CN111019938B - Long-chain DNA with sticky end and preparation method thereof - Google Patents
Long-chain DNA with sticky end and preparation method thereof Download PDFInfo
- Publication number
- CN111019938B CN111019938B CN201911244562.XA CN201911244562A CN111019938B CN 111019938 B CN111019938 B CN 111019938B CN 201911244562 A CN201911244562 A CN 201911244562A CN 111019938 B CN111019938 B CN 111019938B
- Authority
- CN
- China
- Prior art keywords
- dna
- single strand
- primer
- double
- chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a long-chain DNA with a sticky end and a preparation method thereof, wherein the preparation method comprises the following steps: the method comprises the steps of adding a double-stranded linear DNA pre-primer with a sticky end and a double-stranded linear DNA post-primer with a sticky end into an EP tube, enabling the final concentration of the pre-primer and the double-stranded linear DNA post-primer to be equal to 0.1-2.0 mu M, enabling the final concentration of target DNA sequence to be 0.1-3 ng/. Mu.l, adding 1-mu.l DNA polymerase, adding 50 mu.l of deionized water, placing into a PCR instrument, and carrying out PCR amplification to obtain long-chain DNA with the sticky end. The double-stranded linear DNA front and back primers with the sticky ends have good thermal stability and can bear the high temperature of more than 90 ℃ without being melted. The long-chain DNA with the sticky end constructed by the invention can be used as a material with excellent biocompatibility and can also be used as a basic plate for synthesizing large-fragment DNA.
Description
Technical Field
The invention belongs to the field of DNA synthesis of biosynthesis technology, and relates to long-chain DNA with a sticky end and a preparation method thereof.
Background
With the rapid development of the field of synthetic biology, the design and rewriting of biological genomes by humans has become increasingly realistic. Synthetic genomics is an important research direction of synthetic biology, can be used as a research means for exploring gene functions, can promote the production of novel medicines, and has wide application potential in the field of biological medicines. DNA synthesis and splicing techniques, which serve as the basis and core of synthetic genomics, will become the key to drive the development of genomics and even synthetic biology.
The synthesis and assembly of DNA is based on synthesizing oligonucleotide chain from head, and the synthesis of large fragment genome is realized through subsequent assembly and splicing, and the synthesis comprises two processes of in vitro splicing and intracellular assembly. In vitro splicing of DNA requires the help of various tool enzymes to realize the cutting of DNA chains, the generation of sticky ends, double-chain connection, the filling of gaps and the like, and the DNA fragments spliced in vitro can reach hundreds of kb generally, and the DNA can be further assembled to Mb level by the help of a homologous recombination system of a microorganism.
However, when amplifying DNA fragments in vitro using a tool enzyme, there is often obtained a nucleic acid product having a blunt end, and the ligation efficiency of a DNA strand having a blunt end is low, and it is necessary to additionally introduce a restriction enzyme for treatment to produce a cohesive end, but the number of cohesive end bases produced by the enzyme is limited, and it is difficult to support ligation of larger fragments, so that this method has a drawback. If long-chain DNA with a sticky end can be designed and synthesized, the complex operation of using an enzyme to generate the sticky end can be avoided, and the efficiency of DNA amplification can be improved, so that the further splicing and assembly of large-fragment DNA can be realized more conveniently.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provide a double-stranded linear DNA (deoxyribonucleic acid) front primer with a sticky end.
A second object of the present invention is to provide a method for preparing a double-stranded linear DNA pre-primer having a cohesive end.
A third object of the present invention is to provide a double-stranded linear DNA back primer with a cohesive end.
A fourth object of the present invention is to provide a method for preparing a double-stranded linear DNA back primer having a cohesive end.
It is a fifth object of the present invention to provide a long-chain DNA having a cohesive end.
A sixth object of the present invention is to provide a method for producing a long-chain DNA having a cohesive end.
