CN111019917A - L-glutamate dehydrogenase mutant and application thereof - Google Patents
L-glutamate dehydrogenase mutant and application thereof Download PDFInfo
- Publication number
- CN111019917A CN111019917A CN201910434379.XA CN201910434379A CN111019917A CN 111019917 A CN111019917 A CN 111019917A CN 201910434379 A CN201910434379 A CN 201910434379A CN 111019917 A CN111019917 A CN 111019917A
- Authority
- CN
- China
- Prior art keywords
- gly
- ala
- leu
- val
- glufosinate
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0012—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7)
- C12N9/0014—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4)
- C12N9/0016—Oxidoreductases (1.) acting on nitrogen containing compounds as donors (1.4, 1.5, 1.6, 1.7) acting on the CH-NH2 group of donors (1.4) with NAD or NADP as acceptor (1.4.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P13/00—Preparation of nitrogen-containing organic compounds
- C12P13/04—Alpha- or beta- amino acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
- C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
- C12Y104/01002—Glutamate dehydrogenase (1.4.1.2)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
- C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
- C12Y104/01003—Glutamate dehydrogenase (NAD(P)+)(1.4.1.3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y104/00—Oxidoreductases acting on the CH-NH2 group of donors (1.4)
- C12Y104/01—Oxidoreductases acting on the CH-NH2 group of donors (1.4) with NAD+ or NADP+ as acceptor (1.4.1)
- C12Y104/01004—Glutamate dehydrogenase (NADP+) (1.4.1.4)
Abstract
The invention discloses an L-glutamate dehydrogenase mutant, wherein the amino acid sequence of the L-glutamate dehydrogenase mutant is shown as SEQ ID No.9 in a sequence table. The invention also discloses application of the L-amino acid dehydrogenase mutant in preparation of L-glufosinate-ammonium or salt thereof. Compared with the L-glutamate dehydrogenase mutant mutated only at 164 or 375, the L-glufosinate-ammonium or the salt thereof prepared by the L-glutamate dehydrogenase mutant has higher specific enzyme activity, so that the action efficiency of the enzyme is improved, and the conversion rate is higher when the L-glufosinate-ammonium or the salt thereof is applied to the preparation of the L-glufosinate-ammonium, so that the reaction cost can be remarkably reduced when the industrial scale-up production is carried out, and the industrial production is more facilitated.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to an L-glutamate dehydrogenase mutant and application thereof.
Background
Glufosinate-ammonium (2-amino-4- [ hydroxy (methyl) phosphono ] butanoic acid) was a broad-spectrum contact herbicide developed by the firm husks in the 80 s. Three herbicides in the world currently comprise glyphosate, glufosinate-ammonium and paraquat, and the glufosinate-ammonium has excellent weeding performance and smaller side effect compared with the glyphosate and paraquat. The glufosinate-ammonium has two optical isomers, namely D-glufosinate-ammonium and L-glufosinate-ammonium, but only the L-glufosinate-ammonium has herbicidal activity, so that the method for developing the L-glufosinate-ammonium has important significance for improving atom economy, reducing use cost and relieving environmental stress.
At present, the method for preparing L-glufosinate-ammonium mainly comprises a chiral resolution method, a chemical synthesis method and a biological catalysis method.
Chiral resolution methods such as CN1053669C disclose a method of using quinine alkaloids as resolving agents to recrystallize a quinine salt of L-glufosinate-ammonium, and then neutralizing the salt with an acid to obtain L-glufosinate-ammonium. Meanwhile, 5-nitro salicylaldehyde or 3, 5-dinitrosalicylaldehyde is used as a racemization reagent to racemize unreacted D-glufosinate-ammonium to obtain DL-glufosinate-ammonium which is continuously used for the resolution reaction. However, this method requires expensive chiral resolution reagent and multiple steps of recrystallization, and is cumbersome to operate and not a desirable method.
Chemical synthesis methods such as US6936444 disclose asymmetric hydrogenation of 2-acetamido-4- (hydroxymethylphosphinyl) -2-butenoic acid with a ruthenium catalyst to give L-2-acetamido-4- (hydroxymethylphosphinyl) -2-butanoic acid, which is then deacetylated to give L-glufosinate-ammonium. The method needs expensive metal catalyst, has high cost, and has heavy metal residue, which causes serious environmental pollution.
Compared with a chiral resolution method, a chemical synthesis method and a biological catalysis method, the method has the advantages of strong specificity, mild reaction conditions and the like, and is an advantageous method for producing the L-glufosinate-ammonium.
Currently, there is a method for obtaining L-glufosinate-ammonium by using N-phenylacetyl-DL-glufosinate-ammonium as a substrate and penicillin-G-acyltransferase derived from escherichia coli as a catalyst, which is described in US4389488(a), but the synthesis cost of phenylacetyl glufosinate-ammonium is relatively high, a mixed solution of L-glufosinate-ammonium, N-phenylacetyl-D-glufosinate-ammonium and phenylacetic acid is obtained after the reaction is finished, and the operation is relatively complicated because L-glufosinate-ammonium needs to be separated by using a strong acid cation exchange resin.
EP0382113A describes a process for the catalytic cleavage of carboxylic acid esters of N-acetyl-glufosinate by an acyltransferase to obtain L-glufosinate, but the enzyme in this process is not specific for free N-acetyl-glufosinate and therefore the N-acetyl-glufosinate must be esterified, which increases the number of reaction steps and correspondingly the production costs.
In addition, some of them are methods for producing L-glufosinate-ammonium by transaminase catalysis using 2-oxo-4- (hydroxymethylphosphinyl) butanoic acid (PPO) as a substrate, and U.S. Pat. No.4,419, 5221737A and EP0344683A describe methods for producing L-glufosinate-ammonium by the aminotransferase from Escherichia coli using glutamic acid as an amino donor from the corresponding keto acid 4- (hydroxymethylphosphinyl) -2-oxobutanoic acid, and an equivalent amount or an excess of glutamic acid as an amino donor is required in the reaction system, making it difficult to purify the product. CN1284858C modified the above method by using aspartate as an amino donor and L-glufosinate obtained by aspartate aminotransferase from the corresponding keto acid 4- (hydroxymethylphosphinyl) -2-oxobutyrate, in which aspartate is converted to oxaloacetate which is unstable in aqueous medium and spontaneously decarboxylates to pyruvate which can be removed by enzymatic reaction, making the reverse reaction impossible and requiring only equimolar amounts of amino donor and amino acceptor. However, the amino group donors used in the process using transaminase are mostly amino acids, which is costly.
In addition, a method for preparing L-glufosinate-ammonium by using 2-oxo-4- (hydroxymethyl phosphinyl) butyric acid (PPO) as a substrate and catalyzing by amino acid dehydrogenase is also provided, such as CN106978453A, wherein an inorganic amino donor is adopted, so that the product is simple to separate, and the cost is reduced. However, the concentration of the substrate catalyzed by the enzyme in CN106978453A is only 10-100mM, and the catalytic efficiency of the enzyme is not high.
CN108588045A discloses the application of a plurality of glutamate dehydrogenase mutants in the preparation of L-glufosinate-ammonium, finds that glutamate dehydrogenase (NCBI accession number: NP-742836.1) from pseudomonas putida, and the catalytic ability of the glutamate dehydrogenase on PPO is improved by mutating alanine at position 167 to glycine or mutating valine at position 378 to alanine, and then researches mutants at homologous sites at positions 167 and 378 of glutamate dehydrogenase from other sources, and finds that the mutants can also improve the catalytic ability of the glutamate dehydrogenase on PPO; however, no combinatorial mutations have been investigated on mutants of the homologous sites of glutamate dehydrogenase from these other sources. Furthermore, although both sites of glutamate dehydrogenase of pseudomonas putida are mutated at the same time in this patent application, the resulting double mutants have an increased enzyme activity by a factor comparable to that of the single-mutated mutants, and the effect of the double-mutated site mutants is not necessarily superior to that of their respective single-mutated mutants due to unpredictability in the biological field.
Disclosure of Invention
The invention aims to solve the technical problem that the existing L-glutamate dehydrogenase has low catalytic efficiency when preparing L-glufosinate-ammonium or salt thereof, and the like, so the invention provides an L-glutamate dehydrogenase mutant and application thereof in preparing L-glufosinate-ammonium or salt thereof. Compared with the glutamate dehydrogenase mutant with single site (164 site or 375 site) mutation, the L-glufosinate-ammonium or the salt thereof prepared by the L-glutamate dehydrogenase mutant has higher specific enzyme activity, so that the action efficiency of the enzyme is improved, and the conversion rate is higher when the L-glufosinate-ammonium or the salt thereof is applied to the preparation of the L-glufosinate-ammonium, so that the reaction cost can be remarkably reduced when the L-glufosinate-ammonium or the salt thereof is industrially expanded, and the L-glufosinate-ammonium or the salt thereof is more beneficial to industrial production.
The source of the wild-type L-glutamate dehydrogenase used by the invention is glutamate dehydrogenase of Pseudomonas entomophila L48, the amino acid sequence is shown as SEQ ID NO.1, and Genbank accession number WP _ 044487662.1. The glutamate dehydrogenase is not subjected to double mutation of two sites simultaneously in the prior art, and due to unpredictability in the biological field, the effect of the mutant of the double mutation sites is not necessarily superior to that of the respective mutant of single mutation. The inventor carries out combined mutation on the 164 th site and the 375 th site of the wild enzyme aiming at the substrate 2-oxo-4- (hydroxymethyl phosphinyl) butyric acid (PPO), and unexpectedly finds that when the 164 th site amino acid residue A is mutated into G and the 375 th site amino acid residue V is mutated into A, the specific enzyme activity of the obtained mutant to the substrate PPO is obviously improved.
One of the technical solutions for solving the above technical problems of the present invention is: an L-glutamate dehydrogenase mutant, the amino acid sequence of which is shown as SEQ ID NO.9 in the sequence table.
Preferably, the nucleotide sequence of the L-glutamate dehydrogenase mutant is shown as SEQ ID NO. 10.
The second technical scheme for solving the technical problems is as follows: an isolated nucleic acid encoding the L-glutamate dehydrogenase mutant as described above.
Preferably, the nucleotide sequence encoding the nucleic acid is shown as SEQ ID NO. 10.
The third technical scheme for solving the technical problems is as follows: a recombinant expression vector comprising said nucleic acid.
The fourth technical scheme for solving the technical problems is as follows: a transformant comprising the nucleic acid or the recombinant expression vector.
The fifth technical scheme for solving the technical problems is as follows: a preparation method of L-glufosinate-ammonium salt comprises the following steps: in the presence of a reaction solvent, the L-glutamate dehydrogenase mutant, an inorganic amino donor and reduced coenzyme NADPH (nicotinamide adenine dinucleotide phosphate), performing ammoniation reaction on the 2-oxo-4- (hydroxymethyl phosphinyl) butyrate to obtain the L-glufosinate-ammonium salt.
In the preparation method, except for the L-glutamate dehydrogenase mutant obtained by the invention, other raw materials, reaction steps and conditions are all conventional in the art, and the details can be found in the above-mentioned CN106978453A and the patent application with the application number of CN201810162629.4 of the applicant.
The preparation method of the L-glufosinate-ammonium salt can further comprise the following steps: and (2) carrying out oxidation reaction on the D-glufosinate in the presence of D-amino acid oxidase (DAAO) to obtain the 2-oxo-4- (hydroxymethyl phosphinyl) butyrate.
In the oxidation reaction, the cation of the D-glufosinate salt may be a cation conventional in the art, such as ammonium, sodium, and/or potassium, and the like. And may be a cation of the buffer used.
In the oxidation reaction, the D-glufosinate salt may be present alone or in combination with L-glufosinate salt (in which case the L-glufosinate salt may not react), for example: form D enriched glufosinate salt (i.e. with a content of the D enantiomer of > 50%, even pure D-glufosinate salt), form L enriched glufosinate salt (i.e. with a content of the L-glufosinate salt of > 50%, excluding the case of pure L-glufosinate salt), or the racemic glufosinate salt, etc.
In the oxidation reaction, the concentration of the D Amino Acid Oxidase (DAAO) may be conventional in the art, and is preferably 0.6-6U/mL, more preferably 1.8U/mL.
In the oxidation reaction, the concentration of the D-glufosinate salt may be conventional in the art, preferably 100-600mM, more preferably 200 mM.
The oxidation reaction may also be carried out in the presence of catalase.
The oxidation reaction can also be carried out under aeration conditions. The aeration is preferably air or oxygen. The rate of aeration is preferably 0.5-1 VVM.
In the present invention, the air may be air conventional in the art, and generally contains oxygen in an amount conventional in the art. Oxygen in the air is involved in the reaction.
When the oxidation reaction can also be carried out under aeration conditions, the oxidation reaction can also be carried out in the presence of an antifoaming agent.
