CN111019927A - Recombinant plasmid and recombinant engineering bacterium for expressing TEV protein, and method for preparing and purifying TEV protein - Google Patents

Abstract

The application discloses a recombinant plasmid for expressing TEV protein, which comprises a skeleton plasmid sequence and a TEV protein expression segment; the TEV protein expression fragment sequentially consists of an upstream restriction endonuclease site, a protease enzyme cutting site sequence, His6, a nucleotide sequence for expressing TEV and a downstream restriction endonuclease site. The invention also provides a recombinant engineering bacterium for expressing the TEV protein and a fermentation and purification process thereof. The invention can help bioengineering pharmaceutical enterprises and laboratory researchers to quickly, simply and cheaply obtain tool enzyme, and solve the problems of research and production.

Description

Recombinant plasmid and recombinant engineering bacterium for expressing TEV protein, and method for preparing and purifying TEV protein

Technical Field

The invention belongs to the technical field of biology, and relates to a method for efficiently preparing tobacco etching virus protease.

Background

In biological research and biopharmaceutical practice, it is desirable to express a wide variety of proteins or polypeptides. In the recombinant expression of these proteins or polypeptides using vectors, phenomena such as incorrect disulfide bond formation, incorrect folding, low expression level, and even no expression, occur. In order to overcome the difficulty of recombinant expression of target protein, target protein or polypeptide is often fused with appropriate leader peptide, and the leader peptide is used to assist the formation of correct structure of target protein and to increase expression level. However, this in turn leads to problems in how to remove the leader peptide from the fusion protein to purify the recombinant protein. Protease methods are widely used because of their mild conditions, non-toxicity, and high specificity. Commonly used tool proteases include thrombin (recognition site: Leu-Val-Pro-Arg ↓: Gly- -Ser), PreScission protease (recognition site: Leu-Glu-Val-Phe-Gln ↓: Gly-Pro), factor Xa (recognition site: Ile-Glu/Asp-Gly-Arg ↓) and enterokinase (recognition site: Asp-Asp-Asp-Asp-Lys ↓), which do not leave redundant amino acids at the amino terminal of the target protein after cleavage, and the two enzymes are preferred for adding amino acid sensitive polypeptide or protein at the amino terminal. However, to obtain high activity factor Xa or enterokinase, eukaryotic expression is generally required, the production process is complicated, and the cost is high. TEV protease recognizes a seven amino acid sequence Glu-Asn-Leu-Tyr-Phe-Gln ↓ Gly/Ser, and cleavage occurs between Gln and Gly/Ser, which results in one Gly or Ser more at the amino terminus of the target protein. The optimum temperature for TEV protease cleavage is 30 ℃, but the enzyme has better activity at 4 ℃, and has activity in the presence of a plurality of protease inhibitors and 2mol/L urea, and the prokaryotic expression TEV enzyme also has good activity. Therefore, TEV protease is an ideal choice for removing the tag of fusion protein, especially the target protein with Gly or Ser as the first amino acid at the amino terminal.

Most of the methods for directly expressing TEV enzyme by using an escherichia coli system in the prior art are expressed in the form of inclusion bodies, and the yield and the solubility are low. In order to increase the solubility, renaturation from inclusion bodies is considered to increase the yield of protease, but the effect is not desirable and time and labor are wasted.

Disclosure of Invention

In view of the above technical problems, the present application aims to provide a complete set of solutions for preparing high-activity TEV enzyme from upstream construction to large-scale fermentation and purification by selecting appropriate leader peptides to help the TEV enzyme fold correctly and achieve soluble expression.

The invention discloses a recombinant plasmid for expressing TEV protein, which comprises a skeleton plasmid sequence and a TEV protein expression segment; the TEV protein expression fragment sequentially consists of an upstream restriction endonuclease site, a protease enzyme cutting site sequence, His6, a nucleotide sequence for expressing TEV and a downstream restriction endonuclease site, wherein the protease enzyme cutting site sequence is selected from one of an enzyme cutting site sequence for expressing TEV, an enzyme cutting site sequence for expressing EK enzyme and an enzyme cutting site sequence for expressing Xa factor protease; the skeleton plasmid is selected from one of pCOLD-SUMO, pMal-c4X, pET32a, pET39b (+) and pGEX-6P-2.

In one embodiment according to the invention, the upstream restriction enzyme site is BamHI.

In one embodiment according to the invention, the downstream restriction enzyme site is HindIII or NotI.

In one embodiment according to the present invention, the backbone plasmid is pCOLD-SUMO and the protease cleavage site sequence is an expression TEV enzyme cleavage site sequence.

In one embodiment according to the present invention, the backbone plasmid is pGEX-6P-2 and the protease cleavage site sequence is an expression TEV enzyme cleavage site sequence.

The invention also provides a recombinant engineering bacterium for expressing TEV protein, which contains the recombinant plasmid, and the host bacterium is XL1-Blue or BL21(DE 3).

In one embodiment of the invention, the host bacterium is XL1-Blue, and the recombinant plasmid is a plasmid with pGEX-6P-2 as a skeleton and a TEV enzyme cutting site sequence as a protease cutting site sequence.

In one embodiment of the present invention, the host bacterium is BL21(DE3), and the recombinant plasmid is a plasmid with pCOLD-SUMO as a backbone and TEV enzyme cleavage site sequence as a protease cleavage site sequence.

The invention further provides a fermentation method for preparing TEV protein by utilizing the recombinant engineering bacteria, which comprises the following steps:

inoculating the recombinant engineering bacteria into an animal source TB culture medium, and adding IPTG (isopropyl-beta-D-thiogalactoside) for induction expression when the bacteria are shaken and propagated to a logarithmic phase.