A method for preparing a double-stranded linear DNA (deoxyribonucleic acid) precursor with a sticky end comprises the following steps:
(1) Taking 2 DNA single strands with the same mole number, and carrying out double-strand base complementary pairing through annealing;
the first DNA single strand consists of 30-105 nucleotides, and the second DNA single strand consists of 15-105 nucleotides; each DNA single strand consists of a first portion and a second portion:
the first part of the first DNA single strand is 20-30 nucleotides at the 3' -end of the DNA single strand, and is used as a cohesive end sequence of a front primer of a subsequent reaction;
the first part of the second DNA single strand is 5-30 nucleotides at the 3' -end of the DNA single strand, and is used as a cohesive end sequence of long-chain DNA;
the second part of the nucleotide sequence of the first DNA single strand is matched with the second part of the nucleotide sequence of the second DNA single strand in an equal number and reverse complementary manner;
(2) The product obtained in the step (1) is prepared into a psoralen compound according to the molar ratio of 1:10-100, and irradiating with ultraviolet under the irradiation energy of 1-6J to obtain double-stranded linear DNA pre-primer with sticky end.
The double-stranded linear DNA pre-primer with sticky ends prepared by the method.
A preparation method of a double-stranded linear DNA post-primer with a sticky end comprises the following steps:
(1) Taking 2 DNA single strands with the same mole number, and carrying out double-strand base complementary pairing through annealing;
the first DNA single strand consists of 30-105 nucleotides, and the second DNA single strand consists of 15-105 nucleotides; each DNA single strand consists of a first portion and a second portion:
the first part of the first DNA single strand is 20-30 nucleotides at the 3' -end of the DNA single strand, and is used as a cohesive end sequence of a post primer of a subsequent reaction;
the first part of the second DNA single strand is 5-30 nucleotides at the 3' -end of the DNA single strand, and is used as a cohesive end sequence of long-chain DNA;
the second part of the nucleotide sequence of the first DNA single strand is matched with the second part of the nucleotide sequence of the second DNA single strand in an equal number and reverse complementary manner;
(2) The product obtained in the step (1) is prepared into a psoralen compound according to the molar ratio of 1:10-100, and irradiating with ultraviolet under the irradiation energy of 1-6J to obtain double-stranded linear DNA post-primer with sticky end.
The double-stranded linear DNA post primer with cohesive ends prepared by the method.
A method for preparing long-chain DNA with sticky ends, comprising the following steps:
the double-stranded linear DNA pre-primer with the sticky end as claimed in claim 2 and the double-stranded linear DNA post-primer with the sticky end as claimed in claim 4 are added into an EP tube, the final concentration of the two primers is equal and is 0.1-2.0 mu M, the target DNA sequence is 0.1-3 ng/mu L, and 1 mu L of DNA polymerase, and finally a 50 mu L system is supplemented by deionized water, and the mixture is placed into a PCR instrument for PCR amplification, so that long-chain DNA with the sticky end is obtained.
The long-chain DNA with the sticky end prepared by the method.
The invention has the advantages that:
the double-stranded linear DNA front and back primers with the sticky ends have good thermal stability and can bear the high temperature of more than 90 ℃ without being melted.
The long-chain DNA with the sticky end constructed by the invention can be used as a material with excellent biocompatibility and can also be used as a basic plate for synthesizing large-fragment DNA.
Drawings
FIG. 1 is a flow chart of the preparation of long-chain DNA with sticky ends according to the present invention;
FIG. 2 is an electrophoretogram of the double-stranded linear DNA pre-primer synthesis with sticky ends of the present invention, wherein M is a DNA standard; 1 is a first single strand of DNA (SEQ ID NO. 9); 2 is a second single strand of DNA (SEQ ID NO. 10); 3 is a double-stranded linear DNA pre-primer with a sticky end.
FIG. 3 is an electrophoretogram of the long-chain DNA synthesis with sticky ends of the present invention, wherein M is a DNA standard; 1 is a long-chain DNA with a cohesive end.
FIG. 4 is a schematic diagram of a double-stranded linear DNA pre-primer with cohesive ends according to the present invention.
FIG. 5 is an electrophoretogram of a large fragment of DNA product synthesized by using long-chain DNA with sticky ends as a basic plate according to the invention, wherein M is a DNA standard; 1 is a large fragment of DNA product synthesized.
Detailed Description
The invention is further illustrated by the following examples. The following examples are intended to enable those skilled in the art to better understand the present invention and are not intended to limit the present invention in any way.
The specific sequences of the respective primers referred to in the examples below are disclosed to enable those skilled in the art to practice the invention better, but the present invention is not limited thereto.