In the oxidation reaction, the pH of the reaction system is preferably 7 to 9, more preferably 8. The pH can be achieved by using a buffer. The pH can also be achieved by adjustment using a base (or alkaline solution). The buffer solution is preferably a phosphate buffer solution or a Tris-HCl buffer solution, and the phosphate buffer solution is preferably a disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution or a dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer solution. The alkali solution is preferably ammonia.
In the oxidation reaction, the temperature of the reaction system may be conventional in the art, and is preferably 20 to 50 ℃, more preferably 20 ℃.
The oxidation reaction and the amination reaction may be carried out separately or simultaneously (in the same reaction system). The said simultaneous operations are for example: and (2) carrying out oxidation reaction and ammoniation reaction on the D-glufosinate-ammonium salt in the presence of D-amino acid oxidase (DAAO), L-glutamate dehydrogenase mutant, inorganic amino donor and reduced coenzyme NADPH to obtain the L-glufosinate-ammonium salt.
In the ammoniation reaction, the cation of the L-glufosinate salt may be a cation conventional in the art, such as ammonium, sodium and/or potassium, and the like. And may be a cation of the buffer used.
In the amination reaction, the cation of the 2-oxo-4- (hydroxymethylphosphinyl) butyrate may be a cation conventional in the art, such as ammonium, sodium, and/or potassium, and the like. And may be a cation of the buffer used.
In the ammoniation reaction, the L-glutamate dehydrogenase mutant can be used in the conventional amount, the L-glutamate dehydrogenase mutant concentration is preferably 0.05-3U/ml, for example can be 0.09U/ml.
In the amination reaction, the inorganic amino donor may be used in an amount conventional in the art, and the concentration of the inorganic amino donor is preferably 100-2000mM, more preferably 200 mM.
In the ammonification reaction, the concentration of the 2-oxo-4- (hydroxymethylphosphinyl) butanoate is preferably 100mM, more preferably 200 mM.
In the ammonification reaction, the 2-oxo-4- (hydroxymethylphosphinyl) butyrate may be used in an amount conventional in the art, and the mass ratio of the reduced coenzyme NADPH to the 2-oxo-4- (hydroxymethylphosphinyl) butyrate is preferably 1:100 to 1:20000, more preferably 1:1000 to 1:15000, still more preferably 1: 5000.
In the ammonification reaction, the inorganic amino donor is one or more of ammonia gas, ammonium sulfate, ammonium chloride, diammonium hydrogen phosphate, ammonium acetate, ammonium formate and ammonium hydrogen carbonate.
In the amination reaction, the temperature of the reaction can be conventional in the art, and in order to ensure the catalytic efficiency of the L-glutamate dehydrogenase mutant, the temperature for performing the amination reaction is preferably 20-50 ℃, more preferably 37 ℃, and when the temperature of the amination reaction is lower than 20 ℃, the amination reaction is slow; when the temperature of the amination reaction is above 50 ℃, the enzyme will irreversibly denature inactive.
In the amination reaction, the reaction solvent is water.
In the preparation method, the ammoniation reaction is preferably carried out at a pH of 7 to 9, more preferably 8.5. The pH can be achieved by using a buffer. The pH can also be achieved by adjustment using a base (or alkaline solution). The buffer solution is preferably a phosphate buffer solution or a Tris-HCl buffer solution, and the phosphate buffer solution is preferably a disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution or a dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer solution. The alkali solution is preferably ammonia.
The preparation method of the L-glufosinate-ammonium salt further comprises the following steps: under the existence of dehydrogenase (such as glucose dehydrogenase, alcohol dehydrogenase or formate dehydrogenase) and hydrogen donor (such as glucose, isopropanol or formate), oxidized coenzyme NADP+And (3) carrying out reduction reaction to obtain the reduced coenzyme NADPH.
In the reduction reaction, the dehydrogenase and the hydrogen donor are in one-to-one correspondence, such as:
when the dehydrogenase is alcohol dehydrogenase, the hydrogen donor is isopropanol;
when the dehydrogenase is glucose dehydrogenase, the hydrogen donor is glucose;
when the dehydrogenase is formate dehydrogenase, the hydrogen donor is formate.
In the reduction reaction, the dehydrogenase concentration can be conventional in the art, preferably 0.6-6U/mL, more preferably 2U/mL.
In the reduction reaction, the concentration of the hydrogen donor may be conventional in the art, preferably 100-1000mM, more preferably 240 mM.
In the reduction reaction, the oxidized coenzyme NADP+The concentration of (b) may be conventional in the art.
In the reduction reaction, the pH at which the reduction reaction is carried out is preferably 7 to 9, more preferably 8.5. The pH can be achieved by using a buffer. The pH can also be achieved by adjustment using a base (or alkaline solution). The buffer solution is preferably a phosphate buffer solution or a Tris-HCl buffer solution, and the phosphate buffer solution is preferably a disodium hydrogen phosphate-sodium dihydrogen phosphate buffer solution or a dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer solution. The alkali solution is preferably ammonia.
In the reduction reaction, the temperature of the reaction system may be conventional in the art, and is preferably 20 to 50 ℃, more preferably 37 ℃.
The reduction reaction and the amination reaction may be carried out separately or simultaneously (in the same reaction system). The simultaneous processing is, for example, as shown in the preferred embodiment of the present invention: in the presence of glucose dehydrogenase, glucose, oxidized coenzyme NADP+An amination reaction of 2-oxo-4- (hydroxymethylphosphinyl) butyrate in the presence of an L-glutamate dehydrogenase mutant and an inorganic amino donor (together with NADP+Reduction reaction) to obtain the L-glufosinate-ammonium salt.
When the reduction reaction and the amination reaction are simultaneously performed, NADPH used for the amination reaction can be cyclically produced by the reduction reaction. The oxidized coenzyme NADP+The concentration of (b) is conventional in the art, and the mass ratio of the compound (b) to the 2-oxo-4- (hydroxymethylphosphinyl) butanoate is 1:100 to 1:20000, preferably 1:1000 to 1:15000, more preferably 1:5000, in order to ensure that the reaction can be normally carried out.
The reduction reaction, the oxidation reaction and the amination reaction may be carried out separately or simultaneously (in the same reaction system). The simultaneous processing is, for example, as shown in the preferred embodiment of the present invention: in D-amino acid oxidase (DAAO), dehydrogenase, hydrogen donor, oxidized coenzyme NADP+D-glufosinate-ammonium is subjected to oxidation reaction and ammoniation reaction (simultaneously existing NADP) in the presence of L-glutamate dehydrogenase mutant and inorganic amino donor+Reduction reaction) to obtain the L-glufosinate-ammonium salt.
When the reduction reaction, the oxidation reaction and the amination reaction are performed simultaneously, NADPH for the amination reaction can be cyclically generated through the reduction reaction. The oxidized coenzyme NADP+The concentration of (b) is conventional in the art, and the mass ratio of the compound (b) to the 2-oxo-4- (hydroxymethylphosphinyl) butanoate is 1:100 to 1:20000, preferably 1:1000 to 1:15000, more preferably 1:5000, in order to ensure that the reaction can be normally carried out.
The reaction time of the preparation method can be stopped when the required purpose is achieved by the final concentration of raw materials or the final concentration or the conversion rate of products under the condition of detecting by a conventional method; the conventional methods include pre-column derivatization high performance liquid chromatography or ion pair chromatography, etc.
The sixth technical scheme for solving the technical problems of the invention is as follows: a preparation method of L-glufosinate-ammonium comprises the following steps:
(1) preparing the L-glufosinate salt according to the preparation method of the L-glufosinate salt;
(2) and (2) carrying out an acidification reaction on the L-glufosinate-ammonium salt prepared in the step (1) to obtain the L-glufosinate-ammonium.
The seventh technical scheme for solving the technical problems of the invention is as follows: an application of the prepared L-glutamate dehydrogenase mutant in preparing L-glufosinate-ammonium or salt thereof.
The application may comprise the steps of: reacting 2-oxo-4- (hydroxymethyl phosphinyl) butyrate in the presence of an L-glutamate dehydrogenase mutant, an inorganic amino donor and reduced coenzyme to obtain the L-glufosinate-ammonium salt.
Alternatively, the application may comprise the steps of: reacting 2-oxo-4- (hydroxymethyl phosphinyl) butyric acid in the presence of an L-glutamate dehydrogenase mutant, an inorganic amino donor and reduced coenzyme to obtain the L-glufosinate-ammonium.
Alternatively, the application may comprise the steps of: reacting 2-oxo-4- (hydroxymethyl phosphinyl) butyrate in the presence of an L-glutamate dehydrogenase mutant, an inorganic amino donor and reduced coenzyme to obtain L-glufosinate-ammonium salt, and then carrying out an acidification reaction to obtain the L-glufosinate-ammonium.
In the present invention, the L-glufosinate salt may be generally present in the form of L-glufosinate ammonium salt. The concentrations of the above compounds are, unless otherwise specified, the concentrations of the above compounds in the whole reaction system before the reaction.
On the basis of the common knowledge in the field, the above preferred conditions can be combined randomly to obtain the preferred embodiments of the invention.
The reagents and starting materials used in the present invention are commercially available. The positive progress effects of the invention are as follows:
compared with the glutamate dehydrogenase mutant with single site (164 or 375 site) mutation, the L-glutamate dehydrogenase mutant has higher specific enzyme activity when used for preparing L-glufosinate-ammonium or salt thereof, and has higher conversion rate when applied to the preparation of the L-glufosinate-ammonium or salt thereof, thereby more obviously reducing the reaction cost when carrying out industrial expanded production and being more beneficial to industrial production. In a preferred embodiment of the present invention, the transformation rate of PenGluDH-A164G-V375A is 84% higher than that of PenGluDH-A164G and PenGluDH-V375A, which are single mutation sites, by at least about 12%.
Drawings
FIG. 1: marcey reagent pre-column derivatization HPLC analysis of racemic glufosinate standard, with the last two peaks being the peaks of the marcey reagent itself.
FIG. 2: and (3) preparing a Marfey reagent pre-column derivatization HPLC analysis result of D-glufosinate-ammonium and L-glufosinate-ammonium in the obtained product.
FIG. 3: ion pair HPLC analysis of racemic glufosinate standard.
FIG. 4: and (5) analyzing the result of the PPO standard substance ion pair HPLC.
FIG. 5: and (4) analyzing the result of the ion pair HPLC analysis of the reaction solution after the reaction is finished.
FIG. 6: mass spectra of PPO standards.
Detailed Description
The invention is further illustrated by the following examples, which are not intended to limit the scope of the invention. The experimental methods without specifying specific conditions in the following examples were selected according to the conventional methods and conditions, or according to the commercial instructions.
The experimental methods in the invention are conventional methods unless otherwise specified, and the gene cloning operation can be specifically referred to in molecular cloning experimental guidelines compiled by J. SammBruk et al.
The abbreviations for the amino acids in the present invention are those conventional in the art unless otherwise specified, and the amino acids corresponding to the specific abbreviations are shown in Table 1.
TABLE 1
Codons corresponding to the amino acids are also conventional in the art, and the correspondence between specific amino acids and codons is shown in table 2.
TABLE 2
pET28a was purchased from Novagen; NdeI enzyme, HindIII enzyme were purchased from Thermo Fisher, e.coli BL21(DE3) competent cells were purchased from the biotechnology limited liability company of china prosperity, beijing dingding; catalase was purchased from Shandong Fengtai Biotech Co., Ltd; NADPH was purchased from Shenzhen Bangtai bioengineering, Inc.; NH (NH)4Cl is available from shanghai tympanoc technology in limited amounts.
Chiral analysis of the product was performed by pre-column derivatization High Performance Liquid Chromatography (HPLC), and the specific analysis method was:
(1) chromatographic conditions are as follows: agilent ZORBAX Eclipse plus C18, 3.5 μm, 150 × 4.6 mm. Mobile phase A: 0.1% TFA + H2O, mobile phase B: 0.1% TFA + CAN. Detection wavelength: 340nm, flow rate: 1.0mL/min, column temperature: at 30 ℃.
(2) A derivatization reagent, namely a Marfey reagent, 50mg of N- α - (2, 4-dinitro-5-fluorophenyl) -L-alaninamide is accurately weighed and dissolved by acetonitrile to prepare 25ml solution for later use.
(3) And (3) derivatization reaction: and (3) taking reaction liquid to dilute by 100 times, and adding an equal volume of Marfey reagent for derivatization. 10. mu.l of sample was injected for analysis.
Conversion ═ (reactant-remaining reactant)/reactant × 100%
2-oxo-4- (hydroxymethyl phosphinyl) butyric acid (PPO for short) is analyzed by ion pair High Performance Liquid Chromatography (HPLC), and the specific analysis method comprises the following steps:
chromatographic conditions are as follows: ultate AQ-C18, 5 μm, 4.6 x 250 mm; mobile phase: 0.05mol/L diammonium phosphate PH 3.6: 10% tetrabutylammonium hydroxide in water: acetonitrile 91:1: 8; detection wavelength: 205 nm; flow rate: 1.0 ml/min; column temperature: at 25 ℃.