Preferably, the content of peptone and yeast extract in the TB culture medium is half of the content of a normal TB culture medium, and the content of glycerol is 2 ml/L;

preferably, the inoculation ratio of the recombinant engineering bacteria in the fermentation tank is 8-12%, preferably 10%, and the seed bacteria are transferred to OD_600nmThe value is 2.0-3.0;

preferably, the glycerol content in the culture medium is 1-4ml/L, preferably 2 ml/L;

preferably, the concentration of dissolved oxygen in the culture medium is 30% -50%, preferably 40%;

preferably, the induction condition in the culture medium is induction for 2-12h at the temperature of 16-30 ℃ and the final concentration of IPTG is 0.1-1mmol/L, and preferably induction for 5h at the temperature of 25 ℃ and the final concentration of IPTG is 0.2 mmol/L.

The invention also provides a purification method of the recombinant TEV protein, which comprises affinity chromatography and buffer solution replacement which are sequentially carried out.

1) And (3) mixing the completely fermented thalli with a bacterium breaking buffer solution in a ratio of 1g:8ml of the mixture is mixed according to the weight-volume ratio, evenly mixed and suspended, precooled at 4 ℃ and crushed under high pressure; then, centrifuging at a high speed, and collecting supernatant for later use; wherein the bacterium breaking buffer solution is prepared from 20mmol/L PB, 150mmol/L sodium chloride, 10mmol/L imidazole and pH7.0 buffer solution;

2) purifying by Ni NTA affinity chromatography;

adding 100ml of NI filler into each liter of supernatant, and combining for more than 1h at 20-25 ℃; washing with 20mmol/L PB +150mmol/L sodium chloride +25mmol/L imidazole and pH7.0 to remove impurities, adding 100ml20mmol/L PB +150mmol/L sodium chloride +500mmol/L imidazole into each 100ml GST filler, resuspending, transferring into a glass protein chromatographic column, and standing for 5min to sufficiently elute TEV protease; then, the elution is continued by using 100ml of 20mmol/L PB +150mmol/L sodium chloride +1mol/L imidazole, and the TEV protease is obtained by collecting flow-through.

Preferably, the method further comprises 3) desalting by G25 chromatography displacement buffer; preferably, the buffer used is PBS buffer ph 7.2;

4) anion exchange chromatography or cation exchange chromatography.

The anion exchange chromatography uses a GE Q HP chromatographic column, and uses a buffer solution as a buffer solution A:20 mol/L PBpH7.1, buffer B:20 mol/L PB +1mol/L sodium chloride pH7.1; the cation exchange chromatography uses a GE SP HP chromatographic column, and uses a buffer solution as a buffer solution A:20mmol/L PB pH6.1, buffer B:20mmol/L PB +1mol/L sodium chloride pH6.1.

The invention has the following beneficial effects:

the invention fuses a plurality of label proteins and target proteins, and repeatedly screens the label proteins to finally obtain the recombinant engineering strain with most soluble expression of the target protein TEV protease. The TEV protease with high purity and good activity can be obtained by simple purification steps.

The invention has the important significance of helping bioengineering pharmaceutical enterprises and laboratory researchers to quickly, simply and cheaply obtain tool enzyme and solving the problems of research and production.

The invention has the characteristics and innovation points that:

the TEV protease in the fusion protein expressed by the recombinant plasmid has good enzyme digestion activity, and can be cut off from the fusion protein and expressed in a soluble form in the expression process.

The fermentation process provided by the invention is reliable, the expression level is high, and at least 130mg of TEV protease with the final purity of more than 99% can be produced in each liter of culture medium.

The invention has simple purification process and low cost, and the obtained final product has high purity and good activity.

Drawings

FIG. 1 is a diagram showing the expression of pGEX-6P-2-TEV/XL1-Blue under different temperature conditions after induction with 0.6mmol/L IPTG; wherein, M: medium molecular weight protein standards; 1: inducing with 0.6mmol/L IPTG, and culturing overnight at 25 deg.C; 2: inducing with 0.6mmol/L IPTG, and culturing overnight at 16 deg.C; 3: inducing with 0.6mmol/L IPTG, and culturing overnight at 20 deg.C; 4: inducing with 0.6mmol/LIPTG, and culturing at 30 deg.C for 6 hr; 5: inducing with 0.6mmol/L IPTG, culturing at 35 deg.C for 4 hr; as can be seen, the target protein is well expressed in the supernatant, and the target protein is dissociated after the enzyme digestion of the fusion protein in the expression process.

FIG. 2 shows the effect of pGEX-6P-2-TEV/XL1-Blue column purification; wherein, 1: after purification (after 10mmol/L imidazole bacteria breaking, 25mmol/L imidazole washes away foreign protein and finally 300mmol/L imidazole elution); m: medium molecular weight protein standards; 2: ultrasonically breaking the bacteria supernatant;

FIG. 3 is a graph showing the results of pCOLD-SUMO-TEV/BL21(DE3) and pCOLD-SUMO (His6-) -TEV/BL21(DE3) expression and Ni-NTA preliminary chromatography; wherein, M: medium molecular weight protein standards; 1: pCOLD-SUMO/ML21(DE 3); 2: pCOLD-SUMO-TEV/BL21(DE3) induction; 3: after induction with pCOLD-SUMO-TEV/BL21(DE 3); 4: eluting with 500mmol/L imidazole; 5: eluting with 1mol/L imidazole; 6: pCOLD-SUMO (His6-) -TEV/BL21(DE3) induction; 7: after induction of pCOLD-SUMO (His6-) -TEV/BL21(DE 3); 8: eluting with 500mmol/L imidazole; 9: eluting with 1mol/L imidazole; the solid arrows indicate the protein of interest, the open arrows express the tag protein SUMO, and since the His6 was removed, SUMO expressed by pCOLD-SUMO (His6-) -TEV/BL21(DE3) was no longer bound to the Ni-NTA filler.

FIG. 4 is a diagram showing the effect of fermentation expression of pGEX-6p-2-TEV/XL 1-blue; wherein, M: a middle molecular protein standard; 1: pGEX-6p-2-TEV/XL1-blue before induction; 2: inducing for 1h by 0.2mmol/L IPTG; 3: inducing for 2h by 0.2mmol/L IPTG; 4: inducing for 3h by 0.2mmol/L IPTG; 5: inducing for 4h by 0.2mmol/L IPTG; 6: inducing for 5h by 0.2mmol/L IPTG; the arrow indicates the protein of interest TEV protease.