Example 1
A preparation method of a double-stranded linear DNA (deoxyribonucleic acid) pre-primer with a sticky end comprises the following steps:
(1) Taking 2 DNA single strands with the same mole number:
the first DNA single strand consists of 30 nucleotides:
the second DNA single strand consists of 15 nucleotides:
each DNA single strand consists of a first portion and a second portion;
the first part of the first DNA single strand is 20 nucleotides at the 3' end of the DNA single strand, which serves as a cohesive end sequence of a primer for subsequent reactions (see the wavy underlined sequence in SEQ ID NO. 1);
the first part of the second DNA single strand is 5 nucleotides at the 3' end of the DNA single strand, as a cohesive end sequence of long-chain DNA (see double underlined sequence in SEQ ID NO. 2);
the second partial nucleotide sequence of the first DNA single strand (underlined in SEQ ID NO. 1) is identical in number and complementary to the second partial nucleotide sequence of the second DNA single strand (underlined in SEQ ID NO. 2) in reverse.
(2) Adding NaCl to make the final concentration of NaCl be 50mM, uniformly mixing, placing in a PCR instrument, controlling the temperature from 90 ℃ and cooling to 25 ℃ within 0.5 hour;
(3) The molar ratio of the product obtained in the step (2) to psoralen is 1:10, and irradiating with ultraviolet light under irradiation energy of 1J to obtain a double-stranded linear DNA precursor having a cohesive end.
A double-stranded linear DNA pre-primer with cohesive ends, consisting of 2 DNA single strands (see 1 and 2 in FIG. 4); the first DNA single strand consists of 30 nucleotides and the second DNA single strand consists of 15 nucleotides; each DNA single strand consists of a first part and a second part (denoted by (1) and (2), respectively in the figure):
the first part of the first DNA single strand is 20 nucleotides at the 3' end of the DNA single strand, which is used as a cohesive end sequence of a front primer of a subsequent reaction; the first part of the second DNA single strand is 5 nucleotides at the 3' end of the DNA single strand, which is used as a cohesive end sequence of long-chain DNA; the second portion of the first single strand of DNA contains 10 nucleotides and the nucleotide sequence of the second portion is reverse complementary paired with the 10 nucleotide sequence of the second portion of the second single strand of DNA.
Example 2
The preparation method of the double-stranded linear DNA post-primer with the sticky end comprises the following steps:
(1) Taking 2 DNA single strands with the same mole number:
the first DNA single strand consists of 30 nucleotides:
the second DNA single strand consists of 15 nucleotides:
each DNA single strand consists of a first portion and a second portion;
the first part of the first DNA single strand is 20 nucleotides at the 3' end of the DNA single strand, which serves as a cohesive end sequence for the subsequent reaction (see the wavy underlined sequence in SEQ ID NO. 3);
the first part of the second DNA single strand is 5 nucleotides at the 3' end of the DNA single strand, as a cohesive end sequence of long-chain DNA (see double underlined sequence in SEQ ID NO. 4);
the second partial nucleotide sequence of the first DNA single strand (underlined in SEQ ID NO. 3) is identical in number and complementary to the second partial nucleotide sequence of the second DNA single strand (underlined in SEQ ID NO. 4) in reverse.
(2) Adding NaCl to make the final concentration of NaCl be 50mM, uniformly mixing, placing in a PCR instrument, controlling the temperature from 90 ℃ and cooling to 25 ℃ within 0.5 hour;
(3) The molar ratio of the product obtained in the step (2) to psoralen is 1:10, and irradiating with ultraviolet light under irradiation energy of 1J to obtain a double-stranded linear DNA post-primer having a cohesive end.
Example 3
A method for preparing long-chain DNA with sticky ends, comprising the following steps:
the double-stranded linear DNA pre-primer with cohesive end prepared in example 1 and the double-stranded linear DNA post-primer with cohesive end prepared in example 2 were added to an EP tube so that the final concentration thereof was equal and the final concentration was 0.1. Mu.M, the target DNA sequence was 5'TAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGGATCTCGATCCCGCGAAATTAATACGACTCACTATAGGGAGACCACAACGGTTTCCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGAGCTTTTCACTGGCGTTGTTCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAG3'SEQ ID NO.13), the final concentration of the nucleic acid sequence shown in SEQ ID NO.13 was 0.1 ng/. Mu.l, and 1 XdNA polymerase, and finally a 50. Mu.l system was filled with deionized water and placed in a PCR instrument for PCR amplification to obtain a long-chain DNA with cohesive end.
The PCR procedure was as follows: preheating for 3min at 95 ℃; denaturation of the ground materials at 95 ℃ for 30s; annealing at 55 ℃ for 30s; extending at 72 ℃ for 60s; (15. About. Repeating 30 cycles); and finally extending for 10min at 72 ℃. As shown in fig. 1.