In the following examples, all the terms are "glufosinate", but since "glufosinate" is in the reaction system, the skilled person defaults to "glufosinate ammonium" as "glufosinate ammonium", the "glufosinate ammonium" is actually referred to as "glufosinate ammonium", the corresponding glufosinate ammonium standards are also referred to as "glufosinate ammonium" and the corresponding generated PPO is referred to as PPO ammonium. And when the optical rotation of the obtained product glufosinate-ammonium is detected, the glufosinate-ammonium is subjected to an acidification reaction to obtain glufosinate-ammonium, and then the glufosinate-ammonium is detected.
EXAMPLE 1 obtaining of L-glutamic acid dehydrogenase mutant enzyme
The glutamate dehydrogenase sequence SEQ ID NO.1, Genbank accession number WP _044487662.1 from Pseudomonas entomophila L48 was retrieved from NCBI, and the genes were synthesized according to the mutant gene sequences SEQ ID NO.2, SEQ ID NO.4, SEQ ID NO.6, SEQ ID NO.8, and SEQ ID NO.10 in Table 3, and the gene synthesis company was Jinzhi Biotech, Inc., Suzhou (national institute of Industrial science and technology, Jurisch 218 Bionanotechnology park, Vol. C3).
Then the mutant gene is respectively enzymatically connected with pET28a and enzyme cutting sites NdeI & HindIII, and the enzyme-connected vector is used for transforming host escherichia coli BL21 competent cells. Inoculating the constructed strain into a TB culture medium, culturing at 37 ℃, shaking at 200rpm, inducing overnight at the concentration of IPTG (isopropyl thiogalactoside) of 0.1mM, and collecting the strain to obtain the engineering strain containing the glutamate dehydrogenase gene.
After the engineering bacteria containing the glutamate dehydrogenase gene are activated by plating and streaking, a single colony is selected and inoculated into 5ml LB liquid culture medium containing 50 mug/ml kanamycin, and shake culture is carried out for 12h at 37 ℃. Transferred to 150ml of fresh LB liquid medium containing 50. mu.g/ml kanamycin at an inoculum size of 2%, shaken at 37 ℃ until the OD600 reaches about 0.8, added with IPTG to a final concentration of 0.5mM, and induced for 16 hours at 18 ℃. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, collecting the thalli, and storing the thalli in an ultra-low temperature refrigerator at minus 80 ℃ for later use.
5g of the collected cells after the culture was completed were washed twice with 50mM Tris-HCl buffer solution (pH8.5), then resuspended in 30mL Tris-HCl buffer solution (pH8.5), homogenized and disrupted, and the disrupted solution was centrifuged at 12000rpm for 10min to remove the precipitate, thereby obtaining a crude enzyme solution of the supernatant containing the recombinant glutamate dehydrogenase.
Table 3:
example 2 detection of specific enzyme Activity of mutant enzymes
Preparing a substrate solution: 355. mu.L of 2.25M PPO (final concentration 20mM) (prepared by the inventors, preparation method reference US8017797B, FIG. 6 shows the corresponding mass spectrum) and 0.4g NH were added4Cl (final concentration 200mM), ammonia adjusted to pH8.5, and 50mM Tris-HCl buffer (pH 8.5) to 40 ml.
The enzyme activity detection method comprises the following steps:
the total reaction system is 1ml, the light absorption value is measured at OD340nm, 940 mu L of substrate solution is sequentially added into a 1ml cuvette, the zero adjustment is carried out, 10 mu L of 25mM NADPH is then added, 50 mu L of crude enzyme solution is finally added, the numerical change of 0-10min is recorded, a value is taken every 30s, a curve is made by taking the reaction time as the abscissa and the absorption value at the wavelength of 340nm as the ordinate, the slope is taken, the reduction rate of the NADPH is calculated, and the enzyme activity is calculated.
Definition of unit enzyme activity: under specific reaction conditions (30 ℃), the amount of enzyme required to reduce NADPH by 1. mu. mol per minute.
The specific enzyme activity is the activity unit contained in each milligram of enzyme protein, and the calculation formula is as follows: the unit of enzyme activity/protein content is U/mg or U/g. The results are shown in Table 4.
It is known from CN108588045A that wild-type PenGluDH-WT (WP _044487662.1) has much lower enzyme activity than single-site mutants, and those skilled in the art can find that wild-type PenGluDH-WT (WP _044487662.1) also has much lower enzyme activity than mutants, so that wild-type PenGluDH-WT (WP _044487662.1) is not detected in the present invention.
TABLE 4
N.d. means no specific enzyme activity was detected.
The above-described method was used for the preparation of the crude L-glutamic acid dehydrogenase used in the following examples.
Example 3 acquisition of D Amino Acid Oxidase (DAAO) Gene
The DAAO enzyme gene was synthesized entirely from the gene sequence of the AC302DAAO enzyme described in patent US9834802B 2. The synthetic company is Suzhou Jinweizhi Biotechnology GmbH, Ministry of Yangbei, south Jing, Jiangsu province, Ministry of Yangyu, Purisun road No. 211.
Example 4 expression of the D Amino Acid Oxidase (DAAO) Gene
Composition of LB liquid medium: 10g/L of peptone, 5g/L of yeast powder and 10g/L of NaCl, dissolving with deionized water, fixing the volume, and sterilizing at 121 ℃ for 20min for later use.
The DAAO enzyme gene synthesized in example 3 was ligated with pET28a, and the restriction sites NdeI & HindIII, and the ligated vector was transformed into competent cells of the host e.coli BL21(DE3) to obtain an engineered strain containing DAAO enzyme.
After the engineering strain containing the DAAO enzyme gene is activated by plating and streaking, a single colony is selected and inoculated into 5ml LB liquid culture medium containing 50 mug/ml kanamycin, and shake culture is carried out for 12h at 37 ℃. Transferred to 50ml of fresh LB liquid medium containing 50. mu.g/ml kanamycin at 2% inoculum size and shaken to OD at 37 ℃600When the value reaches about 0.8, IPTG is added to the final concentration of 0.5mM, and the induction culture is carried out for 16h at 18 ℃. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, collecting the thalli, and storing the thalli in an ultralow temperature refrigerator at the temperature of 20 ℃ below zero for later use.
EXAMPLE 5 preparation of crude enzyme solution of D Amino Acid Oxidase (DAAO) and enzyme Activity measurement
The cells collected in example 4 were washed twice with 50mM phosphate buffer pH8.0, then resuspended in phosphate buffer pH8.0, and then disrupted by low-temperature high-pressure homogenization and centrifugation, and the resulting supernatant was a crude enzyme solution containing recombinant DAAO enzyme.
The enzyme activity detection method comprises the following steps: mu.L of disodium hydrogenphosphate-sodium dihydrogenphosphate buffer (containing 50mmol/L of D-glufosinate-ammonium and 0.1mg/mL of peroxidase) at pH8.0, 50. mu.L of a developing agent (60. mu.g/mL of 2,4, 6-tribromo-3-hydroxybenzoic acid and 1mg/mL of 4-aminoantipyrine), 50. mu.L of DAAO enzyme, and measurement of ultraviolet absorption at 510nm to determine H2O2And (4) calculating the concentration of PPO, and calculating the enzyme activity.
Definition of unit enzyme activity: the amount of enzyme required to produce 1. mu. mol PPO per minute under the specified reaction conditions (30 ℃).
The preparation methods of the DAAO enzyme crude enzyme solutions used in the following examples all employed the above methods.
Example 6 acquisition and expression of alcohol dehydrogenase Gene
The alcohol dehydrogenase gene was synthesized in its entirety based on the gene sequence of Cyclopentanol dehydrogenase derived from Bacillus subtilis KB290 (Genbank accession BAN 05992.1).
Composition of LB liquid medium: 10g/L of peptone, 5g/L of yeast powder and 10g/L of NaCl, dissolving with deionized water, fixing the volume, and sterilizing at 121 ℃ for 20min for later use.
The alcohol dehydrogenase gene is connected with pET28a, and the enzyme cutting site is NdeI&HindIII, and transforming the enzyme-linked vector into host E.coli BL21(DE3) competent cells to obtain an engineering strain containing an alcohol dehydrogenase gene. After the engineering bacteria containing the alcohol dehydrogenase gene are activated by plating and streaking, a single colony is selected and inoculated into 5ml LB liquid culture medium containing 50 mug/ml kanamycin, and shake culture is carried out for 12h at 37 ℃. Transferred to 50ml of fresh LB liquid medium containing 50. mu.g/ml kanamycin at 2% inoculum size and shaken to OD at 37 ℃600When the concentration reached about 0.8, IPTG was added to a final concentration of 0.5mM, and induced culture was carried out at 18 ℃ for 16 hours. And after the culture is finished, centrifuging the culture solution at 10000rpm for 10min, removing the supernatant, collecting the thalli, and storing the thalli in an ultralow temperature refrigerator at the temperature of 20 ℃ below zero for later use.
Example 7 preparation of crude enzyme solution of alcohol dehydrogenase and enzyme Activity measurement
Taking 10g of the thalli collected in the embodiment 6, adding 50ml of 100mM ammonium phosphate buffer solution with pH7.5 into 10g of bacterial sludge, stirring uniformly, homogenizing and crushing at 500bar to obtain a crude enzyme solution, dropwise adding 10% (volume ratio) of flocculant (namely polyethyleneimine, the final concentration is 2-2.5 per mill, volume ratio) under the stirring condition, stirring for 5min, centrifuging at 4000rpm for 10min to obtain a clarified enzyme solution, and taking supernatant to measure the enzyme activity.
The enzyme activity detection method comprises the following steps: 3ml of the reaction system, 2850. mu.L of 400mM isopropanol (100mM phosphate buffer solution) having a pH of 8.0 was added thereto at 25 ℃ and 50. mu.L of NADP was added thereto+(25mM), zero setting by an ultraviolet spectrophotometer, adding 100 mu L of enzyme solution diluted by 100 times, and measuring the OD value at 340nm by the ultraviolet spectrophotometer.
Definition of unit enzyme activity: the amount of enzyme required to produce 1. mu. mol of NADPH per minute under the specific reaction conditions (25 ℃, pH 7.0) was defined as 1U.
The above methods were used for the preparation of the crude glucose dehydrogenase solutions used in the following examples.
EXAMPLE 8 catalytic preparation of L-glufosinate-ammonium by DAAO enzyme and L-glutamate dehydrogenase mutant
200g L-glutamate dehydrogenase mutant thallus (prepared according to example 1) is resuspended in 50mM phosphate buffer solution with pH of 8.0, the volume is determined to be 1L, the thallus is homogenized and crushed at low temperature and high pressure, the precipitate is discarded by centrifugation, and the supernatant is retained, thus obtaining crude L-glutamate dehydrogenase mutant thallus.
80g of D, L-glufosinate-ammonium was weighed, dissolved completely in 50mM disodium hydrogenphosphate-sodium dihydrogenphosphate buffer solution having a pH of 8.0, 2.5g of 40 ten thousand U/g of catalase was added, 150mL of DAAO enzyme crude enzyme solution (12U/mL) prepared according to the method of example 5 was added, the pH was adjusted to 8.0 with ammonia, and 50mM disodium hydrogenphosphate-sodium dihydrogenphosphate buffer solution having a pH of 8.0 was added to make a volume of 1L. Mechanically stirring the mixture in a water bath kettle at the temperature of 20 ℃ for reaction, introducing air according to the volume of 1VVM (introducing air of 1 time of the reaction volume per minute), adding 1mL of defoaming agent to prevent foaming, detecting the generation concentration of PPO by using ion pair HPLC (high performance liquid chromatography), simultaneously detecting the amount and the ee value of the residual L-glufosinate-ammonium by using pre-column derivatization high performance liquid chromatography, and stopping the reaction when the ee value is more than 99%.
3 equal portions of 50mL of the reaction solution were added with 0.54g of ammonium chloride and NADP, respectively+0.4mg and 0.73g of isopropyl alcohol were added to 1mL of the mixture prepared by the method of example 7Respectively adding 1mL of crude L-glutamate dehydrogenase mutant enzyme liquid into the alcohol dehydrogenase (300U/mL), adjusting the pH to 8.5 by ammonia water, controlling the reaction temperature by magnetic stirring in a water bath kettle to be 37 ℃, detecting the residual concentration of PPO by using ion pair HPLC, and simultaneously detecting the amount and ee value of L-glufosinate-ammonium in a system by using pre-column derivatization high performance liquid chromatography. The results of the reaction are shown in Table 5. As is clear from Table 5, the conversion rate after 18 hours of reaction was 84% when PenGluDH-A164G-V375A was used, which was at least about 12% higher than the conversion rate when PenGluDH-A164G and PenGluDH-V375A were used as single mutation sites. When the method is used for industrial scale-up production application, the reaction cost can be remarkably reduced, and the method is more favorable for industrial production.