FIG. 5 is a schematic representation of fermentation expressed TEV protease and its Ni-NTA purification results; wherein, M: medium molecular weight protein standards; 1: breaking the whole bacteria by TEV; 2: breaking bacteria by TEV and centrifuging supernatant; 3: breaking bacteria by TEV, centrifuging and precipitating; 4: TEV Ni-NTA flow through; 5: 20mmol/L PB +150mmol/L NaCl +25mmol/L imidazole eluent; 6: 20mmol/L PB +150mmol/L NaCl +500mmol/L imidazole eluent; 7: 20mmol/L PB +150mmol/L NaCl +1mol/L imidazole eluent;

FIG. 6 is an electrophoretogram of purified protein by chromatography with TEV protease Q HP; wherein, M: medium molecular weight protein standards; 1: q HP sample loading; 2: q HP flow through; 3: q HP equilibrium peak; 4: peak Q HP elution;

FIG. 7 is a chromatogram of purification of TEV protease by SP HP at pH6.1 in the buffer system; 1: elution peak # 1; 2: elution peak # 2; 3: elution peak # 3;

FIG. 8 is a sample of each of the samples collected during SP HP purification of TEV protease at pH6.1 in the buffer system; m: medium molecular weight protein standards; 1: SP HP flow through; 2: SP HP elution peak 1 #; 3: SP HP elution peak # 2; 4: SP HP elution peak 3 #;

FIG. 9 is a chart of TEV protease Q HP purification flow-through HPLC results; wherein the retention time of the target protein is 16.949min, and the purity is 87.236%

FIG. 10 shows TEV protease SP HP purification elution peak 3# HPLC; wherein the retention time of the target protein is 16.856min, and the purity is 99.336%;

FIG. 11 is a diagram showing the results of the detection of the cleavage activity of TEV protease on the fusion protein; wherein, M: medium molecular weight protein standards; 1: 37 degrees, 20mmol/L PB,100mmol/L sodium chloride, 2mol/L urea, 100mmol/L imidazole, TEV enzyme; 2: 4 degrees, 20mmol/L PB,100mmol/L sodium chloride, 2mol/L urea, 100mmol/L imidazole, TEV enzyme; 3: 20mmol/L PB,100mmol/L sodium chloride, 2mol/L urea and 100mmol/L imidazole; 4: 37 degrees, 20mmol/L PB,100mmol/L sodium chloride, 2mol/L urea, 300mmol/L imidazole, TEV enzyme; 5: 4 degrees, 20mmol/L PB,100mmol/L sodium chloride, 2mol/L urea, 300mmol/L imidazole, TEV enzyme; 6: 20mmol/L PB,100mmol/L sodium chloride, 2mol/L urea and 300mmol/L imidazole; 7: a TEV enzyme; the arrow indicates the protein of interest PTH (1-34); the results show that the fusion protein can be cut by TEV enzyme under a relatively loose condition.

Detailed Description

The following examples are intended to illustrate the present application but are not intended to limit the scope of the present application.

Specific embodiments of the present application will be described in more detail below. These embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the disclosure to those skilled in the art.

In the following description and in the claims, the terms "include" and "comprise" are used in an open-ended fashion, and thus should be interpreted to mean "include, but not limited to. The description which follows is a preferred embodiment of the present application, but is made for the purpose of illustrating the general principles of the application and not for the purpose of limiting the scope of the application. The protection scope of the present application shall be subject to the definitions of the appended claims.

Experimental reagents and materials

1. Bacterial strain and plasmid

Strain BL21(DE3), DH5alpha E.coli from Novagen; the strain XL-1blue escherichia coli is a product of Agilent company in the United states; the plasmid pGEX-6p-2 is a product of GE Healthcare, USA; the plasmids pET32a and pET39b (+) are products of Merck, USA; pMal-c4X is a product of NEB corporation; pCOLD-SUMO was purchased from Sorangbao.

2. Reagent

TEV enzyme and EK enzyme are available from Biyunnan Biotechnology Ltd, factor Xa protease Beijing Baiolai Pagaco technology Ltd.

primeSTAR HS DNA polymerase, DNA molecular weight standard, restriction enzyme, protein molecular weight standard, DNA ligase, point mutation kit (mutanBest), etc. are products of Dalibao organism (Takara); the plasmid extraction kit and the gel recovery kit are products of American Omega company; peptone and yeast extracts were purchased from Oxoid, UK, and medium from Obotaxin Biotechnology, Inc., Beijing.

PBS (Potassium dihydrogen phosphate (KH)₂PO₄)0.2g (domestic analytical grade), disodium hydrogen phosphate (Na)₂HPO₄·12H₂O)2.9g (domestic analytically pure), sodium chloride (NaCl)8.0g (domestic analytically pure), potassium chloride (KCl)0.2g, water is added to 1000mL, and the pH value is 7.4); 20mol/L PB buffer: potassium dihydrogen phosphate (KH)₂PO₄)0.2g of disodium hydrogen phosphate (Na)₂HPO₄·12H₂O)2.9g, potassium chloride (KCl)0.2g, water 1000mL, pH6.0, ampicillin, kanamycin (Wabei pharmacy), 5 Xprotein loading buffer 250mmol/L Tris-HCl (pH6.8), 10% (W/V) SDS, 0.5% (W/V) bromophenol blue, 50% (V/V) glycerol, 5% (W/V) β -mercaptoethanol, glutathione Sepharose 4B (GE Healthcare Co., USA), Ni-NTA from Novagen company, agar powder, Tween-20 and other reagents are all commercially available analytical purity.