Example 4
A preparation method of a double-stranded linear DNA (deoxyribonucleic acid) pre-primer with a sticky end comprises the following steps:
(1) Taking 2 DNA single strands with the same mole number:
the first DNA single strand consists of 105 nucleotides:
the second DNA single strand consists of 105 nucleotides:
each DNA single strand consists of a first portion and a second portion;
the first part of the first DNA single strand is 30 nucleotides at the 3' end of the DNA single strand, which serves as a cohesive end sequence for the primers for the subsequent reaction (see the wavy underlined sequence in SEQ ID NO. 5);
the first part of the second DNA single strand is 30 nucleotides at the 3' end of the DNA single strand, as a cohesive end sequence of long-chain DNA (see double underlined sequence in SEQ ID NO. 6);
the second partial nucleotide sequence of the first DNA single strand (underlined in SEQ ID NO. 5) is identical in number and complementary to the second partial nucleotide sequence of the second DNA single strand (underlined in SEQ ID NO. 6) in reverse.
(2) Adding NaCl to make the final concentration of NaCl be 100mM, uniformly mixing, placing in a PCR instrument, controlling the temperature from 95 ℃ and cooling to 4 ℃ within 2 hours;
(3) The molar ratio of the product obtained in the step (2) to psoralen is 1:100, and irradiating with ultraviolet light under an irradiation energy of 6J to obtain a double-stranded linear DNA precursor having a cohesive end.
Example 5
The preparation method of the double-stranded linear DNA post-primer with the sticky end comprises the following steps:
(1) Taking 2 DNA single strands with the same mole number:
the first DNA single strand consists of 105 nucleotides:
the second DNA single strand consists of 105 nucleotides:
each DNA single strand consists of a first portion and a second portion;
the first part of the first DNA single strand is 30 nucleotides at the 3' end of the DNA single strand, which serves as a cohesive end sequence for the subsequent reaction (see the wavy underlined sequence in SEQ ID NO. 7);
the first part of the second DNA single strand is 30 nucleotides at the 3' end of the DNA single strand, as a cohesive end sequence of long-chain DNA (see double underlined sequence in SEQ ID NO. 8);
the second partial nucleotide sequence of the first DNA single strand (underlined in SEQ ID NO. 7) is identical in number and complementary to the second partial nucleotide sequence of the second DNA single strand (underlined in SEQ ID NO. 8) in reverse.
(2) Adding NaCl to make the final concentration of NaCl be 100mM, uniformly mixing, placing in a PCR instrument, controlling the temperature from 95 ℃ and cooling to 4 ℃ within 2 hours;
(3) The molar ratio of the product obtained in the step (2) to psoralen is 1:100, and irradiating with ultraviolet light under an irradiation energy of 6J to obtain a double-stranded linear DNA post-primer having a cohesive end.
Example 6
A method for preparing long-chain DNA with sticky ends, comprising the following steps:
the double-stranded linear DNA pre-primer with cohesive end prepared in example 4 and the double-stranded linear DNA post-primer with cohesive end prepared in example 5 were added to an EP tube so that the final concentration thereof was equal and the final concentration was 2.0. Mu.M, the target DNA sequence (SEQ ID NO. 13) was 3 ng/. Mu.l, the nucleic acid sequence shown in SEQ ID NO.13 was 3 ng/. Mu.l, and 1 Xd DNA polymerase, and finally a 50. Mu.l system was filled with deionized water, and the mixture was placed in a PCR apparatus for PCR amplification to obtain a long-chain DNA with cohesive end.
The PCR procedure was as follows: preheating for 3min at 95 ℃; denaturation of the ground materials at 95 ℃ for 30s; annealing at 55 ℃ for 30s; extending at 72 ℃ for 60s; (15. About. Repeating 30 cycles); and finally extending for 10min at 72 ℃.