The HPLC analysis results of D-glufosinate-L in the product after 18h reaction are shown in FIG. 2 (in the figure, L-glutamate dehydrogenase mutant 1-4(PenGluDH-A164G-V375A) is taken as an example for illustration), wherein L-glufosinate-L with the retention time of 13.781min is obtained, and D-glufosinate-L is hardly detected; a Marfey reagent pre-column derivatization HPLC profile of racemic glufosinate standard (purchased from Shanghai Aladdin Biotechnology, Inc.) is shown in FIG. 1 (L-glufosinate-ammonium retention time 13.683min, D-glufosinate-ammonium retention time 12.016 min). The components of the product prepared in this example were substantially the same as the peak time of L-glufosinate-ammonium in the standard, and the product was acidified, concentrated, column purified, recrystallized to give pure L-glufosinate-ammonium, and the optical rotation was measured [ a ]]D25This example is illustrated for the preparation of L-glufosinate-ammonium at +28.1 ° (C ═ 1,1N HCl) (optical rotation of L-glufosinate-ammonium is described in prior art US 4389488).
The result of ion pair HPLC analysis of the reaction solution after 18h reaction is shown in FIG. 5, wherein 10.159min is the peak position of PPO, and 3.761min is the peak position of glufosinate-ammonium. An ion pair HPLC spectrum of the PPO standard (the standard is made by the inventor, and the preparation method reference is US8017797B, and fig. 6 is a mass spectrum corresponding to the PPO standard) is shown in fig. 4, wherein the retention time of the PPO standard is 9.520 min. The ion pair HPLC profile of racemic glufosinate standard (purchased from shanghai alatin biochemical technology ltd) is shown in fig. 3, wherein the retention time of racemic glufosinate standard is 3.829 min. It can be seen that in the example, most of PPO (ions of PPO are detected by ion chromatography, so that the peak time of PPO and PPO ammonium salt is the same when the PPO and PPO ammonium salt are detected) is converted, and the peak time of the product glufosinate-ammonium is basically consistent with that of the respective standard.
Although the above graphs show the L-glutamate dehydrogenase mutant 1-4(PenGluDH-A164G-V375A), the inventors have conducted experiments with all other mutations and have confirmed that the mutations of the present invention catalyze the substrate when they participate in the above reaction and all produce the correct products.
TABLE 5
| Mutant enzyme numbering | Mutation site | 2h conversion | Conversion rate of 18h | ee value |
| 1-1 | PenGluDH-A164G | 28.78％ | 75.12％ | >99％ |
| 1-2 | PenGluDH-V375A | 27.46％ | 70.24 | >99％ |
| 1-4 | PenGluDH-A164G-V375A | 30.0％ | 84.0％ | >99％ |
Comparative example:
a mutant enzyme of Pseudomonas putida (Genbank accession No.: NP-742836.1) glutamate dehydrogenase (hereinafter abbreviated as PpGluDH) disclosed in CN108588045A was obtained in the same manner as in example 1, and the specific enzyme activity was measured as described in example 2, and the results are shown in Table 6:
TABLE 6
As can be seen from Table 6, the mutants obtained by mutating the glutamate dehydrogenase derived from Pseudomonas putida at the homologous sites thereof are not all mutants having the double site as effective as the single mutant.
SEQUENCE LISTING
<110> Korea chess, Korea biological medicine science and technology Limited
<120> L-glutamate dehydrogenase mutant and application thereof
<130>P19010918C
<160>18
<170>PatentIn version 3.5
<210>1
<211>446
<212>PRT
<213>Pseudomonas entomophila
<400>1
Met Ile Glu Ser Val Asp His Phe Leu Ala Arg Leu Gln Gln Arg Asp
1 5 10 15
Pro Ala Gln Pro Glu Phe His Gln Ala Val Glu Glu Val Leu Arg Ser
20 25 30
Leu Trp Pro Phe Leu Glu Gln Asn Pro His Tyr Leu Glu Ala Gly Ile
35 40 45
Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe Arg Val Ser
5055 60
Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly Tyr Arg Ile
65 70 75 80
Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu Arg Phe His
85 90 95
Pro Ser Val Asn Leu Gly Val Leu Lys Phe Leu Ala Phe Glu Gln Val
100 105 110
Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly Lys Gly Gly
115 120 125
Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val Met Arg Phe
130 135 140
Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly Ala Asp Leu
145 150 155 160
Asp Val Pro Ala Gly Asp Ile Gly Val Gly Ala Arg Glu Ile Gly Phe
165 170 175
Leu Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr Ser Val Leu
180 185 190
Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg Pro Glu Ala
195 200 205
Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu Lys Arg Gln
210 215220
Glu Gln Arg Ile Asp Gly Arg Arg Val Ala Ile Ser Gly Ser Gly Asn
225 230 235 240
Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly Gly Lys Val
245 250 255
Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Phe Cys Glu Ala Gly Leu
260 265 270
Thr Asp Glu Gln Trp Asp Ala Leu Met Glu Leu Lys Asn Val Lys Arg
275 280 285
Gly Arg Ile Ser Glu Leu Ala Gly Arg Phe Gly Leu Glu Phe Arg Lys
290 295 300
Gly Gln Thr Pro Trp Ser Leu Ala Cys Asp Ile Ala Leu Pro Cys Ala
305 310 315 320
Thr Gln Asn Glu Leu Asn Ala Asp Asp Ala Arg Thr Leu Leu Arg Asn
325 330 335
Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr Thr Leu Asp
340 345 350
Ala Val Asp Ile Phe Ile Glu Ala Gly Ile Leu Tyr Ala Pro Gly Lys
355 360 365
Ala Ser Asn Ala Gly Gly Val Ala Val Ser Gly Leu Glu Met Ser Gln
370 375380
Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp Ser Lys Leu
385 390 395 400
His His Ile Met Gln Ser Ile His His Val Cys Val His Tyr Gly Glu
405 410 415
Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn Ile Ala Gly
420 425 430
Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val Val
435 440 445
<210>2
<211>1338
<212>DNA
<213>Pseudomonas entomophila
<400>2
atgatcgaat ctgttgacca cttcctggct cgtctgcagc agcgtgaccc ggctcagccg 60
gaattccacc aggctgttga agaagttctg cgttctctgt ggccgttcct ggaacagaac 120
ccgcactacc tggaagctgg tatcctggaa cgtatggttg aaccggaacg tgctgttctg 180
ttccgtgttt cttgggttga cgaccagggt aaagttcagg ttaaccgtgg ttaccgtatc 240
cagatgtctt ctgctatcgg tccgtacaaa ggtggtctgc gtttccaccc gtctgttaac 300
ctgggtgttc tgaaattcct ggctttcgaa caggttttca aaaactctct gacctctctg 360
ccgatgggtg gtggtaaagg tggttctgac ttcgacccga aaggtaaatc tgacgctgaa 420
gttatgcgtt tctgccaggc tttcatgtct gaactgtacc gtcacatcgg tgctgacctg 480
gacgttccgg ctggtgacat cggtgttggt gctcgtgaaa tcggtttcct gttcggtcag 540
tacaaacgtc tggctaacca gttcacctct gttctgaccg gtaaaggtat gacctacggt 600
ggttctctga tccgtccgga agctaccggt tacggttgcg tttacttcgc tgaagaaatg 660
ctgaaacgtc aggaacagcg tatcgacggt cgtcgtgttg ctatctctgg ttctggtaac 720
gttgctcagt acgctgctcg taaagttatg gacctgggtg gtaaagttat ctctctgtct 780
gactctgaag gtaccctgtt ctgcgaagct ggtctgaccg acgaacagtg ggacgctctg 840
atggaactga aaaacgttaa acgtggtcgt atctctgaac tggctggtcg tttcggtctg 900
gaattccgta aaggtcagac cccgtggtct ctggcttgcg acatcgctct gccgtgcgct 960
acccagaacg aactgaacgc tgacgacgct cgtaccctgc tgcgtaacgg ttgcatctgc 1020
gttgctgaag gtgctaacat gccgaccacc ctggacgctg ttgacatctt catcgaagct 1080
ggtatcctgt acgctccggg taaagcttct aacgctggtg gtgttgctgt ttctggtctg 1140
gaaatgtctc agaacgctat gcgtctgctg tggaccgctg gtgaagttga ctctaaactg 1200
caccacatca tgcagtctat ccaccacgtt tgcgttcact acggtgaaga agctgacggt 1260
cgtatcaact acgttaaagg tgctaacatc gctggtttcg ttaaagttgc tgacgctatg 1320
ctggctcagg gtgttgtt 1338
<210>3
<211>446
<212>PRT
<213>Artificial Sequence
<220>
<223>PenGluDH-A164G
<400>3
Met Ile Glu Ser Val Asp His Phe Leu Ala Arg Leu Gln Gln Arg Asp
1 5 10 15
Pro Ala Gln Pro Glu Phe His Gln Ala Val Glu Glu Val Leu Arg Ser
20 25 30
Leu Trp Pro Phe Leu Glu Gln Asn Pro His Tyr Leu Glu Ala Gly Ile
35 40 45
Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe Arg Val Ser
50 55 60
Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly Tyr Arg Ile
65 70 75 80
Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu Arg Phe His
85 90 95
Pro Ser Val Asn Leu Gly Val Leu Lys Phe Leu Ala Phe Glu Gln Val
100 105 110
Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly Lys Gly Gly
115 120 125
Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val Met Arg Phe
130 135 140
Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly Ala Asp Leu
145 150 155 160
Asp Val Pro Gly Gly Asp Ile Gly Val Gly Ala Arg Glu Ile Gly Phe
165 170 175
Leu Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr Ser Val Leu
180 185 190
Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg Pro Glu Ala
195 200 205
Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu Lys Arg Gln
210 215 220
Glu Gln Arg Ile Asp Gly Arg Arg Val Ala Ile Ser Gly Ser Gly Asn
225 230 235 240
Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly Gly Lys Val
245 250 255
Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Phe Cys Glu Ala Gly Leu
260 265 270
Thr Asp Glu Gln Trp Asp Ala Leu Met Glu Leu Lys Asn Val Lys Arg
275 280 285
Gly Arg Ile Ser Glu Leu Ala Gly Arg Phe Gly Leu Glu Phe Arg Lys
290 295 300
Gly Gln Thr Pro Trp Ser Leu Ala Cys Asp Ile Ala Leu Pro Cys Ala
305 310 315 320
Thr Gln Asn Glu Leu Asn Ala Asp Asp Ala Arg Thr Leu Leu Arg Asn
325 330 335
Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr Thr Leu Asp
340 345 350
Ala Val Asp Ile Phe Ile Glu Ala Gly Ile Leu Tyr Ala Pro Gly Lys
355 360 365
Ala Ser Asn Ala Gly Gly Val Ala Val Ser Gly Leu Glu Met Ser Gln
370 375 380
Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp Ser Lys Leu
385 390 395 400
His His Ile Met Gln Ser Ile His His Val Cys Val His Tyr Gly Glu
405 410 415
Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn Ile Ala Gly
420 425 430
Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val Val
435 440 445
<210>4
<211>1338
<212>DNA
<213>Artificial Sequence
<220>
<223>PenGluDH-A164G
<400>4