EXAMPLE 1 construction of recombinant TEV protein engineering bacteria preliminary study on expression and purification

The TEV enzyme selects the amino acid sequence of SEQ ID NO. 1, and after the code of the coding DNA (SEQ ID NO:2) is optimized, Shanghai bioengineering limited company is entrusted to synthesize the following fragments on the basis of The (TEV):

upstream restriction endonuclease site-TEV restriction site (TEVs, EDLYFQS) -His 6-TEV-downstream restriction endonuclease site, named TEVsTEV, with the sequence of SEQ ID NO: 3. wherein, the upstream enzyme cutting site is BamHI, and the downstream enzyme cutting site is HindIII and NotI.

Simultaneously designing and combining with Shanghai bioengineering company Limited to synthesize a primer which takes the fragment as a template to amplify the following fragments:

upstream restriction enzyme site-EKs (EK enzyme site) -His 6-TEV-downstream restriction enzyme site, the fragment was named EKsTEV,

upstream primer, PEKTEV1:5 'GGTGGATCCGATGACGATGACAAACACCACCACCACCACCACCACGGTGA 3' (SEQ ID NO:4)

Upstream restriction enzyme site-Xas (Xa site) -His 6-TEV-downstream restriction enzyme site, the fragment was named XasteV,

upstream primer, PXATEV1:5 'GGTGGATCCATCGAGGGTCGCCACC ACCACCACCACCACCACGGTGA 3' (SEQ ID NO:5)

Two fragments shared a downstream primer, PTEV 2: 5'TAAGCGGCCGCGCCAAGCTTT CATTAGCGGCGGCGGCGACG3' (SEQ ID NO:6)

EKsTEV and XastTEV were amplified using Takara PCR kit (Takara Shuzo) using TEVsTEV as template and PEKTEV1 and PTEV2, PXATEV1 and PTEV2 as primers.

Construction of recombinant expression vectors was performed with BamHI + HindIII and BamHI + NotI double digestion fragments, TEVsTEV, EKsTEV and XastTEV, respectively, in the manner shown in Table 1.

TABLE 1 construction of recombinant TEV enzyme expression vectors

The recombinant plasmid constructed by completing the experiment of Table 1 was transformed into E.coli DH5 alpha; carrying out single colony liquid culture on positive clones screened on an LB (LA) plate containing ampicillin, collecting bacteria, carrying out plasmid extraction by using a plasmid extraction kit, and respectively transforming escherichia coli XL1-Blue (pGEX-TTEV, pGEX-ETEV and pGEX-XTEV) and BL21(DE3) (the rest recombinant plasmids) to construct recombinant engineering bacteria after the plasmids are identified correctly by using corresponding double enzyme digestion.

Example 2 Shake flask expression of recombinant TEV protein engineering bacteria

And selecting a single colony of the recombinant engineering bacteria to perform a shake flask 10ml expression study. Selecting each recombinant engineering bacterium, adding 10ml LA, shaking at 37 deg.C and 200 rpm, and culturing to OD_600nmWhen reaching 0.6-0.8, adding IPTG with final concentration of 0.2-1mmol/L respectively, inducing at 30 deg.C for 6 hr, inducing at 37 deg.C for 4 hr, and culturing at the rest temperature overnight. The bacteria were collected by centrifugation and resuspended in 2ml of PBS, disrupted by sonication, and the supernatant of disrupted by sonication was examined for the expression of interest by 10% SDS-PAGE, and the results are shown in FIG. 1. Preliminary Ni-NTA affinity chromatography and 10% SDS-PAGE were performed on the target protein, and the results are shown in FIG. 2.

In a comparative study of expression of various vectors, pGEX-TTEV/XL1-Blue (shown in figure 1) and pCOLD-TTEV/BL21(DE3) (shown in figure 3) are found in two recombinant engineering bacteria, and the TEV enzyme of the target protein is separated from the fusion protein in a soluble expression form, which indicates that the TEV enzyme in the fusion protein has enzyme activity in the expression process.

Since the SUMO tag of pCOLD-SUMO vector carries His6, the pCOLD-TTEV recombinant plasmid was subjected to His 6-removing mutation as follows:

mutant primer PCOLDSH-R: 5'CATATGCACTTTGTGATTCATGGTGT ATTACC 3'

PCOLDSH-F:5'TCGGACTCAGAAGTCAATCAAGAAGCTAAGC CAG 3'

The pCOLD-TTEV is used as a template for full-length amplification, a Takara kit is used for constructing a mutant according to the method of the instruction, and the pCOLD-TTEV with His6 removed is named as pCOLD-H-TTEV. BL21(DE3) was transformed after correct sequencing of the mutants to construct pCOLD-H-TTEV/BL21(DE3) and expression studies were continued by subjecting the sonicated supernatants to preliminary Ni-NTA affinity chromatography followed by 10% SDS-PAGE, the results of which are shown in FIG. 3.

EXAMPLE 3 fermentation of recombinant TEV protein engineering bacteria

The TEV protein engineering bacteria used in this example were Escherichia coli XL1-Blue (pGEX-6p-2-TEV/XL1-Blue) containing pGEX-6p-2 vector (pGEX-6p-2-TEV) expressing TEV recombinant protein.

1. Determination of fermentation conditions

1) Influence of the culture medium on the growth of the engineering bacteria and the expression of the target protein:

the effect of 2 media on the growth of the engineered bacteria was tested in shake flasks:

animal origin TB (potassium dihydrogen phosphate 2.31g, disodium hydrogen phosphate dodecahydrate 25.79g, glycerol 4ml, yeast extract 24g, animal origin tryptone 12g, adding water to 1L); animal origin modified TB (potassium dihydrogen phosphate 2.31g, disodium hydrogen phosphate dodecahydrate 25.79g, glycerol 2ml, yeast extract 12g, animal origin tryptone 6g, magnesium sulfate heptahydrate 0.5g, ammonium sulfate 1.16g, added water to 1L).

pGEX-6p-2-TEV/XL1-Blue was inoculated to Amp⁺Incubation in LB plate (100. mu.g/mL) at 37 ℃ for 16-20 h, picking single colony in 10mL Amp⁺In LB medium, put in a shaker at 37 ℃ and shake at 220rpm to OD_600nmAt about 0.5-1.0, at a ratio of 1:100 was inoculated into 100ml of 2 kinds of culture media, shaken at 220rpm at 37 ℃ for 16 hours, and OD was measured every 2 hours_600nm。