Example 7
A method for preparing a double-stranded linear DNA (see FIG. 2) with cohesive ends, comprising the steps of:
(1) 2 kinds of DNA single strands with the same mole number are taken:
the first DNA single strand consists of 61 nucleotides:
the second DNA single strand consists of 49 nucleotides:
each DNA single strand consists of a first portion and a second portion;
the first part of the first DNA single strand is 23 nucleotides at the 3' end of the DNA single strand, which serves as a cohesive end sequence for the primers for the subsequent reaction (see the wavy underlined sequence in SEQ ID NO. 9);
the first part of the second DNA single strand is 11 nucleotides at the 3' end of the DNA single strand, as a cohesive end sequence of long-chain DNA (see double underlined sequence in SEQ ID NO. 10);
the second partial nucleotide sequence of the first DNA single strand (underlined in SEQ ID NO. 9) is identical in number and complementary to the second partial nucleotide sequence of the second DNA single strand (underlined in SEQ ID NO. 10) in reverse.
(2) Adding NaCl to make the final concentration of NaCl 80mM, mixing, placing in a PCR instrument, controlling the temperature from 94 ℃ and cooling to 25 ℃ within 1 hour;
(3) The molar ratio of the product obtained in the step (2) to psoralen is 1:50, and irradiating with ultraviolet light under an irradiation energy of 4J to obtain a double-stranded linear DNA precursor having a cohesive end.
Example 8
The preparation method of the double-stranded linear DNA post-primer with the sticky end comprises the following steps:
(1) Taking 2 DNA single strands with the same mole number:
the first DNA single strand consists of 62 nucleotides:
the second DNA single strand consists of 49 nucleotides:
each DNA single strand consists of a first portion and a second portion;
the first part of the first DNA single strand is 24 nucleotides at the 3' end of the DNA single strand, which serves as a cohesive end sequence for the subsequent reaction (see the wavy underlined sequence in SEQ ID NO. 11);
the first part of the second DNA single strand is 11 nucleotides at the 3' end of the DNA single strand, as a cohesive end sequence of long-chain DNA (see double underlined sequence in SEQ ID NO. 12);
the second partial nucleotide sequence of the first DNA single strand (underlined in SEQ ID NO. 11) is identical in number and complementary to the second partial nucleotide sequence of the second DNA single strand (underlined in SEQ ID NO. 12) in reverse.
(2) Adding NaCl to make the final concentration of NaCl 80mM, mixing, placing in a PCR instrument, controlling the temperature from 94 ℃ and cooling to 25 ℃ within 1 hour;
(3) The molar ratio of the product obtained in the step (2) to psoralen is 1:50, and irradiating with ultraviolet light under an irradiation energy of 4J to obtain a double-stranded linear DNA post-primer having a cohesive end.
Example 9
A method for preparing long-chain DNA with sticky ends, comprising the following steps:
the double-stranded linear DNA pre-primer with cohesive end prepared in example 7 and the double-stranded linear DNA post-primer with cohesive end prepared in example 8 were added to an EP tube so that the final concentration thereof was equal and the final concentration was 0.125. Mu.M, the target DNA sequence (SEQ ID NO. 13) was set to a final concentration of the nucleic acid sequence shown in SEQ ID NO.13 of 0.2 ng/. Mu.l, and 1. Mu.l DNA polymerase, and finally a 50. Mu.l system was filled with deionized water and placed in a PCR instrument for PCR amplification to obtain a long-chain DNA with cohesive end, FIG. 3. The reason for the 3 bands of the 1 product in FIG. 3 is that the cohesive end sequences of the cohesive end long-chain DNA may form an i-motif structure, resulting in two or three cohesive end long-chain DNA being joined end to end.
The PCR procedure was as follows: preheating for 3min at 95 ℃; denaturation of the ground materials at 95 ℃ for 30s; annealing at 55 ℃ for 30s; extending at 72 ℃ for 60s; (15. About. Repeating 30 cycles); final extension at 72℃for 10min
The invention proposes that double-stranded DNA with sticky ends is amplified by Polymerase Chain Reaction (PCR) by taking double-stranded DNA with sticky ends as a primer. Electrophoresis shows that the double-stranded DNA with the sticky end is used as a primer to successfully amplify the long-chain DNA with the sticky end.
The long-chain DNAs with cohesive ends prepared in example 9 of the present invention were able to join to each other at ph=5.0 over cohesive ends, resulting in longer DNAs, see fig. 5.
Which are described by way of example, it will be apparent to those skilled in the relevant art that variations and suitable alterations and combinations can be made to the methods described herein without departing from the spirit and scope of the invention. It is expressly intended that all such similar substitutes and modifications apparent to those skilled in the art are deemed to be included within the spirit, scope and content of the invention.