atgatcgaat ctgttgacca cttcctggct cgtctgcagc agcgtgaccc ggctcagccg 60
gaattccacc aggctgttga agaagttctg cgttctctgt ggccgttcct ggaacagaac 120
ccgcactacc tggaagctgg tatcctggaa cgtatggttg aaccggaacg tgctgttctg 180
ttccgtgttt cttgggttga cgaccagggt aaagttcagg ttaaccgtgg ttaccgtatc 240
cagatgtctt ctgctatcgg tccgtacaaa ggtggtctgc gtttccaccc gtctgttaac 300
ctgggtgttc tgaaattcct ggctttcgaa caggttttca aaaactctct gacctctctg 360
ccgatgggtg gtggtaaagg tggttctgac ttcgacccga aaggtaaatc tgacgctgaa 420
gttatgcgtt tctgccaggc tttcatgtct gaactgtacc gtcacatcgg tgctgacctg 480
gacgttccgg gtggtgacat cggtgttggt gctcgtgaaa tcggtttcct gttcggtcag 540
tacaaacgtc tggctaacca gttcacctct gttctgaccg gtaaaggtat gacctacggt 600
ggttctctga tccgtccgga agctaccggt tacggttgcg tttacttcgc tgaagaaatg 660
ctgaaacgtc aggaacagcg tatcgacggt cgtcgtgttg ctatctctgg ttctggtaac 720
gttgctcagt acgctgctcg taaagttatg gacctgggtg gtaaagttat ctctctgtct 780
gactctgaag gtaccctgtt ctgcgaagct ggtctgaccg acgaacagtg ggacgctctg 840
atggaactga aaaacgttaa acgtggtcgt atctctgaac tggctggtcg tttcggtctg 900
gaattccgta aaggtcagac cccgtggtct ctggcttgcg acatcgctct gccgtgcgct 960
acccagaacg aactgaacgc tgacgacgct cgtaccctgc tgcgtaacgg ttgcatctgc 1020
gttgctgaag gtgctaacat gccgaccacc ctggacgctg ttgacatctt catcgaagct 1080
ggtatcctgt acgctccggg taaagcttct aacgctggtg gtgttgctgt ttctggtctg 1140
gaaatgtctc agaacgctat gcgtctgctg tggaccgctg gtgaagttga ctctaaactg 1200
caccacatca tgcagtctat ccaccacgtt tgcgttcact acggtgaaga agctgacggt 1260
cgtatcaact acgttaaagg tgctaacatc gctggtttcg ttaaagttgc tgacgctatg 1320
ctggctcagg gtgttgtt 1338
<210>5
<211>446
<212>PRT
<213>Artificial Sequence
<220>
<223>PenGluDH-V375A
<400>5
Met Ile Glu Ser Val Asp His Phe Leu Ala Arg Leu Gln Gln Arg Asp
1 5 10 15
Pro Ala Gln Pro Glu Phe His Gln Ala Val Glu Glu Val Leu Arg Ser
20 25 30
Leu Trp Pro Phe Leu Glu Gln Asn Pro His Tyr Leu Glu Ala Gly Ile
35 40 45
Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe Arg Val Ser
50 55 60
Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly Tyr Arg Ile
65 70 75 80
Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu Arg Phe His
85 90 95
Pro Ser Val Asn Leu Gly Val Leu Lys Phe Leu Ala Phe Glu Gln Val
100 105 110
Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly Lys Gly Gly
115 120 125
Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val Met Arg Phe
130 135 140
Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly Ala Asp Leu
145 150 155 160
Asp Val Pro Ala Gly Asp Ile Gly Val Gly Ala Arg Glu Ile Gly Phe
165 170 175
Leu Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr Ser Val Leu
180 185 190
Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg Pro Glu Ala
195 200 205
Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu Lys Arg Gln
210 215 220
Glu Gln Arg Ile Asp Gly Arg Arg Val Ala Ile Ser Gly Ser Gly Asn
225 230 235 240
Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly Gly Lys Val
245 250 255
Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Phe Cys Glu Ala Gly Leu
260 265 270
Thr Asp Glu Gln Trp Asp Ala Leu Met Glu Leu Lys Asn Val Lys Arg
275 280 285
Gly Arg Ile Ser Glu Leu Ala Gly Arg Phe Gly Leu Glu Phe Arg Lys
290 295 300
Gly Gln Thr Pro Trp Ser Leu Ala Cys Asp Ile Ala Leu Pro Cys Ala
305 310 315 320
Thr Gln Asn Glu Leu Asn Ala Asp Asp Ala Arg Thr Leu Leu Arg Asn
325 330 335
Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr Thr Leu Asp
340 345 350
Ala Val Asp Ile Phe Ile Glu Ala Gly Ile Leu Tyr Ala Pro Gly Lys
355 360 365
Ala Ser Asn Ala Gly Gly Ala Ala Val Ser Gly Leu Glu Met Ser Gln
370 375 380
Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp Ser Lys Leu
385 390 395 400
His His Ile Met Gln Ser Ile His His Val Cys Val His Tyr Gly Glu
405 410 415
Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn Ile Ala Gly
420 425 430
Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val Val
435 440 445
<210>6
<211>1338
<212>DNA
<213>Artificial Sequence
<220>
<223>PenGluDH-V375A
<400>6
atgatcgaat ctgttgacca cttcctggct cgtctgcagc agcgtgaccc ggctcagccg 60
gaattccacc aggctgttga agaagttctg cgttctctgt ggccgttcct ggaacagaac 120
ccgcactacc tggaagctgg tatcctggaa cgtatggttg aaccggaacg tgctgttctg 180
ttccgtgttt cttgggttga cgaccagggt aaagttcagg ttaaccgtgg ttaccgtatc 240
cagatgtctt ctgctatcgg tccgtacaaa ggtggtctgc gtttccaccc gtctgttaac 300
ctgggtgttc tgaaattcct ggctttcgaa caggttttca aaaactctct gacctctctg 360
ccgatgggtg gtggtaaagg tggttctgac ttcgacccga aaggtaaatc tgacgctgaa 420
gttatgcgtt tctgccaggc tttcatgtct gaactgtacc gtcacatcgg tgctgacctg 480
gacgttccgg ctggtgacat cggtgttggt gctcgtgaaa tcggtttcct gttcggtcag 540
tacaaacgtc tggctaacca gttcacctct gttctgaccg gtaaaggtat gacctacggt 600
ggttctctga tccgtccgga agctaccggt tacggttgcg tttacttcgc tgaagaaatg 660
ctgaaacgtc aggaacagcg tatcgacggt cgtcgtgttg ctatctctgg ttctggtaac 720
gttgctcagt acgctgctcg taaagttatg gacctgggtg gtaaagttat ctctctgtct 780
gactctgaag gtaccctgtt ctgcgaagct ggtctgaccg acgaacagtg ggacgctctg 840
atggaactga aaaacgttaa acgtggtcgt atctctgaac tggctggtcg tttcggtctg 900
gaattccgta aaggtcagac cccgtggtct ctggcttgcg acatcgctct gccgtgcgct 960
acccagaacg aactgaacgc tgacgacgct cgtaccctgc tgcgtaacgg ttgcatctgc 1020
gttgctgaag gtgctaacat gccgaccacc ctggacgctg ttgacatctt catcgaagct 1080
ggtatcctgt acgctccggg taaagcttct aacgctggtg gtgctgctgt ttctggtctg 1140
gaaatgtctc agaacgctat gcgtctgctg tggaccgctg gtgaagttga ctctaaactg 1200
caccacatca tgcagtctat ccaccacgtt tgcgttcact acggtgaaga agctgacggt 1260
cgtatcaact acgttaaagg tgctaacatc gctggtttcg ttaaagttgc tgacgctatg 1320
ctggctcagg gtgttgtt 1338
<210>7
<211>446
<212>PRT
<213>Artificial Sequence
<220>
<223>PenGluDH-A164G-V375S
<400>7
Met Ile Glu Ser Val Asp His Phe Leu Ala Arg Leu Gln Gln Arg Asp
1 5 10 15
Pro Ala Gln Pro Glu Phe His Gln Ala Val Glu Glu Val Leu Arg Ser
20 25 30
Leu Trp Pro Phe Leu Glu Gln Asn Pro His Tyr Leu Glu Ala Gly Ile
35 40 45
Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe Arg Val Ser
50 55 60
Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly Tyr Arg Ile
65 70 75 80
Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu Arg Phe His
85 90 95
Pro Ser Val Asn Leu Gly Val Leu Lys Phe Leu Ala Phe Glu Gln Val
100 105 110
Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly Lys Gly Gly
115 120 125
Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val Met Arg Phe
130 135 140
Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly Ala Asp Leu
145 150 155 160
Asp Val Pro Gly Gly Asp Ile Gly Val Gly Ala Arg Glu Ile Gly Phe
165 170 175
Leu Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr Ser Val Leu
180 185 190
Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg Pro Glu Ala
195 200 205
Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu Lys Arg Gln
210 215 220
Glu Gln Arg Ile Asp Gly Arg Arg Val Ala Ile Ser Gly Ser Gly Asn
225 230 235 240
Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly Gly Lys Val
245 250 255
Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Phe Cys Glu Ala Gly Leu
260 265 270
Thr Asp Glu Gln Trp Asp Ala Leu Met Glu Leu Lys Asn Val Lys Arg
275 280 285
Gly Arg Ile Ser Glu Leu Ala Gly Arg Phe Gly Leu Glu Phe Arg Lys
290 295 300
Gly Gln Thr Pro Trp Ser Leu Ala Cys Asp Ile Ala Leu Pro Cys Ala
305 310 315 320
Thr Gln Asn Glu Leu Asn Ala Asp Asp Ala Arg Thr Leu Leu Arg Asn
325 330 335
Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr Thr Leu Asp
340 345 350
Ala Val Asp Ile Phe Ile Glu Ala Gly Ile Leu Tyr Ala Pro Gly Lys
355 360 365
Ala Ser Asn Ala Gly Gly Ser Ala Val Ser Gly Leu Glu Met Ser Gln
370 375 380
Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp Ser Lys Leu
385 390 395 400
His His Ile Met Gln Ser Ile His His Val Cys Val His Tyr Gly Glu
405 410 415
Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn Ile Ala Gly
420 425 430
Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val Val
435 440 445
<210>8
<211>1338
<212>DNA
<213>Artificial Sequence
<220>
<223>PenGluDH-A164G-V375S
<400>8
atgatcgaat ctgttgacca cttcctggct cgtctgcagc agcgtgaccc ggctcagccg 60
gaattccacc aggctgttga agaagttctg cgttctctgt ggccgttcct ggaacagaac 120
ccgcactacctggaagctgg tatcctggaa cgtatggttg aaccggaacg tgctgttctg 180
ttccgtgttt cttgggttga cgaccagggt aaagttcagg ttaaccgtgg ttaccgtatc 240
cagatgtctt ctgctatcgg tccgtacaaa ggtggtctgc gtttccaccc gtctgttaac 300
ctgggtgttc tgaaattcct ggctttcgaa caggttttca aaaactctct gacctctctg 360
ccgatgggtg gtggtaaagg tggttctgac ttcgacccga aaggtaaatc tgacgctgaa 420
gttatgcgtt tctgccaggc tttcatgtct gaactgtacc gtcacatcgg tgctgacctg 480
gacgttccgg gtggtgacat cggtgttggt gctcgtgaaa tcggtttcct gttcggtcag 540
tacaaacgtc tggctaacca gttcacctct gttctgaccg gtaaaggtat gacctacggt 600
ggttctctga tccgtccgga agctaccggt tacggttgcg tttacttcgc tgaagaaatg 660
ctgaaacgtc aggaacagcg tatcgacggt cgtcgtgttg ctatctctgg ttctggtaac 720
gttgctcagt acgctgctcg taaagttatg gacctgggtg gtaaagttat ctctctgtct 780
gactctgaag gtaccctgtt ctgcgaagct ggtctgaccg acgaacagtg ggacgctctg 840
atggaactga aaaacgttaa acgtggtcgt atctctgaac tggctggtcg tttcggtctg 900
gaattccgta aaggtcagac cccgtggtct ctggcttgcg acatcgctct gccgtgcgct 960
acccagaacg aactgaacgc tgacgacgct cgtaccctgc tgcgtaacgg ttgcatctgc 1020
gttgctgaag gtgctaacat gccgaccacc ctggacgctg ttgacatctt catcgaagct 1080
ggtatcctgt acgctccggg taaagcttct aacgctggtg gttctgctgt ttctggtctg 1140
gaaatgtctc agaacgctat gcgtctgctg tggaccgctg gtgaagttga ctctaaactg 1200
caccacatca tgcagtctat ccaccacgtt tgcgttcact acggtgaaga agctgacggt 1260
cgtatcaact acgttaaagg tgctaacatc gctggtttcg ttaaagttgc tgacgctatg 1320
ctggctcagg gtgttgtt 1338
<210>9
<211>446
<212>PRT
<213>Artificial Sequence
<220>
<223>PenGluDH-A164G-V375A
<400>9
Met Ile Glu Ser Val Asp His Phe Leu Ala Arg Leu Gln Gln Arg Asp
1 5 10 15
Pro Ala Gln Pro Glu Phe His Gln Ala Val Glu Glu Val Leu Arg Ser
20 25 30
Leu Trp Pro Phe Leu Glu Gln Asn Pro His Tyr Leu Glu Ala Gly Ile