Inoculating fresh TEV engineering bacteria solution (OD600 about 0.5-1.0) at a ratio of 1:100 into 100ml TB culture medium and modified TB culture medium respectively, shaking at 37 deg.C and 220rpm to OD_600nmAbout 0.8, 1mmol/L IPTG was added and induction was carried out at 25 ℃ for 12 hours. Taking 100ml of bacterial liquid for centrifugation, discarding supernatant, and weighing the modified TB in g. The cells were disrupted by sonication (power 300W) with 1g:10ml and PBS for 10min (5 seconds of work, 5 seconds of rest), and the expression effect of the recombinant engineering in each medium was judged by using 10% SDS-PAGE results in combination with GST-Sepharose 4B (reference example 2).

The results show that: the unit target protein expression quantity improved TB is better than normal TB, so the improved TB culture medium is selected for fermentation of the TEV engineering bacteria.

2) Growth of engineering bacteria under different seed bacteria inoculation amounts and expression condition of target protein

The influence of three different seed bacteria inoculum sizes of 8%, 10% and 12% on fermentation was studied. The optimal inoculation amount is determined by a bacterial growth curve and the unit protein expression amount. When the seed bacteria OD_600nmTransferring into fermentation tank for culturing at 2.0-3.0 hr, sampling every 1 hr, and measuring OD_600nmAnd drawing a prophase growth period curve of the engineering bacteria to judge the growth speed of the bacteria until the induction is finished. After induction, the cells were treated by the above-described disruption method, and then subjected to 10% SDS-PAGE to determine the expression level of the target protein.

The results show that: the expression level of the unit target protein obtained by 10 percent of the seed strain inoculation amount is the highest.

3) Effect of glycerol concentration on expression of protein of interest:

the amount of glycerol in the medium during fermentation has a great influence on the amount of bacteria. When the glycerol in the culture medium is consumed up, the pH value and the dissolved oxygen value can be rapidly increased, a 10% glycerol solution is added immediately to maintain the continuous growth of the thalli, and IPTG is added to start induction when the thalli grow to the late logarithmic phase. Therefore, the amount of glycerol content will directly determine the timing of induction. The optimal glycerol concentration is determined by studying the expression of the target protein when the glycerol content in the culture medium is 1ml/L, 2ml/L and 4 ml/L. 10% SDS-PAGE to determine the expression level of the unit target protein.

The results show that: when the concentration of the glycerol is 2ml/L, the expression quantity is the highest; 1 ml/L; 4ml/L is worst. Therefore, the glycerol amount is selected to be 2ml/L when the TEV engineering bacteria are fermented.

4) Effect of different dissolved oxygen concentrations on target protein expression:

in the fermentation process of the engineering bacteria, the concentration of dissolved oxygen in the culture medium has great influence on the growth of the bacteria, so that the control of the dissolved oxygen in the fermentation process is very important, and the growth of the bacteria and the expression condition of target protein when the dissolved oxygen is 30%, 40% and 50% are respectively inspected. 10% SDS-PAGE to determine the expression level of the unit target protein.

The results show that: under the condition of 40% dissolved oxygen, the bacteria grow best; meanwhile, when dissolved oxygen is 40%, the expression level of the target protein is also the best, so that the dissolved oxygen concentration is selected to be 40% when the TEV engineering bacteria are fermented.

5) Effect of different IPTG concentrations on target protein expression:

fresh TEV engineering bacteria liquid (OD)_600nmAbout 0.5-1.0) were inoculated into 4 100ml modified TB medium at a ratio of 1:100, respectively, and shaken at 220rpm at 37 ℃ to OD_600nmAt about 0.8, IPTG was added to the mixture to give final concentrations of 0.1mmol/L, 0.2mmol/L, 0.5mmol/L and 1mmol/L, respectively, and the mixture was induced at 25 ℃ for 12 hours. Then, the cells were centrifuged, the supernatant was discarded, the cells were disrupted, and 10% SDS-PAGE was performed to determine the expression level of the target protein.

The results are shown in FIG. 4: the protein expression level is obviously better than that of 0.1mmol/L, 0.5mmol/L and 1mmol/L when the final concentration of IPTG is 0.2mmol/L, so that the final concentration of IPTG is selected to be 0.2mmol/L when the TEV engineering bacteria are fermented.

6) Effect of different Induction temperatures and Induction times on expression of proteins of interest

The expression of the target protein at three different induction temperatures, 16 ℃, 25 ℃ and 30 ℃, and the time taken to reach the maximum expression level were examined. Wherein, samples are taken every 2h after induction, induction is carried out for 10h, and the samples are processed as required above, and 10% SDS-PAGE is carried out to judge the expression amount of the unit target protein.

The results show that: the unit expression amount is the highest at 25 ℃, the expression time is the shortest, and the expression difference between 4h and 6h is not large. The expression amount per unit at 16 ℃ and 30 ℃ is not as high as 25 ℃ and the expression time is long. Therefore, the optimum induction temperature is 25 ℃ and the induction time is 5h when the TEV engineering bacteria are fermented.

In conclusion, the invention determines the optimal fermentation process of the recombinant TEV protein:

(1) the basic culture medium is an animal derived modified TB culture medium, wherein the content of peptone and yeast extract is half of the normal TB content, and the content of glycerol is 2 ml/L;

(2) the inoculation ratio of the seed bacteria in the fermentation tank is 10 percent, and the seed bacteria are transferred to OD_600nmThe value is about 2.0-3.0;

(3) controlling the dissolved oxygen concentration in the fermentation process to be about 40%;

(4) when the pH value and the dissolved oxygen are increased in the fermentation process, a 10% glycerol solution is fed-batch to maintain the growth of the thalli;

(5) the induction conditions were: inducing at 25 deg.C with IPTG concentration of 0.2mmol/L for 5 h.