Sequence listing
<110> university of Tianjin
<120> Long-chain DNA having sticky ends and method for preparing the same
<160> 13
<170> SIPOSequenceListing 1.0
<210> 1
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
agtacatgag taaccgtatt accgcctttg 30
<210> 2
<211> 15
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
ctcatgtact cctac 15
<210> 3
<211> 30
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
agtacatgag ctcgccggac acgctgaact 30
<210> 4
<211> 15
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
ctcatgtact ctacc 15
<210> 5
<211> 105
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
atgcatatcg ctacacatgg accgatatca tatgtacatt actatagtac ctgagaccga 60
taggcatatg ctagttaacc gtattaccgc ctttgagtga gctga 105
<210> 6
<211> 105
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
actagcatat gcctatcggt ctcaggtact atagtaatgt acatatgata tcggtccatg 60
tgtagcgata tgcatcctaa cctaagcccc ggtatgccaa tcagg 105
<210> 7
<211> 105
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atgcatatcg ctacacatgg accgatatca tatgtacatt actatagtac ctgagaccga 60
taggcatatg ctagtctcgc cggacacgct gaacttgtgg ccgtt 105
<210> 8
<211> 105
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
actagcatat gcctatcggt ctcaggtact atagtaatgt acatatgata tcggtccatg 60
tgtagcgata tgcatcccat gacggtggcc caatcctaac ctaag 105
<210> 9
<211> 61
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
tggaccgata tcatatgtac attactatag tacctgagta accgtattac cgcctttgag 60
t 61
<210> 10
<211> 49
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
ctcaggtact atagtaatgt acatatgata tcggtccacc cctaacccc 49
<210> 11
<211> 62
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
tggaccgata tcatatgtac attactatag tacctgagct cgccggacac gctgaacttg 60
tg 62
<210> 12
<211> 49
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
ctcaggtact atagtaatgt acatatgata tcggtccacc cctaacccc 49
<210> 13
<211> 326
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg 60
cagcgagtca gtgagcgagg aagcggaaga gcgcccaata cgcaaaccgc ctctccccgc 120
gcgttggccg attcattaat gcaggatctc gatcccgcga aattaatacg actcactata 180
gggagaccac aacggtttcc ctctagaaat aattttgttt aactttaaga aggagatata 240
ccatggagct tttcactggc gttgttccca tcctggtcga gctggacggc gacgtaaacg 300
gccacaagtt cagcgtgtcc ggcgag 326
Claims (2)
1. A method for preparing a double-stranded linear DNA pre-primer or post-primer with a sticky end is characterized by comprising the following steps:
(1) Taking 2 DNA single strands with the same mole number, and carrying out double-strand base complementary pairing through annealing;
the first DNA single strand consists of 30-105 nucleotides, and the second DNA single strand consists of 15-105 nucleotides; each DNA single strand consists of a first portion and a second portion:
the first part of the first DNA single strand is 20-30 nucleotides at the 3' -end of the DNA single strand, and is used as a cohesive end sequence of a front primer of a subsequent reaction;
the first part of the second DNA single strand is 5-30 nucleotides at the 3' -end of the DNA single strand, and is used as a cohesive end sequence of long-chain DNA;
the second part of the nucleotide sequence of the first DNA single strand is matched with the second part of the nucleotide sequence of the second DNA single strand in an equal number and reverse complementary manner;
(2) The product obtained in the step (1) is prepared into a psoralen compound according to the molar ratio of 1:10-100, and irradiating with ultraviolet under the irradiation energy of 1-6J to obtain double-stranded linear DNA pre-primer or post-primer with adhesive end.