35 40 45
Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe Arg Val Ser
50 55 60
Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly Tyr Arg Ile
65 70 75 80
Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu Arg Phe His
85 90 95
Pro Ser Val Asn Leu Gly Val Leu Lys Phe Leu Ala Phe Glu Gln Val
100 105110
Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly Lys Gly Gly
115 120 125
Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val Met Arg Phe
130 135 140
Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly Ala Asp Leu
145 150 155 160
Asp Val Pro Gly Gly Asp Ile Gly Val Gly Ala Arg Glu Ile Gly Phe
165 170 175
Leu Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr Ser Val Leu
180 185 190
Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg Pro Glu Ala
195 200 205
Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu Lys Arg Gln
210 215 220
Glu Gln Arg Ile Asp Gly Arg Arg Val Ala Ile Ser Gly Ser Gly Asn
225 230 235 240
Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly Gly Lys Val
245 250 255
Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Phe Cys Glu Ala Gly Leu
260 265270
Thr Asp Glu Gln Trp Asp Ala Leu Met Glu Leu Lys Asn Val Lys Arg
275 280 285
Gly Arg Ile Ser Glu Leu Ala Gly Arg Phe Gly Leu Glu Phe Arg Lys
290 295 300
Gly Gln Thr Pro Trp Ser Leu Ala Cys Asp Ile Ala Leu Pro Cys Ala
305 310 315 320
Thr Gln Asn Glu Leu Asn Ala Asp Asp Ala Arg Thr Leu Leu Arg Asn
325 330 335
Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr Thr Leu Asp
340 345 350
Ala Val Asp Ile Phe Ile Glu Ala Gly Ile Leu Tyr Ala Pro Gly Lys
355 360 365
Ala Ser Asn Ala Gly Gly Ala Ala Val Ser Gly Leu Glu Met Ser Gln
370 375 380
Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp Ser Lys Leu
385 390 395 400
His His Ile Met Gln Ser Ile His His Val Cys Val His Tyr Gly Glu
405 410 415
Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn Ile Ala Gly
420 425430
Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val Val
435 440 445
<210>10
<211>1338
<212>DNA
<213>Artificial Sequence
<220>
<223>PenGluDH-A164G-V375A
<400>10
atgatcgaat ctgttgacca cttcctggct cgtctgcagc agcgtgaccc ggctcagccg 60
gaattccacc aggctgttga agaagttctg cgttctctgt ggccgttcct ggaacagaac 120
ccgcactacc tggaagctgg tatcctggaa cgtatggttg aaccggaacg tgctgttctg 180
ttccgtgttt cttgggttga cgaccagggt aaagttcagg ttaaccgtgg ttaccgtatc 240
cagatgtctt ctgctatcgg tccgtacaaa ggtggtctgc gtttccaccc gtctgttaac 300
ctgggtgttc tgaaattcct ggctttcgaa caggttttca aaaactctct gacctctctg 360
ccgatgggtg gtggtaaagg tggttctgac ttcgacccga aaggtaaatc tgacgctgaa 420
gttatgcgtt tctgccaggc tttcatgtct gaactgtacc gtcacatcgg tgctgacctg 480
gacgttccgg gtggtgacat cggtgttggt gctcgtgaaa tcggtttcct gttcggtcag 540
tacaaacgtc tggctaacca gttcacctct gttctgaccg gtaaaggtat gacctacggt 600
ggttctctga tccgtccgga agctaccggt tacggttgcg tttacttcgc tgaagaaatg 660
ctgaaacgtc aggaacagcg tatcgacggt cgtcgtgttg ctatctctgg ttctggtaac 720
gttgctcagt acgctgctcg taaagttatggacctgggtg gtaaagttat ctctctgtct 780
gactctgaag gtaccctgtt ctgcgaagct ggtctgaccg acgaacagtg ggacgctctg 840
atggaactga aaaacgttaa acgtggtcgt atctctgaac tggctggtcg tttcggtctg 900
gaattccgta aaggtcagac cccgtggtct ctggcttgcg acatcgctct gccgtgcgct 960
acccagaacg aactgaacgc tgacgacgct cgtaccctgc tgcgtaacgg ttgcatctgc 1020
gttgctgaag gtgctaacat gccgaccacc ctggacgctg ttgacatctt catcgaagct 1080
ggtatcctgt acgctccggg taaagcttct aacgctggtg gtgctgctgt ttctggtctg 1140
gaaatgtctc agaacgctat gcgtctgctg tggaccgctg gtgaagttga ctctaaactg 1200
caccacatca tgcagtctat ccaccacgtt tgcgttcact acggtgaaga agctgacggt 1260
cgtatcaact acgttaaagg tgctaacatc gctggtttcg ttaaagttgc tgacgctatg 1320
ctggctcagg gtgttgtt 1338
<210>11
<211>449
<212>PRT
<213>Pseudomonas putida
<400>11
Met Ser Thr Met Ile Glu Ser Val Asp Asn Phe Leu Ala Arg Leu Lys
1 5 10 15
Gln Arg Asp Pro Gly Gln Pro Glu Phe His Gln Ala Val Glu Glu Val
20 25 30
Leu Arg Thr Leu Trp Pro Phe Leu Glu Ala Asn Pro His Tyr Leu Gln
35 40 45
Ser Gly Ile Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe
50 55 60
Arg Val Ser Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly
65 70 75 80
Tyr Arg Ile Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu
85 90 95
Arg Phe His Pro Ser Val Asn Leu Ser Val Leu Lys Phe Leu Ala Phe
100 105 110
Glu Gln Val Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly
115 120 125
Lys Gly Gly Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val
130 135 140
Met Arg Phe Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly
145 150 155 160
Ala Asp Cys Asp Val Pro Ala Gly Asp Ile Gly Val Gly Ala Arg Glu
165 170 175
Ile Gly Phe Met Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr
180 185 190
Ser Val Leu Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg
195 200 205
Pro Glu Ala Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu
210 215 220
Lys Arg Gln Asp Lys Arg Ile Asp Gly Arg Arg Val Ala Val Ser Gly
225 230 235 240
Ser Gly Asn Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly
245 250 255
Gly Lys Val Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Tyr Ala Glu
260 265 270
Ala Gly Leu Thr Asp Ala Gln Trp Asp Ala Leu Met Glu Leu Lys Asn
275 280 285
Val Lys Arg Gly Arg Ile Ser Glu Leu Ala Gly Gln Phe Gly Leu Glu
290 295 300
Phe Arg Lys Gly Gln Thr Pro Trp Ser Leu Pro Cys Asp Ile Ala Leu
305 310 315 320
Pro Cys Ala Thr Gln Asn Glu Leu Gly Ala Glu Asp Ala Arg Thr Leu
325 330 335
Leu Arg Asn Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr
340 345 350
Thr Leu Glu Ala Val Asp Ile Phe Leu Asp Ala Gly Ile Leu Tyr Ala
355 360 365
Pro Gly Lys Ala Ser Asn Ala Gly Gly Val Ala Val Ser Gly Leu Glu
370 375 380
Met Ser Gln Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp
385 390 395 400
Ser Lys Leu His Asn Ile Met Gln Ser Ile His His Ala Cys Val His
405 410 415
Tyr Gly Glu Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn
420 425 430
Ile Ala Gly Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val
435 440 445
Val
<210>12
<211>1347
<212>DNA
<213>Pseudomonas putida
<400>12
atgtctacca tgatcgaatc tgttgacaac ttcctggctc gtctgaaaca gcgtgacccg 60
ggtcagccgg aattccacca ggctgttgaa gaagttctgc gtaccctgtg gccgttcctg 120
gaagctaacc cgcactacct gcagtctggt atcctggaac gtatggttga accggaacgt 180
gctgttctgt tccgtgtttc ttgggttgac gaccagggta aagttcaggt taaccgtggt 240
taccgtatcc agatgtcttc tgctatcggt ccgtacaaag gtggtctgcg tttccacccg 300
tctgttaacc tgtctgttct gaaattcctg gctttcgaac aggttttcaa aaactctctg 360
acctctctgc cgatgggtgg tggtaaaggt ggttctgact tcgacccgaa aggtaaatct 420
gacgctgaag ttatgcgttt ctgccaggct ttcatgtctg aactgtaccg tcacatcggt 480
gctgactgcg acgttccggc tggtgacatc ggtgttggtg ctcgtgaaat cggtttcatg 540
ttcggtcagt acaaacgtct ggctaaccag ttcacctctg ttctgaccgg taaaggtatg 600
acctacggtg gttctctgat ccgtccggaa gctaccggtt acggttgcgt ttacttcgct 660
gaagaaatgc tgaaacgtca ggacaaacgt atcgacggtc gtcgtgttgc tgtttctggt 720
tctggtaacg ttgctcagta cgctgctcgt aaagttatgg acctgggtgg taaagttatc 780
tctctgtctg actctgaagg taccctgtac gctgaagctg gtctgaccga cgctcagtgg 840
gacgctctga tggaactgaa aaacgttaaa cgtggtcgta tctctgaact ggctggtcag 900
ttcggtctgg aattccgtaa aggtcagacc ccgtggtctc tgccgtgcga catcgctctg 960
ccgtgcgcta cccagaacga actgggtgct gaagacgctc gtaccctgct gcgtaacggt 1020
tgcatctgcg ttgctgaagg tgctaacatg ccgaccaccc tggaagctgt tgacatcttc 1080
ctggacgctg gtatcctgta cgctccgggt aaagcttcta acgctggtgg tgttgctgtt 1140
tctggtctgg aaatgtctca gaacgctatg cgtctgctgt ggaccgctgg tgaagttgac 1200
tctaaactgc acaacatcat gcagtctatc caccacgctt gcgttcacta cggtgaagaa 1260
gctgacggtc gtatcaacta cgttaaaggt gctaacatcg ctggtttcgt taaagttgct 1320
gacgctatgc tggctcaggg tgttgtt 1347
<210>13
<211>449
<212>PRT
<213>Artificial Sequence
<220>
<223>PpGluDH-A167G
<400>13
Met Ser Thr Met Ile Glu Ser Val Asp Asn Phe Leu Ala Arg Leu Lys
1 5 10 15
Gln Arg Asp Pro Gly Gln Pro Glu Phe His Gln Ala Val Glu Glu Val
20 25 30
Leu Arg Thr Leu Trp Pro Phe Leu Glu Ala Asn Pro His Tyr Leu Gln
35 40 45
Ser Gly Ile Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe
50 55 60
Arg Val Ser Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly
65 70 75 80
Tyr Arg Ile Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu
85 90 95
Arg Phe His Pro Ser Val Asn Leu Ser Val Leu Lys Phe Leu Ala Phe
100 105 110
Glu Gln Val Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly
115 120 125
Lys Gly Gly Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val
130 135 140
Met Arg Phe Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly
145 150 155 160
Ala Asp Cys Asp Val Pro Gly Gly Asp Ile Gly Val Gly Ala Arg Glu
165 170 175
Ile Gly Phe Met Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr
180 185 190
Ser Val Leu Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg
195 200 205
Pro Glu Ala Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu
210 215 220
Lys Arg Gln Asp Lys Arg Ile Asp Gly Arg Arg Val Ala Val Ser Gly
225 230 235 240
Ser Gly Asn Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly
245 250 255
Gly Lys Val Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Tyr Ala Glu
260 265 270
Ala Gly Leu Thr Asp Ala Gln Trp Asp Ala Leu Met Glu Leu Lys Asn
275 280 285
Val Lys Arg Gly Arg Ile Ser Glu Leu Ala Gly Gln Phe Gly Leu Glu
290 295 300
Phe Arg Lys Gly Gln Thr Pro Trp Ser Leu Pro Cys Asp Ile Ala Leu
305 310 315 320
Pro Cys Ala Thr Gln Asn Glu Leu Gly Ala Glu Asp Ala Arg Thr Leu
325 330 335
Leu Arg Asn Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr
340 345 350
Thr Leu Glu Ala Val Asp Ile Phe Leu Asp Ala Gly Ile Leu Tyr Ala
355 360 365
Pro Gly Lys Ala Ser Asn Ala Gly Gly Val Ala Val Ser Gly Leu Glu
370 375 380
Met Ser Gln Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp
385 390 395 400
Ser Lys Leu His Asn Ile Met Gln Ser Ile His His Ala Cys Val His
405 410 415
Tyr Gly Glu Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn
420 425 430
Ile Ala Gly Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val
435 440 445
Val
<210>14
<211>1347
<212>DNA
<213>Artificial Sequence
<220>
<223>PpGluDH-A167G
<400>14
atgtctacca tgatcgaatc tgttgacaac ttcctggctc gtctgaaaca gcgtgacccg 60
ggtcagccgg aattccacca ggctgttgaa gaagttctgc gtaccctgtg gccgttcctg 120
gaagctaacc cgcactacct gcagtctggt atcctggaac gtatggttga accggaacgt 180
gctgttctgt tccgtgtttc ttgggttgac gaccagggta aagttcaggt taaccgtggt 240
taccgtatcc agatgtcttc tgctatcggt ccgtacaaag gtggtctgcg tttccacccg 300
tctgttaacc tgtctgttct gaaattcctg gctttcgaac aggttttcaa aaactctctg 360
acctctctgc cgatgggtgg tggtaaaggt ggttctgact tcgacccgaa aggtaaatct 420
gacgctgaag ttatgcgttt ctgccaggct ttcatgtctg aactgtaccg tcacatcggt 480
gctgactgcg acgttccggg tggtgacatc ggtgttggtg ctcgtgaaat cggtttcatg 540
ttcggtcagt acaaacgtct ggctaaccag ttcacctctg ttctgaccgg taaaggtatg 600
acctacggtg gttctctgat ccgtccggaa gctaccggtt acggttgcgt ttacttcgct 660
gaagaaatgc tgaaacgtca ggacaaacgt atcgacggtc gtcgtgttgc tgtttctggt 720
tctggtaacg ttgctcagta cgctgctcgt aaagttatgg acctgggtgg taaagttatc 780
tctctgtctg actctgaagg taccctgtac gctgaagctg gtctgaccga cgctcagtgg 840
gacgctctga tggaactgaa aaacgttaaa cgtggtcgta tctctgaact ggctggtcag 900
ttcggtctgg aattccgtaa aggtcagacc ccgtggtctc tgccgtgcga catcgctctg 960
ccgtgcgcta cccagaacga actgggtgct gaagacgctc gtaccctgct gcgtaacggt 1020
tgcatctgcg ttgctgaagg tgctaacatg ccgaccaccc tggaagctgt tgacatcttc 1080
ctggacgctg gtatcctgta cgctccgggt aaagcttcta acgctggtgg tgttgctgtt 1140
tctggtctgg aaatgtctca gaacgctatg cgtctgctgt ggaccgctgg tgaagttgac 1200
tctaaactgc acaacatcat gcagtctatc caccacgctt gcgttcacta cggtgaagaa 1260
gctgacggtc gtatcaacta cgttaaaggt gctaacatcg ctggtttcgt taaagttgct 1320
gacgctatgc tggctcaggg tgttgtt 1347
<210>15
<211>449
<212>PRT
<213>Artificial Sequence
<220>
<223>PpGluDH-V378A
<400>15
Met Ser Thr Met Ile Glu Ser Val Asp Asn Phe Leu Ala Arg Leu Lys
1 5 10 15
Gln Arg Asp Pro Gly Gln Pro Glu Phe His Gln Ala Val Glu Glu Val
20 25 30
Leu Arg Thr Leu Trp Pro Phe Leu Glu Ala Asn Pro His Tyr Leu Gln
35 40 45
Ser Gly Ile Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe
50 55 60
Arg Val Ser Trp Val Asp Asp GlnGly Lys Val Gln Val Asn Arg Gly
65 70 75 80
Tyr Arg Ile Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu
85 90 95
Arg Phe His Pro Ser Val Asn Leu Ser Val Leu Lys Phe Leu Ala Phe
100 105 110
Glu Gln Val Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly
115 120 125
Lys Gly Gly Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val
130 135 140
Met Arg Phe Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly
145 150 155 160
Ala Asp Cys Asp Val Pro Ala Gly Asp Ile Gly Val Gly Ala Arg Glu
165 170 175
Ile Gly Phe Met Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr
180 185 190
Ser Val Leu Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg
195 200 205
Pro Glu Ala Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu
210 215 220
Lys Arg Gln Asp Lys Arg Ile Asp Gly Arg Arg Val Ala Val Ser Gly
225 230 235 240
Ser Gly Asn Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly
245 250 255
Gly Lys Val Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Tyr Ala Glu
260 265 270
Ala Gly Leu Thr Asp Ala Gln Trp Asp Ala Leu Met Glu Leu Lys Asn
275 280 285
Val Lys Arg Gly Arg Ile Ser Glu Leu Ala Gly Gln Phe Gly Leu Glu
290 295 300
Phe Arg Lys Gly Gln Thr Pro Trp Ser Leu Pro Cys Asp Ile Ala Leu
305 310 315 320
Pro Cys Ala Thr Gln Asn Glu Leu Gly Ala Glu Asp Ala Arg Thr Leu
325 330 335
Leu Arg Asn Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr
340 345 350
Thr Leu Glu Ala Val Asp Ile Phe Leu Asp Ala Gly Ile Leu Tyr Ala
355 360 365
Pro Gly Lys Ala Ser Asn Ala Gly Gly Ala Ala Val Ser Gly Leu Glu
370 375 380
Met Ser Gln Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp
385 390 395 400
Ser Lys Leu His Asn Ile Met Gln Ser Ile His His Ala Cys Val His
405 410 415
Tyr Gly Glu Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn
420 425 430
Ile Ala Gly Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val
435 440 445
Val
<210>16
<211>1347
<212>DNA
<213>Artificial Sequence
<220>
<223>PpGluDH-V378A
<400>16
atgtctacca tgatcgaatc tgttgacaac ttcctggctc gtctgaaaca gcgtgacccg 60
ggtcagccgg aattccacca ggctgttgaa gaagttctgc gtaccctgtg gccgttcctg 120
gaagctaacc cgcactacct gcagtctggt atcctggaac gtatggttga accggaacgt 180
gctgttctgt tccgtgtttc ttgggttgac gaccagggta aagttcaggt taaccgtggt 240
taccgtatcc agatgtcttc tgctatcggt ccgtacaaag gtggtctgcg tttccacccg 300
tctgttaacc tgtctgttct gaaattcctg gctttcgaac aggttttcaa aaactctctg 360
acctctctgc cgatgggtgg tggtaaaggt ggttctgact tcgacccgaa aggtaaatct 420
gacgctgaag ttatgcgttt ctgccaggct ttcatgtctg aactgtaccg tcacatcggt 480
gctgactgcg acgttccggc tggtgacatc ggtgttggtg ctcgtgaaat cggtttcatg 540
ttcggtcagt acaaacgtct ggctaaccag ttcacctctg ttctgaccgg taaaggtatg 600
acctacggtg gttctctgat ccgtccggaa gctaccggtt acggttgcgt ttacttcgct 660
gaagaaatgc tgaaacgtca ggacaaacgt atcgacggtc gtcgtgttgc tgtttctggt 720
tctggtaacg ttgctcagta cgctgctcgt aaagttatgg acctgggtgg taaagttatc 780
tctctgtctg actctgaagg taccctgtac gctgaagctg gtctgaccga cgctcagtgg 840
gacgctctga tggaactgaa aaacgttaaa cgtggtcgta tctctgaact ggctggtcag 900
ttcggtctgg aattccgtaa aggtcagacc ccgtggtctc tgccgtgcga catcgctctg 960
ccgtgcgcta cccagaacga actgggtgct gaagacgctc gtaccctgct gcgtaacggt 1020
tgcatctgcg ttgctgaagg tgctaacatg ccgaccaccc tggaagctgt tgacatcttc 1080
ctggacgctg gtatcctgta cgctccgggt aaagcttcta acgctggtgg tgctgctgtt 1140
tctggtctgg aaatgtctca gaacgctatg cgtctgctgt ggaccgctgg tgaagttgac 1200
tctaaactgc acaacatcat gcagtctatc caccacgctt gcgttcacta cggtgaagaa 1260
gctgacggtc gtatcaacta cgttaaaggt gctaacatcg ctggtttcgt taaagttgct 1320
gacgctatgc tggctcaggg tgttgtt 1347
<210>17
<211>449
<212>PRT
<213>Artificial Sequence
<220>
<223>PpGluDH-A167G-V378A
<400>17
Met Ser Thr Met Ile Glu Ser Val Asp Asn Phe Leu Ala Arg Leu Lys
1 5 10 15
Gln Arg Asp Pro Gly Gln Pro Glu Phe His Gln Ala Val Glu Glu Val
20 25 30
Leu Arg Thr Leu Trp Pro Phe Leu Glu Ala Asn Pro His Tyr Leu Gln
35 40 45
Ser Gly Ile Leu Glu Arg Met Val Glu Pro Glu Arg Ala Val Leu Phe
50 55 60
Arg Val Ser Trp Val Asp Asp Gln Gly Lys Val Gln Val Asn Arg Gly
65 70 75 80
Tyr Arg Ile Gln Met Ser Ser Ala Ile Gly Pro Tyr Lys Gly Gly Leu
85 90 95
Arg Phe His Pro Ser Val Asn Leu Ser Val Leu Lys Phe Leu Ala Phe
100 105 110
Glu Gln Val Phe Lys Asn Ser Leu Thr Ser Leu Pro Met Gly Gly Gly
115 120 125
Lys Gly Gly Ser Asp Phe Asp Pro Lys Gly Lys Ser Asp Ala Glu Val
130 135 140
Met Arg Phe Cys Gln Ala Phe Met Ser Glu Leu Tyr Arg His Ile Gly
145 150 155 160
Ala Asp Cys Asp Val Pro Gly Gly Asp Ile Gly Val Gly Ala Arg Glu
165 170 175
Ile Gly Phe Met Phe Gly Gln Tyr Lys Arg Leu Ala Asn Gln Phe Thr
180 185 190
Ser Val Leu Thr Gly Lys Gly Met Thr Tyr Gly Gly Ser Leu Ile Arg
195 200 205
Pro Glu Ala Thr Gly Tyr Gly Cys Val Tyr Phe Ala Glu Glu Met Leu
210 215 220
Lys Arg Gln Asp Lys Arg Ile Asp Gly Arg Arg Val Ala Val Ser Gly
225 230 235 240
Ser Gly Asn Val Ala Gln Tyr Ala Ala Arg Lys Val Met Asp Leu Gly
245 250 255
Gly Lys Val Ile Ser Leu Ser Asp Ser Glu Gly Thr Leu Tyr Ala Glu
260 265 270
Ala Gly Leu Thr Asp Ala Gln Trp Asp Ala Leu Met Glu Leu Lys Asn
275 280 285
Val Lys Arg Gly Arg Ile Ser Glu Leu Ala Gly Gln Phe Gly Leu Glu
290 295 300
Phe Arg Lys Gly Gln Thr Pro Trp Ser Leu Pro Cys Asp Ile Ala Leu
305 310 315 320
Pro Cys Ala Thr Gln Asn Glu Leu Gly Ala Glu Asp Ala Arg Thr Leu
325 330 335
Leu Arg Asn Gly Cys Ile Cys Val Ala Glu Gly Ala Asn Met Pro Thr
340 345 350
Thr Leu Glu Ala Val Asp Ile Phe Leu Asp Ala Gly Ile Leu Tyr Ala
355 360 365
Pro Gly Lys Ala Ser Asn Ala Gly Gly Ala Ala Val Ser Gly Leu Glu
370 375 380
Met Ser Gln Asn Ala Met Arg Leu Leu Trp Thr Ala Gly Glu Val Asp
385 390 395 400
Ser Lys Leu His Asn Ile Met Gln Ser Ile His His Ala Cys Val His
405 410 415
Tyr Gly Glu Glu Ala Asp Gly Arg Ile Asn Tyr Val Lys Gly Ala Asn
420 425 430
Ile Ala Gly Phe Val Lys Val Ala Asp Ala Met Leu Ala Gln Gly Val
435 440 445
Val
<210>18
<211>1347
<212>DNA
<213>Artificial Sequence
<220>
<223>PpGluDH-A167G-V378A
<400>18
atgtctacca tgatcgaatc tgttgacaac ttcctggctc gtctgaaaca gcgtgacccg 60
ggtcagccgg aattccacca ggctgttgaa gaagttctgc gtaccctgtg gccgttcctg 120
gaagctaacc cgcactacct gcagtctggt atcctggaac gtatggttga accggaacgt 180
gctgttctgt tccgtgtttc ttgggttgac gaccagggta aagttcaggt taaccgtggt 240
taccgtatcc agatgtcttc tgctatcggt ccgtacaaag gtggtctgcg tttccacccg 300
tctgttaacc tgtctgttct gaaattcctg gctttcgaac aggttttcaa aaactctctg 360
acctctctgc cgatgggtgg tggtaaaggt ggttctgact tcgacccgaa aggtaaatct 420
gacgctgaag ttatgcgttt ctgccaggct ttcatgtctg aactgtaccg tcacatcggt 480
gctgactgcg acgttccggg tggtgacatc ggtgttggtg ctcgtgaaat cggtttcatg 540
ttcggtcagt acaaacgtct ggctaaccag ttcacctctg ttctgaccgg taaaggtatg 600
acctacggtg gttctctgat ccgtccggaa gctaccggtt acggttgcgt ttacttcgct 660
gaagaaatgc tgaaacgtca ggacaaacgt atcgacggtc gtcgtgttgc tgtttctggt 720
tctggtaacg ttgctcagta cgctgctcgt aaagttatgg acctgggtgg taaagttatc 780
tctctgtctg actctgaagg taccctgtac gctgaagctg gtctgaccga cgctcagtgg 840
gacgctctga tggaactgaa aaacgttaaa cgtggtcgta tctctgaact ggctggtcag 900
ttcggtctgg aattccgtaa aggtcagacc ccgtggtctc tgccgtgcga catcgctctg 960
ccgtgcgcta cccagaacga actgggtgct gaagacgctc gtaccctgct gcgtaacggt 1020
tgcatctgcg ttgctgaagg tgctaacatg ccgaccaccc tggaagctgt tgacatcttc 1080
ctggacgctg gtatcctgta cgctccgggt aaagcttcta acgctggtgg tgctgctgtt 1140
tctggtctgg aaatgtctca gaacgctatg cgtctgctgt ggaccgctgg tgaagttgac 1200
tctaaactgc acaacatcat gcagtctatc caccacgctt gcgttcacta cggtgaagaa 1260
gctgacggtc gtatcaacta cgttaaaggt gctaacatcg ctggtttcgt taaagttgct 1320
gacgctatgc tggctcaggg tgttgtt 1347
Claims (12)
1. An L-glutamate dehydrogenase mutant is characterized in that the amino acid sequence of the L-glutamate dehydrogenase mutant is shown as SEQ ID NO.9 in a sequence table.
2. The L-glutamate dehydrogenase mutant according to claim 1, wherein the nucleotide sequence of the L-glutamate dehydrogenase mutant is shown as SEQ ID No.10 of the sequence Listing.
3. An isolated nucleic acid encoding the L-glutamate dehydrogenase mutant according to any one of claims 1 to 2.
4. A recombinant expression vector comprising the nucleic acid of claim 3.
5. A transformant comprising the nucleic acid of claim 3 or the recombinant expression vector of claim 4.
6. A preparation method of L-glufosinate-ammonium salt is characterized by comprising the following steps: performing ammoniation reaction on 2-oxo-4- (hydroxymethyl phosphinyl) butyrate in the presence of a reaction solvent, an L-glutamate dehydrogenase mutant, an inorganic amino donor and reduced coenzyme NADPH to obtain L-glufosinate-ammonium salt; wherein the L-glutamate dehydrogenase mutant is the L-glutamate dehydrogenase mutant according to any one of claims 1 to 2.
7. The method of claim 6, further comprising the steps of: in the presence of D-amino acid oxidase, carrying out oxidation reaction on D-glufosinate ammonium salt to obtain the 2-oxo-4- (hydroxymethyl phosphinyl) butyrate;
preferably, the D-glufosinate salt exists alone or together with the L-glufosinate salt; the form of the L-glufosinate coexisting with the D-glufosinate-ammonium salt is D-enriched glufosinate-ammonium salt, L-enriched glufosinate-ammonium salt or racemic glufosinate-ammonium salt;
and/or the concentration of the D-amino acid oxidase is 0.6-6U/mL, preferably 1.8U/mL;
and/or, the oxidation reaction is carried out under aeration conditions, preferably at a rate of 0.5 to 1 VVM;
and/or, the oxidation reaction is carried out in the presence of catalase;
and/or the concentration of the D-glufosinate salt is 100-600mM, preferably 200 mM;
and/or the pH of the reaction system of the oxidation reaction is 7-9, preferably 8;
and/or the temperature of the reaction system of the oxidation reaction is 20-50 ℃, preferably 20 ℃.
8. The method according to claim 6 or 7, wherein the concentration of the mutant L-glutamate dehydrogenase is 0.05-3U/ml, such as 0.09U/ml;
and/or the concentration of the inorganic amino donor is 100-2000mM, preferably 200 mM;
and/or the concentration of the 2-oxo-4- (hydroxymethyl phosphinyl) butyrate is 100-600mM, preferably 200 mM;
and/or the mass ratio of the reduced coenzyme NADPH to the 2-oxo-4- (hydroxymethyl phosphinyl) butyrate is 1:100-1:20000, preferably 1:1000-1:15000, more preferably 1: 5000;
and/or the inorganic amino donor is one or more of ammonia gas, ammonium sulfate, ammonium chloride, diammonium hydrogen phosphate, ammonium acetate, ammonium formate and ammonium hydrogen carbonate, and the ammonia gas is preferably used in the form of ammonia water;
and/or, the reaction solvent is water;
and/or the pH of the reaction system of the ammoniation reaction is 7-9, preferably 8.5;
and/or the temperature of the reaction system of the ammoniation reaction is 20-50 ℃, preferably 37 ℃.
9. The method according to any one of claims 6 to 8, further comprising the steps of: in the presence of dehydrogenase and hydrogen donor, NADP+Carrying out reduction reaction to obtain the reduced coenzyme NADPH; preferably, the dehydrogenase is glucose dehydrogenase, alcohol dehydrogenase or formate dehydrogenase;
and/or the hydrogen donor is glucose, isopropanol or formate;
more preferably, when the dehydrogenase is alcohol dehydrogenase, the hydrogen donor is isopropanol; when the dehydrogenase is glucose dehydrogenase, the hydrogen donor is glucose; when the dehydrogenase is formate dehydrogenase, the hydrogen donor is formate.
10. The method according to claim 9, wherein the concentration of the dehydrogenase is 0.6-6U/mL, preferably 2U/mL;
and/or, the oxidized coenzyme NADP+The mass ratio of the compound to the 2-oxo-4- (hydroxymethyl phosphinyl) butyrate is 1:100 to 1:20000, preferably 1:1000 to 1:15000, more preferably 1: 5000;
and/or the concentration of the hydrogen donor is 100-1000mM, preferably 240 mM;
and/or the pH of the reaction system of the reduction reaction is 7-9, preferably 8.5;
and/or the temperature of the reaction system of the reduction reaction is 20-50 ℃, preferably 37 ℃.
11. A preparation method of L-glufosinate-ammonium is characterized by comprising the following steps:
(1) the preparation method according to any one of claims 6 to 10, wherein L-glufosinate-ammonium salt is prepared;
(2) and (2) carrying out an acidification reaction on the L-glufosinate-ammonium salt prepared in the step (1) to obtain the L-glufosinate-ammonium.
12. Use of the mutant L-glutamate dehydrogenase according to any one of claims 1 to 2 for the preparation of L-glufosinate or a salt thereof.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910434379.XA CN111019917B (en) | 2019-05-23 | 2019-05-23 | L-glutamate dehydrogenase mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910434379.XA CN111019917B (en) | 2019-05-23 | 2019-05-23 | L-glutamate dehydrogenase mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111019917A true CN111019917A (en) | 2020-04-17 |
| CN111019917B CN111019917B (en) | 2020-11-03 |
Family
ID=70203597
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910434379.XA Active CN111019917B (en) | 2019-05-23 | 2019-05-23 | L-glutamate dehydrogenase mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111019917B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112391363A (en) * | 2021-01-21 | 2021-02-23 | 凯莱英生命科学技术(天津)有限公司 | Amino acid dehydrogenase mutant and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106978453A (en) * | 2017-03-31 | 2017-07-25 | 浙江大学 | A kind of method that utilization amino acid dehydrogenase prepares L glufosinate-ammoniums |
| CN107502647A (en) * | 2017-09-15 | 2017-12-22 | 浙江大学 | A kind of method that biological enzyme deracemization prepares L glufosinate-ammoniums |
| CN108588045A (en) * | 2018-03-09 | 2018-09-28 | 浙江大学 | Glutamate dehydrogenase enzyme mutant and its application in preparing L-glufosinate-ammonium |
| CN109576236A (en) * | 2018-12-28 | 2019-04-05 | 浙江工业大学 | A kind of D-AAO mutant and its application |
| CN109609582A (en) * | 2019-01-17 | 2019-04-12 | 重庆惠健生物科技有限公司 | A kind of method that microorganism catalysis deracemization prepares L-glufosinate-ammonium |
-
2019
- 2019-05-23 CN CN201910434379.XA patent/CN111019917B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106978453A (en) * | 2017-03-31 | 2017-07-25 | 浙江大学 | A kind of method that utilization amino acid dehydrogenase prepares L glufosinate-ammoniums |
| CN107502647A (en) * | 2017-09-15 | 2017-12-22 | 浙江大学 | A kind of method that biological enzyme deracemization prepares L glufosinate-ammoniums |
| CN108588045A (en) * | 2018-03-09 | 2018-09-28 | 浙江大学 | Glutamate dehydrogenase enzyme mutant and its application in preparing L-glufosinate-ammonium |
| CN109576236A (en) * | 2018-12-28 | 2019-04-05 | 浙江工业大学 | A kind of D-AAO mutant and its application |
| CN109609582A (en) * | 2019-01-17 | 2019-04-12 | 重庆惠健生物科技有限公司 | A kind of method that microorganism catalysis deracemization prepares L-glufosinate-ammonium |
Non-Patent Citations (2)
| Title |
|---|
| XINJIAN YIN ET AL.: "Efficient reductive amination process for enantioselective synthesis of L-phosphinothricin applying engineered glutamate dehydrogenase", 《APPLIED MICROBIOLOGY AND BIOTECHNOLOGY》 * |
| XINJIAN YIN ET AL.: "Rational Molecular Engineering of Glutamate Dehydrogenases for Enhancing Asymmetric Reductive Amination of Bulky α‐Keto Acids", 《ADVANCED SYNTHESIS & CATALYSIS》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112391363A (en) * | 2021-01-21 | 2021-02-23 | 凯莱英生命科学技术(天津)有限公司 | Amino acid dehydrogenase mutant and application thereof |
| CN112391363B (en) * | 2021-01-21 | 2021-04-06 | 凯莱英生命科学技术(天津)有限公司 | Amino acid dehydrogenase mutant and application thereof |
| WO2022156042A1 (en) * | 2021-01-21 | 2022-07-28 | 凯莱英生命科学技术(天津)有限公司 | Amino acid dehydrogenase mutant and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111019917B (en) | 2020-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110343676B (en) | L-glutamate dehydrogenase mutant and application thereof | |
| TWI308594B (en) | Method for producing l-amino acid | |
| CN110184246B (en) | Glutamate dehydrogenase mutant and application thereof | |
| CN109609475A (en) | Glufosinate-ammonium dehydrogenase mutant and its application for synthesizing L-glufosinate-ammonium | |
| CN110055289B (en) | Preparation method of L-glufosinate-ammonium | |
| CN109735522B (en) | L-aspartic acid-alpha-decarboxylase mutant and application thereof | |
| CN106566823B (en) | Cloning and application of glutamate decarboxylase gene | |
| CN107075463A (en) | The biosynthesis production of acylamino acid | |
| US11905534B2 (en) | L-glutamate dehydrogenase mutant and application thereof | |
| CN110885803A (en) | Recombinant glufosinate-ammonium dehydrogenase, genetically engineered bacterium and application of recombinant glufosinate-ammonium dehydrogenase in preparation of L-glufosinate-ammonium | |
| CN107119084B (en) | Method for producing L-glufosinate-ammonium by using transaminase and ethylene synthetase | |
| CN111019917B (en) | L-glutamate dehydrogenase mutant and application thereof | |
| CN111876396B (en) | Double-coenzyme-dependent glufosinate-ammonium dehydrogenase mutant and application thereof in catalytic synthesis of L-glufosinate-ammonium | |
| CN111057687B (en) | L-glutamate dehydrogenase mutant and application thereof | |
| CN100334206C (en) | Novel dehydrogenase and gene encoding the same | |
| CN111019982A (en) | Method for preparing L-glufosinate-ammonium by using hydroxy acid dehydrogenase | |
| CN109593739A (en) | Recombinate ketone acid reduction enzyme mutant, gene, engineering bacteria and its application | |
| CN112779233B (en) | Recombinant glufosinate dehydrogenase, genetically engineered bacterium and application thereof in preparation of L-glufosinate | |
| CN109988806B (en) | Racemization method of N-acetyl-glufosinate-ammonium salt | |
| CN111909907B (en) | Aspartate oxidase mutant, engineering bacteria and application of aspartate oxidase mutant in preparation of refined glufosinate-ammonium through oxidation-reduction coupling | |
| Shi et al. | Purification, enzymatic properties of a recombinant D-hydantoinase and its dissociation by zinc ion | |
| JPWO2004055179A1 (en) | D-aminoacylase | |
| CN116555206A (en) | D-amino acid oxidase and application thereof in preparation of L-glufosinate or intermediate thereof | |
| CN115058401A (en) | Ketobetazolic acid hydroxymethyltransferase mutant, coding gene and application | |
| CN117903007A (en) | Key enzyme for spermidine biosynthesis pathway |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information |
Address after: Room 3114, Building B, 555 Dongchuan Road, Minhang District, Shanghai, 200240 Applicant after: Ecolab Biotechnology (Shanghai) Co.,Ltd. Address before: Room 3114, Building B, 555 Dongchuan Road, Minhang District, Shanghai, 200240 Applicant before: ABIOCHEM BIOTECHNOLOGY Co.,Ltd. |
|
| CB02 | Change of applicant information | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20200417 Assignee: Shanghai Qizhou ziyue Biotechnology Co.,Ltd. Assignor: Ecolab Biotechnology (Shanghai) Co.,Ltd. Contract record no.: X2021980001053 Denomination of invention: A mutant of L-glutamate dehydrogenase and its application Granted publication date: 20201103 License type: Exclusive License Record date: 20210205 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20230328 Address after: 200241 Room 0829, 2nd Floor, Jilou, No. 555, Dongchuan Road, Minhang District, Shanghai Patentee after: Shanghai Qizhou ziyue Biotechnology Co.,Ltd. Address before: Room 3114, building B, 555 Dongchuan Road, Minhang District, Shanghai 200240 Patentee before: Ecolab Biotechnology (Shanghai) Co.,Ltd. |
|
| TR01 | Transfer of patent right |