2. Amplification of fermentation process

Carrying out fermentation scale amplification (12L) for 3 times according to the optimized process conditions, and respectively harvesting 330g, 445g and 376g of thalli; after performing 10% SDS-PAGE on the broken bacteria supernatant, the amounts of the target proteins were 20.8, 21.4 and 21.1% respectively by grayscale scanning.

As shown in FIG. 4, the expression level of the target protein increased significantly with time, and reached the highest level at 5 h.

To sum up: the amplification of the fermentation process of the recombinant TEV engineering bacteria completely achieves the expected result. The fermentation process of the invention is suitable for large-scale industrial fermentation production.

Example 4: purification process of recombinant TEV protein

1. Preparation of bacteria-breaking supernatant

100g of each batch of thalli produced in the fermentation of example 2 is taken and added with 20mmol/L PB +150mmol/L sodium chloride +10mmol/L imidazole and pH7.0 buffer solution, and the weight ratio is as follows: adding the mixture according to the volume ratio of 1g to 8ml, uniformly mixing and suspending, precooling at 4 ℃, and crushing under high pressure: the high pressure homogenizer (high pressure homogenizer AH-1500, ATS industrial systems limited, canada) pipeline was flushed with distilled water and the low temperature circulation system was started to pre-cool to 1-4 ℃ for use. And (3) adding the pre-cooled suspension bacterium liquid into a high-pressure homogenizer, and maintaining the pressure at 750-800bar for bacterium breaking for 3-5 times. High-speed centrifugation: the liquid after the disruption was filled into a centrifuge bucket (Beckman, USA), centrifuged at 7500rpm for 30min at 4 ℃, and the supernatant was collected for use.

2. Ni-NTA affinity chromatography purification

Adding 100ml of Ni filler into each liter of supernatant, combining for more than 1h at 20-25 ℃, and adopting a vertical rotation or stirring method in the combining process to promote the combination of the TEV protease and the Ni filler. The TEV protein-bound Ni filler described above was washed 5 volumes with 20mmol/L PB +150mmol/L NaCl +25mmol/L imidazole, pH7.0 to remove any contaminating proteins not bound to the Ni filler. Then adding 100ml of 20mmol/L PB +150mmol/L sodium chloride +500mmol/L imidazole into each 100ml of GST filler for resuspension, transferring the mixture into a glass protein chromatographic column for standing for 5min, and fully eluting TEV protease; this was followed by a continuation with 100ml of 20mmol/L PB +150mmol/L NaCl +1mol/L imidazole. TEV protease was obtained by collecting the flow through and analyzed by 10% SDS-PAGE. The results are shown in figure 5 of the accompanying drawings,

experiments show that the content and the purity of the TEV protease obtained after Ni filler affinity are obviously improved, the process has good stability, and a foundation is laid for subsequent further purification.

G25 chromatography Displacement buffer

An instrument system: NGC Quest100 plus Chromatography System (Bio-Rad, USA); chromatography packing: g25; column specification: 50ml pre-packed column; column packing volume: 50 ml; buffer solution: PBS buffer solution; sample loading: Ni-NTA eluted sample; flow rate: 10 ml/min. The sample obtained from the previous purification was passed through a G25 column to displace the buffer and collect the protein peak.

4. Anion exchange chromatography

Column selection GE 5ml Q HP column instrumentation system: NGC Quest100 plus ChromatographySystem (Bio-Rad, USA) buffer: buffer A20 mmol/L PB, pH7.1, buffer B20 mmol/L PB +1mol/L sodium chloride, pH7.1, sample loading: flow-through sample flow rate for G25 chromatographic collection: 5ml/min, and the elution flow rate is 5 ml/min; elution procedure: 100% B,10 Column Volumes (CV). Collecting: the flow-through (TEV-Q) of the loading process, a small peak appearing at equilibrium, the elution peak. The purification effect was evaluated by performing purity analysis by 10% SDS-PAGE (FIG. 6) and purity analysis by HPLC (FIG. 9). As can be seen from FIG. 6, in the anion chromatography process, the target protein basically does not hang on the column and exists in a large amount in the flow-through liquid; while the hetero-protein is adsorbed on the column. After the chromatography, the purity of the target protein is obviously improved.

5. Cation exchange chromatography

The chromatographic column is selected from GE 5ml SP HP column, and the instrument system is NGC Quest100 plus chromatography system (Bio-Rad company, USA), buffer solution is ① mmol/L PB, pH7.1, ② mmol/L PB +1mol/L sodium chloride, pH7.1, buffer solution B ① mmol/L PB, pH6.1, ② mmol/L PB +1mol/L sodium chloride, pH 6.1. sample loading is flow-through of Q HP chromatography collection, pH7.1 and 6.1. sample loading flow rate is 5ml/min, elution program is 0-100% B,10 Column Volumes (CV). collection, elution peak 1#, 2# and 3# (figure 7), 10% SDS-PAGE analysis is carried out, and purification effect (figure 8) is evaluated, elution peak 3# (TEV-SP-3) is carried out, and purity detection is carried out at the same time (figure 10%).

In the cation chromatography process, under the condition of lower pH, the TEV protease has better separation effect and higher purity in the chromatography process.