2. The preparation method of the long-chain DNA with the sticky end is characterized by comprising the following steps:
adding the double-chain linear DNA pre-primer and the double-chain linear DNA post-primer with the sticky ends, which are disclosed in the claim 1, into an EP tube, enabling the final concentration of the double-chain linear DNA pre-primer and the double-chain linear DNA post-primer to be equal and to be 0.1-2.0 mu M, enabling the final concentration of the target DNA sequence to be 0.1-3 ng/mu L, enabling the final concentration of the target DNA sequence to be 1 mu L, enabling the target DNA polymerase to be 1 mu L, and finally using deionized water to complement a 50 mu L system, placing the system into a PCR instrument, and carrying out PCR amplification to obtain long-chain DNA with the sticky ends.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911244562.XA CN111019938B (en) | 2019-12-06 | 2019-12-06 | Long-chain DNA with sticky end and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911244562.XA CN111019938B (en) | 2019-12-06 | 2019-12-06 | Long-chain DNA with sticky end and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111019938A CN111019938A (en) | 2020-04-17 |
| CN111019938B true CN111019938B (en) | 2023-07-18 |
Family
ID=70207447
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911244562.XA Active CN111019938B (en) | 2019-12-06 | 2019-12-06 | Long-chain DNA with sticky end and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111019938B (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998005765A1 (en) * | 1996-08-07 | 1998-02-12 | Novo Nordisk A/S | Double-stranded dna with cohesive end(s), and method of shuffling dna using the same |
| WO1999002725A1 (en) * | 1997-07-11 | 1999-01-21 | Brax Group Limited | Categorising nucleic acid |
| CN103305498A (en) * | 2012-03-06 | 2013-09-18 | 中国科学院上海生命科学研究院 | Method for producing preset cohesive end at double-stranded DNA fragment end |
| CN107541510A (en) * | 2017-09-29 | 2018-01-05 | 天津大学 | Dendritic gene cluster nano material and preparation method and application |
-
2019
- 2019-12-06 CN CN201911244562.XA patent/CN111019938B/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998005765A1 (en) * | 1996-08-07 | 1998-02-12 | Novo Nordisk A/S | Double-stranded dna with cohesive end(s), and method of shuffling dna using the same |
| WO1999002725A1 (en) * | 1997-07-11 | 1999-01-21 | Brax Group Limited | Categorising nucleic acid |
| CN103305498A (en) * | 2012-03-06 | 2013-09-18 | 中国科学院上海生命科学研究院 | Method for producing preset cohesive end at double-stranded DNA fragment end |
| CN107541510A (en) * | 2017-09-29 | 2018-01-05 | 天津大学 | Dendritic gene cluster nano material and preparation method and application |
Non-Patent Citations (1)
| Title |
|---|
| Mark R. Hartman等.Thermostable Branched DNA Nanostructures as Modular Primers for Polymerase Chain Reaction.《Angew Chem Int Ed Engl》.2013,第52卷(第33期),第8699页图1，第8701页左栏第1段，第8701页左栏图3，第8699页右栏第2段、图1，第8701页右栏，第8700页右栏第1、4段. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111019938A (en) | 2020-04-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105121655B (en) | Novel ligase activity | |
| AU2016220404B2 (en) | DNA sequencing using controlled strand displacement | |
| JP4789271B2 (en) | Synthesis of nucleic acid molecules with minimized errors | |
| JP2018139603A (en) | Dna minicircle and use thereof | |
| AU2014363967A1 (en) | Long nucleic acid sequences containing variable regions | |
| WO2000075374A1 (en) | Solid phase methods for amplifying multiple nucleic acids | |
| CN108018270A (en) | To lift the recombinant DNA polymerase that nucleotide analog is incorporated to | |
| WO2021128441A1 (en) | Controlled strand-displacement for paired-end sequencing | |
| WO2023098492A1 (en) | Sequencing library construction method and application | |
| EP4150106A2 (en) | Methods for ligation-coupled-pcr | |
| KR102014989B1 (en) | Polynucleotide and use thereof | |
| KR20020007359A (en) | Amplification and Sequencing Primer Pairs and Use thereof | |
| CN111019938B (en) | Long-chain DNA with sticky end and preparation method thereof | |
| JP6069314B2 (en) | Large-scale synthesis method of long nucleic acid molecules | |
| KR20140027814A (en) | Method for amplifying dna from rna in a sample | |
| CN115244186A (en) | Method for assembling nucleic acids | |
| JP5129498B2 (en) | Nucleic acid cloning method | |
| JP7191115B2 (en) | Method for amplification of nucleic acids by endonuclease-mediated migration equilibrium (EM-SEq) | |
| KR101264295B1 (en) | Hierarchial Gene Synthesis Methods of a Target Nucleic Acid Sequence | |
| US20030180781A1 (en) | Constructing very long DNA sequences from synthetic DNA molecules | |
| WO2022239632A1 (en) | Method for producing synthesized dna molecule | |
| CN115605590A (en) | Method for preparing site-directed modified long-chain DNA | |
| CN115667511A (en) | On-demand synthesis of polynucleotide sequences | |
| CN115976010A (en) | Hydrogel based on non-natural nucleic acid element rolling circle amplification technology and preparation method and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |