primer: 5-AGCTCAGTCAAGTTGTTGTTAG-3'

A fluorescent probe: FAM-AGGGCTCCTGACGCCCACA-BHQ 1;

the GSTP1 gene primer pair and the fluorescent probe are as follows:

an upstream primer: 5-GGCAGCCCTGGTGGACATGGTGAATG-3'

A downstream primer: 5-GCACAAGAAGCCCCTTTCTTTGTTC-3'

A fluorescent probe: HEX-CTGCAAATACATCTCCCTCAT-BHQ 1;

LTC4S gene primer pair and fluorescent probe are as follows:

an upstream primer: 5-AGGGTTTGGCAGGGGTTGCCAG-3'

A downstream primer: 5-ACATCATGCTGGAGCCAGCCCCAG-3'

A fluorescent probe: CY5-TGGGGACAGGGAACAGAT-BHQ 1.

2. The primer set and the fluorescent probe as claimed in claim 1, wherein the primer set comprises 6 sets of primer pairs and 6 fluorescent probes.

3. An aspirin gene polymorphism multiple fluorescent probe dissolution curve PCR detection reagent, which is characterized in that the reagent comprises the primer group of claim 1 or 2, a fluorescent probe and 6 gene polymorphism plasmid positive standard substances, and the sequences of the standard substances are as follows:

GPIIIaPIA 1/A2 standard sequence:

GPIIIaPIA 1/A2 mutant:

5’-CAGGAAAGACCACAACAATTTGTTTATGCTCCAATGTACGGGGTAAACTCTTAGCTATTGGGAAGTGGTAGGGCCTGCAGGAGGTAGAGAGTCGCCATAGCTCTGATTGCTGGACTTCTCTTTGGGCTCCTGTCTTACAGGCCCTGCCTCTGGGCTCACCTCGCTGTGACCTGAAGGAGAATCTGCTGAAGGATAACTGTGCCCCAGAATCCATCGAGTTCCCAGTGAGTGAGGCCCGAGTACTAGAGGACAGGCCCCTCAGCGACAAGGG-3’；

GPIIIaPIA 1/A wild type:

5’-CAGGAAAGACCACAACAATTTGTTTATGCTCCAATGTACGGGGTAAACTCTTAGCTATTGGGAAGTGGTAGGGCCTGCAGGAGGTAGAGAGTCGCCATAGCTCTGATTGCTGGACTTCTCTTTGGGCTCCTGTCTTACAGGCCCTGCCTCCGGGCTCACCTCGCTGTGACCTGAAGGAGAATCTGCTGAAGGATAACTGTGCCCCAGAATCCATCGAGTTCCCAGTGAGTGAGGCCCGAGTACTAGAGGACAGGCCCCTCAGCGACAAGGG-3’；

PEAR1 standard sequence:

PEAR1 mutant:

5’-GCTTGAACTTGGGCAGGGGTTGGGGGTGCAGAGGTGAGGGGTTATCCTATGCTACATGACTTCCCAGAGAAGCTGGAAGGGAGCCCGTGGGGAAGTCCCTTCTGCTGTCTCACTTCCGTCACCCTTACTCTCTGCTTTCTATAGAAATGGATCCTCTTGTCCACCAGGAACTCTAATCCCCCCCACCCCTGCTCCCCTAGAGCCCACACTCAATTCCTTCCTCCT-3’；

PEAR1 wild type:

5’-GCTTGAACTTGGGCAGGGGTTGGGGGTGCAGAGGTGAGGGGTTATCCTATGCTACATGACTTCCCAGAGAAGCTGGAAGGGAGCCCGTGGGGAAGTCCCTTCTGCTGTCTCACTTCCATCACCCTTACTCTCTGCTTTCTATAGAAATGGATCCTCTTGTCCACCAGGAACTCTAATCCCCCCCACCCCTGCTCCCCTAGAGCCCACACTCAATTCCTTCCTCCT-3’；

PTGS1 standard sequence:

PTGS1 mutant:

5’-GATTCTATAAATTCGGCGGTGGATGTGAGTCTAGCTACAGCATGGACCCTGGCCAGCCCTGGAATCTGAGTTCAGAGATCTTTGAAAAAATGCCTTCCGATAACTGAGCACCTACTACATGCTGGGCACTGCACCAGGAGATTTGTGTGCATTCCCTCATTGAATCTTACAACCACCCTCTGGGATGGTTTTTGCTATTAAGCCGATTTTATAGATGAGAATACTGAGGGCTAGAAAAGATAAGTACCTTGTCCAAGGTGACACG-3’；

PTGS1 wild type:

5’-GATTCTATAAATTCGGCGGTGGATGTGAGTCTAGCTACAGCATGGACCCTGGCCAGCCCTGGAATCTGAGTTCAGAGATCTTTGAAAAAATGCCTTCCGATAACTGAGCACCTACTACATGCTGGACACTGCACCAGGAGATTTGTGTGCATTCCCTCATTGAATCTTACAACCACCCTCTGGGATGGTTTTTGCTATTAAGCCGATTTTATAGATGAGAATACTGAGGGCTAGAAAAGATAAGTACCTTGTCCAAGGTGACACG-3’

GP1BA standard sequence:

GP1BA mutant:

5’-TGGACGTCTCCTTCAACCGGCTGACCTCGCTGCCTCTTGGTGCCCTGCGTGGTCTTGGCGAACTCCAAGAGCTCTACCTGAAAGGCAATGAGCTGAAGACCCTGCCCCCAGGGCTCCTGATGCCCACACCCAAGCTGGAGAAGCTCAGTCTGGCTAACAACAACTTGACTGAGCTCCCCGCTGGGCTCCTGAATGGGCTGGAGAATCTCGACACCCTTCTCCTCCAAGAGAACTCGCTGTA-3’；

GP1BA wild type:

5’-TGGACGTCTCCTTCAACCGGCTGACCTCGCTGCCTCTTGGTGCCCTGCGTGGTCTTGGCGAACTCCAAGAGCTCTACCTGAAAGGCAATGAGCTGAAGACCCTGCCCCCAGGGCTCCTGACGCCCACACCCAAGCTGGAGAAGCTCAGTCTGGCTAACAACAACTTGACTGAGCTCCCCGCTGGGCTCCTGAATGGGCTGGAGAATCTCGACACCCTTCTCCTCCAAGAGAACTCGCTGTA-3’；

GSTP1 standard sequence:

GSTP1 mutant:

5’-CCAACCCCAGGGCTCTATGGGAAGGACCAGCAGGAGGCAGCCCTGGTGGACATGGTGAATGACGGCGTGGAGGACCTCCGCTGCAAATACGTCTCCCTCATCTACACCAACTATGTGAGCATCTGCACCAGGGTTGGGCACTGGGGGCTGAACAAAGAAAGGGGCTTCTTGTGCCCTCACCCCCCTTACCCCTCAGGTGGCTTGGGCTGACCCCTTCTTGGGTCAGGGTGCAGGGGCTGGGTCAGCTCTGG-3’；

GSTP1 wild type:

5’-CCAACCCCAGGGCTCTATGGGAAGGACCAGCAGGAGGCAGCCCTGGTGGACATGGTGAATGACGGCGTGGAGGACCTCCGCTGCAAATACATCTCCCTCATCTACACCAACTATGTGAGCATCTGCACCAGGGTTGGGCACTGGGGGCTGAACAAAGAAAGGGGCTTCTTGTGCCCTCACCCCCCTTACCCCTCAGGTGGCTTGGGCTGACCCCTTCTTGGGTCAGGGTGCAGGGGCTGGGTCAGCTCTGG-3’；

LTC4S standard sequence:

LTC4S mutant:

5’-TTTCCTGAAGGAGAAAGAGCTTGTGGGGCCCAGTGTGGCTGGGGGGGCGCTGGGACTCCATTCTGAAGCCAAAGGCACTGGGAAGGGCTTCCGCAGAGGAGGGTTTGGCAGGGGTTGCCAGGAACAGCCTGGATGGGGACAGGGAACAGATAAGGTGGGTGGAGGAGTTAGCCGGGAGCCTGGGGCTGGCTCCAGCATGATGTGGGGGTCTGCAAGGCCCTGGAGAAAGTGGGGTGGTGCAGCAGGGGGCACACCCACAGCTGGAGCTGACCCAGATGGACAGCTTGGGCTCTGCCACGCGGGACTAGGCAAGGAAGGGGC-3’；

LTC4S wild type:

5’-TTTCCTGAAGGAGAAAGAGCTTGTGGGGCCCAGTGTGGCTGGGGGGGCGCTGGGACTCCATTCTGAAGCCAAAGGCACTGGGAAGGGCTTCCGCAGAGGAGGGTTTGGCAGGGGTTGCCAGGAACAGCCTGGATGGGGACCGGGAACAGATAAGGTGGGTGGAGGAGTTAGCCGGGAGCCTGGGGCTGGCTCCAGCATGATGTGGGGGTCTGCAAGGCCCTGGAGAAAGTGGGGTGGTGCAGCAGGGGGCACACCCACAGCTGGAGCTGACCCAGATGGACAGCTTGGGCTCTGCCACGCGGGACTAGGCAAGGAAGGGGC-3’。

4. the primer set and the fluorescent probe as described in claim 1 or 2 are used for detecting aspirin medication genes.

5. Use of the standard substance sequence of claim 3 in the detection of aspirin administration genes.

6. A multiplex fluorescent probe PCR melting curve method for detecting genes for aspirin use, comprising the primer set, the fluorescent probe or the standard substance sequence of claim 1 or 2, the method comprising the steps of:

(2) PCR reaction solution 1 was prepared from GPIIIaPlA1/A2, PEAR1, PTGS1 primer set, probe set and PCR reaction reagent, and PCR reaction solution 2 was prepared from GP1BA, GSTP1, LTC4S primer set, probe set and PCR reaction reagent, and the total amplification volume was 20. mu.l, wherein the sample volume was 2. mu.l.

(3) Setting a PCR amplification program and a melting program;

7. The assay of claim 6, wherein the sample diluent is one of:

(1) sodium hydroxide solution with concentration of 0.01M-0.1M;

8. The assay of claim 6 or 7, wherein the dilution factor is between 5 and 40.

9. The detection method according to claim 6, wherein the PCR reaction solution has the following composition:

PCR reaction solution 1: tris buffer 20mmol/L, KCl50mmol/L, MgCl₂2mmol/L, dNTPs 2mmol/L, polymerase 20000U/L, GPIIIaPlA1/A2 upstream primer 50nmol/L, GPIIIaPlA1/A2 downstream primer 300nmol/L, GPIIIaPlA1/A2 fluorescent probe 100 nmol/L; upstream of PEAR1Primer 50nmol/L, PEAR1 downstream primer 300nmol/L, PEAR1 fluorescent probe 100 nmol/L; PTGS1 upstream primer 50nmol/L, PTGS1 downstream primer 300nmol/L, PTGS1 fluorescent probe 100 nmol/L.

10. The assay of claim 9, wherein the Tris buffer has a pH of 8.5.