6. Three batches TEV protease purification statistics (Table 1)

The yields calculated as per liter of medium are shown in table 2:

TABLE 2 productivity of the culture media

Fermentation batch	A	II	III
				Fermentation medium (L)	12	12	12
Harvesting of bacteria	330	445	376
				Harvest protein (mg/100g bacteria)	500	530	550
Harvesting protein (mg/L medium)	137.5	196.5	172.3

Example 5: HPLC purity detection of recombinant TEV enzyme

Refer to high performance liquid chromatography in appendix III of three parts of the book "Chinese pharmacopoeia" 2015 edition. High performance liquid chromatograph: shimadzu LC-2040C 3D (Shimadzu, Japan). A chromatographic column: agilent ZORBAX 300SB-C3 (Agilent, USA). Acetonitrile was purchased from Honeywell and trifluoroacetic acid (TFA) was purchased from aladin. Mobile phase A: 100% aqueous solution with 0.1% TFA; mobile phase B: acetonitrile-water (90:10) solution with 0.1% TFA. Detection conditions are as follows: column temperature 30 ℃, ultraviolet detection at 214nm, reference substance, sample to be detected: TEV-Q and TEV-SP-3, respectively, and loading 10 μ l; gradient elution: 0-17min, B: 10% -30%; 17-30min, B: 30% -100%; 30-38min, B100%; 38-40min, B100-10%; 40-50min, B10%; flow rate: and (3) 0.2ml/min, calculating the content of the sample to be detected by adopting an external standard method, and calculating the purity of the sample to be detected by adopting an area normalization method. The purity measurement results are shown in fig. 9 and 10.

Example 6: recombinant TEV enzyme activity assay

The purified TEV protease of the present invention was applied to SUMO-PTH (1-34), a fusion protein expressed by this company, under the following conditions:

20mmol/L PB +100mmol/L NaCl +2mol/L urea, pH7.1

Then imidazole and temperature are changed for cutting. 10% SDS-PAGE and Coomassie blue staining was performed. The enzyme cut product has SUMO tag of about 16kD and target protein PTH (1-34) of about 4kD, as shown in FIG. 11. The specific activity of the TEV protease of the present invention was not lower than that of the control by comparing the activity with that of TEV protease of other companies.

Although the present application has been described in detail with respect to the general description and the specific examples, it will be apparent to those skilled in the art that certain changes and modifications may be made based on the present application. Accordingly, such modifications and improvements are intended to be within the scope of this invention as claimed.

Sequence listing

<110> Chongqing Ailidi Biotech Co., Ltd

<120> recombinant plasmid and recombinant engineering bacterium for expressing TEV protein, and methods for preparing and purifying TEV protein

<160>6

<170>SIPOSequenceListing 1.0

<210>1

<211>242

<212>PRT

<213>TEV(TEV)

<400>1

Gly Glu Ser Leu Phe Lys Gly Pro Arg Asp Tyr Asn Pro Ile Ser Ser

1 5 10 15

Ser Ile Cys His Leu Thr Asn Glu Ser Asp Gly His Thr Thr Ser Leu

20 25 30

Tyr Gly Ile Gly Phe Gly Pro Phe Ile Ile Thr Asn Lys His Leu Phe

35 40 45

Arg Arg Asn Asn Gly Thr Leu Leu Val Gln Ser Leu His Gly Val Phe

50 55 60

Lys Val Lys Asp Thr Thr Thr Leu Gln Gln His Leu Val Asp Gly Arg

65 70 75 80

Asp Met Ile Ile Ile Arg Met Pro Lys Asp Phe Pro Pro Phe Pro Gln

85 90 95

Lys Leu Lys Phe Arg Glu Pro Gln Arg Glu Glu Arg Ile Cys Leu Val

100 105 110

Thr Thr Asn Phe Gln Thr Lys Ser Met Ser Ser Met Val Ser Asp Thr

115 120 125

Ser Cys Thr Phe Pro Ser Ser Asp Gly Ile Phe Trp Lys His Trp Ile

130 135 140

Gln Thr Lys Asp Gly Gln Cys Gly Ser Pro Leu Val Ser Thr Arg Asp

145 150 155 160

Gly Phe Ile Val Gly Ile His Ser Ala Ser Asn Phe Thr Asn Thr Asn

165 170 175

Asn Tyr Phe Thr Ser Val Pro Lys Asn Phe Met Glu Leu Leu Thr Asn

180 185 190

Gln Glu Ala Gln Gln Trp Val Ser Gly Trp Arg Leu Asn Ala Asp Ser

195 200 205

Val Leu Trp Gly Gly His Lys Val Phe Met Val Lys Pro Glu Glu Pro

210 215 220

Phe Gln Pro Val Lys Glu Ala Thr Gln Leu Met Asn Glu Arg Arg Arg

225 230 235 240

Arg Arg

<210>2

<211>726

<212>DNA

<213>TEV(TEV)

<400>2

ggtgaaagct tgtttaaggg tccacgtgat tacaacccga tttcgagcag catttgtcat 60

ttgaccaatg aatctgatgg tcacacaaca tcgttgtatg gtattggttt tggtccgttc 120

atcattacaa acaagcactt gtttcgccgt aataatggta cactgttggt ccaatcactg 180

catggtgtat tcaaggtcaa ggacaccacc actttgcaac aacacctcgt tgatggtcgt 240

gacatgatca ttattcgcat gcctaaggat ttcccaccat ttcctcaaaa gctgaaattt 300

cgcgagccac aacgcgaaga gcgcatttgt cttgtgacaa ccaacttcca aactaagagc 360

atgtctagca tggtgtcaga cactagttgc acattccctt catctgatgg catcttctgg 420

aagcattgga ttcaaaccaa ggatggtcag tgtggcagtc cattagtatc aactcgcgat 480

ggtttcattg ttggtatcca ctcagcatcg aatttcacca acacaaacaa ttatttcaca 540

agcgtgccga aaaacttcat ggaattgttg acaaatcagg aggcgcagca gtgggttagt 600

ggttggcgtt taaatgctga ctcagtattg tggggtggcc ataaagtttt catggttaaa 660

cctgaagagc cttttcagcc agttaaggaa gcgactcaac tcatgaatga acgtcgccgc 720

cgccgc 726

<210>3

<211>803

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>3

ggtggatccg aggatctgta ctttcagagc caccaccacc accaccacca cggtgaaagc 60

ttgtttaagg gtccacgtga ttacaacccg atttcgagca gcatttgtca tttgaccaat120

gaatctgatg gtcacacaac atcgttgtat ggtattggtt ttggtccgtt catcattaca 180

aacaagcact tgtttcgccg taataatggt acactgttgg tccaatcact gcatggtgta 240

ttcaaggtca aggacaccac cactttgcaa caacacctcg ttgatggtcg tgacatgatc 300

attattcgca tgcctaagga tttcccacca tttcctcaaa agctgaaatt tcgcgagcca 360

caacgcgaag agcgcatttg tcttgtgaca accaacttcc aaactaagag catgtctagc 420

atggtgtcag acactagttg cacattccct tcatctgatg gcatcttctg gaagcattgg 480

attcaaacca aggatggtca gtgtggcagt ccattagtat caactcgcga tggtttcatt 540

gttggtatcc actcagcatc gaatttcacc aacacaaaca attatttcac aagcgtgccg 600

aaaaacttca tggaattgtt gacaaatcag gaggcgcagc agtgggttag tggttggcgt 660

ttaaatgctg actcagtatt gtggggtggc cataaagttt tcatggttaa acctgaagag 720

ccttttcagc cagttaagga agcgactcaa ctcatgaatg aacgtcgccg ccgccgctaa 780

tgaaagcttg gcgcggccgc tta 803

<210>4

<211>50

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>4

ggtggatccg atgacgatga caaacaccac caccaccacc accacggtga 50

<210>5

<211>47

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>5

ggtggatcca tcgagggtcg ccaccaccac caccaccacc acggtga 47

<210>6

<211>41

<212>DNA

<213> Artificial Sequence (Artificial Sequence)

<400>6

taagcggccg cgccaagctt tcattagcgg cggcggcgac g 41

Claims (10)

1. A recombinant plasmid for expressing TEV protein, wherein the recombinant plasmid comprises a backbone plasmid sequence and a TEV protein expression fragment; the TEV protein expression fragment sequentially consists of an upstream restriction endonuclease site, a protease enzyme cutting site sequence, His6, a nucleotide sequence for expressing TEV and a downstream restriction endonuclease site, wherein the protease enzyme cutting site sequence is selected from one of an enzyme cutting site sequence for expressing TEV, an enzyme cutting site sequence for expressing EK enzyme and an enzyme cutting site sequence for expressing Xa factor protease; the skeleton plasmid is selected from one of pCOLD-SUMO, pMal-c4X, pET32a, pET39b (+) and pGEX-6P-2.

2. The recombinant plasmid of claim 1, wherein the upstream restriction enzyme site is BamHI.

3. The recombinant plasmid of claim 1 or 2, wherein the downstream restriction enzyme site is HindIII or NotI.

4. The recombinant plasmid of any one of claims 1-3, wherein the backbone plasmid is pCOLD-SUMO and the protease cleavage site sequence is an expression TEV enzyme cleavage site sequence.

5. The recombinant plasmid of any one of claims 1-3, wherein the backbone plasmid is pGEX-6P-2 and the protease cleavage site sequence is an expression TEV enzyme cleavage site sequence.

6. Recombinant engineered bacterium for expressing TEV protein, characterized in that it contains the recombinant plasmid according to any one of claims 1 to 5, and the host bacterium is XL1-Blue or BL21(DE 3).

7. The recombinant engineered bacterium of claim 6, wherein the host bacterium is XL1-Blue, and the recombinant plasmid is pGEX-6P-2 as a backbone plasmid and the recombinant plasmid expresses TEV enzyme cleavage site sequence as protease cleavage site sequence.

8. The recombinant engineered bacterium of claim 6, wherein the host bacterium is BL21(DE3), and the recombinant plasmid is a plasmid with pCOLD-SUMO as a backbone and a sequence expressing TEV enzyme cleavage site as a protease cleavage site.

9. A fermentation process for the production of TEV protein using a recombinant engineered bacterium according to any one of claims 6 to 8, comprising:

inoculating the recombinant engineering bacteria into an animal source TB culture medium, and adding IPTG (isopropyl-beta-D-thiogalactoside) for induction expression when the bacteria are shaken and propagated to a logarithmic phase.

Preferably, the content of peptone and yeast extract in the TB culture medium is half of the content of a normal TB culture medium, and the content of glycerol is 2 ml/L;

preferably, the inoculation ratio of the recombinant engineering bacteria in the fermentation tank is 8-12%, preferably 10%, and the seed bacteria are transferred to OD_600nmThe value is 2.0-3.0;

preferably, the glycerol content in the culture medium is 1-4ml/L, preferably 2 ml/L;

preferably, the concentration of dissolved oxygen in the culture medium is 30% -50%, preferably 40%;

preferably, the induction condition in the culture medium is induction for 2-12h at the temperature of 16-30 ℃ and the final concentration of IPTG is 0.1-1mmol/L, and preferably induction for 5h at the temperature of 25 ℃ and the final concentration of IPTG is 0.2 mmol/L.

10. A method of purifying a recombinant TEV protein comprising:

1) mixing the fermented thallus according to claim 9 with a bacteria-breaking buffer solution in a ratio of 1g:8ml of the mixture is mixed according to the weight-volume ratio, evenly mixed and suspended, precooled at 4 ℃ and crushed under high pressure; then, centrifuging at a high speed, and collecting supernatant for later use; wherein the bacterium breaking buffer solution is prepared from 20mmol/L PB, 150mmol/L sodium chloride, 10mmol/L imidazole and pH7.0 buffer solution;

2) NI-NTA affinity chromatography purification;

adding 100ml of Ni filler into each liter of supernatant, and combining for more than 1h at the temperature of 20-25 ℃; washing with 20mmol/L PB +150mmol/L sodium chloride +25mmol/L imidazole and pH7.0 to remove impurities, adding 100ml20mmol/L PB +150mmol/L sodium chloride +500mmol/L imidazole into each 100ml GST filler, resuspending, transferring into a glass protein chromatographic column, and standing for 5min to sufficiently elute TEV protease; then, the elution is continued by using 100ml of 20mmol/L PB +150mmol/L sodium chloride +1mol/L imidazole, and the TEV protease is obtained by collecting flow-through.

Preferably, the method further comprises 3) desalting by G25 chromatography displacement buffer;

4) anion exchange chromatography or cation exchange chromatography.

Images