CN111004859B - Phytophthora hibernalis specific detection target Phibe _ s00001g00026.1 and application thereof - Google Patents
Phytophthora hibernalis specific detection target Phibe _ s00001g00026.1 and application thereof Download PDFInfo
- Publication number
- CN111004859B CN111004859B CN201911393216.8A CN201911393216A CN111004859B CN 111004859 B CN111004859 B CN 111004859B CN 201911393216 A CN201911393216 A CN 201911393216A CN 111004859 B CN111004859 B CN 111004859B
- Authority
- CN
- China
- Prior art keywords
- phytophthora
- hibernalis
- detection
- primer
- phibe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Abstract
The invention discloses a detection target Phibe _ s00001g00026.1 of phytophthora hibernalis, a detection primer and a detection method thereof, wherein the DNA sequence of the detection target Phibe _ s00001g00026.1 is shown as SEQ ID NO: 1, the CDS sequence is shown as SEQ ID NO:2, and the protein sequence is shown as SEQ ID NO:3, respectively. The detection primer is composed of a forward primer sequence shown as SEQ ID NO: 4, the reverse primer sequence is shown as SEQ ID NO: 5, and (b). The detection target discovered by the invention and the designed primer combination thereof have strong specificity and high sensitivity when being used for common PCR, and prove that the Phibe _ s00001g00026.1 is suitable for being used as the detection target of the phytophthora hibernalis.
Description
Technical Field
The invention belongs to the technical field of gene detection, and particularly relates to a specific detection target Phibe _ s00001g00026.1 of phytophthora hibernalis and application thereof.
Background
Phytophthora (Phytophthora), any plant once infected by it will be hijack and escape, and the damage is severe. Therefore, latin Phytophthora is described as: the destruction of plants. Phyto means a plant in the original Greek language, and phora means a destruction. More than 100 species of phytophthora (phytophthora) are formally reported, and many phytophthora have records seriously harming agricultural production safety, so that the phytophthora is a destructor of crops, seedlings and ridges are slightly lost, and serious yield loss is caused, even dead yield is caused. Therefore, the method has important significance for preventing the introduction of the foreign harmful quarantine phytophthora into China. The Chinese epidemic entrance inspection list comprises 11 kinds of phytophthora hibernalis, phytophthora syringae P.syringale, sudden oak death pathogen P.ramorum, phytophthora sojae P.sojae, phytophthora chestnut black water pathogen P.camtivora, phytophthora infestans P.erythrospeptica, phytophthora fragrans P.fragrans and rhodobacter fragrans, phytophthora brazii P.fragaragiae, phytophthora brazii P.rubi, phytophthora parasitica P.lateralis, phytophthora medica P.medicauginis and phytophthora phaseoli P.phaseoli.
The citrus is an economic fruit which likes warm and humid climate, and is planted in 138 countries (regions) all over the world, and the yield and the area of the citrus account for the first of all the fruits. China is a large citrus producing country, the citrus industry plays an important role in the development of agricultural economy in China, and from 2007, China has become the world with the largest annual citrus yield. In 1925, Phytophthora hibernalis was first found on citrus fruit in the western Australia. At present, main hosts of phytophthora hibernalis are citrus, apples, tomatoes and other plants, and fruit brown rot, branch blight and leaf blight can be caused, so that fruits are browned and rotted until the plants die. The pathogen is found on orange fruits in western australia for the first time, and is distributed in most countries of europe, such as Israel, Turkey, California of the United states, Australia, New Zealand, Brazil and the like, and orange damage is serious in Italy, grapevine and the like. In 2015, phytophthora hibernalis is captured from imported American navel oranges and grapefruits at Shanghai ports. At present, no report of the distribution of phytophthora hibernalis (P.hibernalis) exists in China.
The traditional classification and identification of phytophthora hibernalis is mainly based on morphological characteristics, pathogenicity determination, physiological and biochemical characteristics and the like. The traditional method for separating phytophthora is to separate phytophthora from soil, irrigation water and plant materials by adopting an induction and capture method. In order to improve the trapping effect, a small amount of antibiotics and bactericides can be added into the soil solution to inhibit the growth of the mixed bacteria. The plant material suitable for bait is different from phytophthora infestans, and the pine needle is suitable for trapping phytophthora infestans. The traditional method plays an important role in detecting the phytophthora hibernalis, but wastes time and labor and requires operators to have professional phytophthora separation, morphological identification knowledge and rich experience; meanwhile, the traditional classification identification method is long in time consumption, low in sensitivity, easy to be interfered by various factors such as human factors, environment factors and the like, cannot diagnose in the latent period and the early stage of disease occurrence, and is difficult to monitor and effectively control the disease occurrence in time. With the development of molecular biology, the PCR technology provides the advantages of rapidness, sensitivity and accuracy for the diagnosis of plant pathogens, and the position of the PCR technology in the identification and detection of pathogens is more and more important. In recent years, PCR detection methods for some Phytophthora have been developed. The primers designed in these methods are mainly derived from the transcribed spacer (ITS) or elicidin gene. These regions or genes are high copy in the genome and are therefore easily detected. However, more and more researches show that the ITS sequences of part of phytophthora species have small difference, and primers designed by using the sequence as a target are difficult to distinguish different species.
The specificity and sensitivity of different target sequence detection have certain difference, and the result has great difference due to different selected target sequences and different fragment sizes. The discovery of target genes with good specificity is the core of all current detection technologies. The target gene is selected to ensure that it is highly conserved across different strains within a species, while being highly variable across species. In conclusion, the development of a high-reliability specific molecular detection target and the establishment of a sensitive and accurate detection technology system based on the new target play an important role in promoting the rapid molecular detection research on phytophthora hibernalis and the early diagnosis of diseases caused by the detection of the phytophthora hibernalis.
Disclosure of Invention
Aiming at the problems of long required period, poor specificity and low sensitivity of the detection method in the prior art in the biological detection method of the phytophthora hibernalis, the number of specific detection targets is small. The invention aims to provide a novel detection target Phibe _ s00001g00026.1 of phytophthora hibernalis and a PCR detection primer composition based on the novel detection target. Another objective of the invention is to provide a PCR detection kit for the phytophthora hibernalis.
The research is based on published phytophthora genome sequences (p.cinnaomi, p.sojae, p.ramorum, p.infestans, p.capsici) and the phytophthora genome sequences obtained by the CGRB sequencing center, including whole genome sequences of 15 phytophthora syringae (p.syringae), p.hibernalis, p.nicotiana (p.nicotianae), p.vigna (p.vigna), chestnut, p.nigra (p.camtivora), p.camphora (p.cinnaomi), and p.camphora, and finds a large-scale genetic database by Blast sequence search, sequence extraction, alignment and analysis, thereby developing detection targets of phytophthora. Obtaining 1719 specific detection targets of phytophthora hibernalis in total through whole genome comparison; randomly selecting partial genes from 1719 specific genes of phytophthora hibernalis as candidate genes, and designing and screening specific primers. And verifying the designed specific primer by adopting a PCR technology. The DNA of a strain (phytophthora syringae; phytophthora parasitica; phytophthora infestans; phytophthora banksiae; phytophthora fragrans; phytophthora capsici) of a species different from that of phytophthora hibernalis and a strain of a genus different from that of the species (colletotrichum truncatum; fusarium solani; magnaporthe oryzae; rhizoctonia solani; verticillium dahlia; pythium ultimum) is selected as a template for PCR verification, and finally 1 new target gene Phibe _ s00001g.
In a first aspect, the invention provides a specific detection target Phytophthora hibernalis Phybe _ s00001g00026.1, wherein the DNA sequence of the detection target is shown as SEQ ID NO: 1, the CDS sequence is shown as SEQ ID NO. 2, and the coded protein sequence is shown as SEQ ID NO. 3.
In a second aspect, the invention provides a primer combination for detecting phytophthora hibernalis (p.hibernalis), wherein the sequence of a forward primer Phi-F is shown as SEQ ID NO: 4, the sequence of the reverse primer Phi-R is shown as SEQ ID NO: 5, respectively. Meanwhile, the invention also provides application of the primer combination in detection of phytophthora hibernalis (P.hibernalis).
In a third aspect, the invention provides a kit for detecting phytophthora hibernalis (p. hibernalis), which at least comprises more than 1 dosage of detection solution containing the primer combination.
Alternatively, the detection solution comprises 20. mu.M primer combination, 2000. mu.M each of 4 dNTPs, 100. mu.L of 10 × PCR reaction buffer, 80mM Mg2+100 μ L of 1% BSA, 50 units Taq enzyme.
The invention also provides application of the kit in detection of phytophthora hibernalis (P.hibernalis).
In a fourth aspect, the present invention also provides a method for detecting phytophthora hibernalis (p.hibernalis), comprising the steps of: taking 1 mu L of DNA solution of a detection object, adding 23 mu L of the detection solution and 1 mu L of sterilized deionized water, wherein the total volume is 25 mu L; the PCR amplification procedure is 94 ℃ denaturation for 5 minutes and 94 ℃ denaturation for 1 minute; annealing at 60 ℃ for 30 seconds; extension at 72 ℃ for 1 min; 35 cycles, and a final extension at 72 ℃ for 7 minutes.
Compared with the prior art, the invention has the beneficial effects that:
1) the invention discloses a high-reliability specific molecular detection target Phibe _ s00001g00026.1 for the first time, establishes a sensitive and accurate PCR detection technical system based on the new target, and plays an important role in promoting the rapid molecular detection research of phytophthora and the early diagnosis of diseases caused by the detection of phytophthora.
2) The detection method provided by the invention has high accuracy: because the traditional detection technology for the phytophthora hibernalis only determines a detection object according to morphological characteristics, the interference of human factors cannot be eliminated, morphological similar species are difficult to distinguish, and the detection accuracy is only 60-80%; according to the invention, a specific PCR primer is designed according to the sequence of a new detection target Phibe _ s00001g00026.1 detected by phytophthora hibernalis, 2 independent regions on the target sequence are specifically recognized by 2 primers in a PCR reaction, and the specificity and the sensitivity are verified, so that the discovery of the new detection target Phibe _ s00001g00026.1 is proved. By adopting the inventionThe provided detection primer combination is used for detecting 2 strains of phytophthora hibernalis strains, 22 other oomycetes and 14 pathogenic fungi, the result shows that only the detection result of the phytophthora hibernalis is positive, and meanwhile, the sensitivity of the PCR method for detecting the genome DNA of the phytophthora hibernalis is 100pg mu L through the specific experiment-1。
3) The invention provides a novel detection target discovery method and a technical platform for detecting phytophthora hibernalis, identifies pathogens at the early stage of disease infection, and can also detect the pathogens in field soil. The invention also has important significance for reducing blind use of pesticides, reducing production cost and reducing environmental pollution of the pesticides.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments will be briefly described below.
FIG. 1 is a general PCR specificity verification electrophoretogram of specific primers Phi-F/Phi-R designed based on a new detection target Phibe _ s00001g00026.1 of Phytophthora hibernalis among Phytophthora species; the specific primer upstream primer Phi-F and the specific primer downstream primer Phi-R can only specifically amplify a 395bp band from a tested winter phytophthora strain, and the rest phytophthora does not generate a target band; wherein, Phib, phytophthora hibernalis (p.hibernalis); cry, phytophthora crypthecogenica (p. cryptogea); lit, phytophthora litchi (p. litchii); pal, phytophthora palmae (p.palmivora); dre, phytophthora drechsleri (p.drechsleri); inf, phytophthora infestans (p.infestans); nic, phytophthora nicotianae (p. nicotianae); meg, phytophthora major (p. megaspora); boe, phytophthora ramie (p. boehmeriae); cap, phytophthora capsici (p.caps ci); n, negative control.
FIG. 2 is a general PCR specificity verification electrophoretogram of specific primers designed based on a new detection target Phytophthora hibernalis Phibe _ s00001g00026.1 in other oomycetes and fungi; the specific primer upstream primer Phi-F and the specific primer downstream primer Phi-R can only specifically amplify a 395bp band from a tested winter phytophthora strain, and the rest phytophthora does not generate a target band; wherein, Phib, phytophthora hibernalis (p.hibernalis); oxy, Fusarium oxysporum (Fusarium equiseti); ult, Pythium ultimum (Pythi um ultimum); equ, Fusarium equiseti (Fusarium oxysporum); tru, Colletotrichum truncatum (Colletotrichum truncatum); sol, Rhizoctonia solani (Rhizoctonia solani); gra, Fusarium graminearum (Fusarium graminearum); fuj, Fusarium lutescens (Fusarium f ujikuroi); pro, Fusarium culmorum (Fusarium fujikuroi); n: and (5) negative control.
FIG. 3 is a detection specificity verification electropherogram of other detection targets in example 3, exemplified by Phibe _ s00001g00031.1; wherein, phi is phytophthora hibernalis (p.hibernalis), Psyr is phytophthora syringae (p.syringae), Pcac is phytophthora infestans (p.cacorum), Psoj is phytophthora sojae (p.sojae), Pmpeg is phytophthora grandis (p.megaspora), Pinf is phytophthora infestans (p.infestans), Pcry is cryptophyta (p.cryptogea), Pcin is phytophthora camphora (p.cinnaomi), Pmit is phytophthora citri fusca (p.citrophthora), Pli is phytophthora litchi ((p.litchii), Pnic nicotiana (P.n icotinae), and re is phytophthora delbrueckii (p.drechleri), the detection target has no specificity among various phytophthora species as the detection target phi _ 000026.1g26.1.
FIG. 4 is a specific verification electrophoretogram of other detection primer combinations in example 3, and the results show that the detection sensitivity of the primers can only reach 1ng μ L-1。
FIG. 5 is a general PCR sensitivity verification electrophoretogram of specific primers designed based on Phytophthora hibernalis new detection target Phibe _ s00001g00026.1;
FIG. 6 is a graph showing the results of experimental inoculation and detection in example 4. Wherein FIG. 6A is a citrus fruit artificially inoculated with Phytophthora hibernalis, FIG. 6B is a citrus fruit artificially inoculated with an agar block, and FIG. 6C is a PCR electrophoretogram. PCR detection result diagram of pathogenic citrus artificially inoculated with phytophthora hibernalis. P in the PCR assay result plot, phytophthora hibernalis (P. cinnammomi); 1, artificially inoculating DNA extracted from citrus of phytophthora hibernalis; 2, artificially inoculating DNA extracted from citrus in agar blocks, N, negative control.
Detailed Description
Embodiments of the present invention will be described in detail below with reference to the accompanying drawings. The following examples are only for illustrating the technical solutions of the present invention more clearly, and therefore are only examples, and the protection scope of the present invention is not limited thereby. It is to be noted that, unless otherwise specified, technical or scientific terms used herein shall have the ordinary meaning as understood by those skilled in the art to which the invention pertains.
Example 1
1791 phytophthora hibernalis specific genes are obtained by whole genome sequence alignment, and a high-reliability specific molecule detection target Phibe _ s00001g00026.1 is developed from the genes, wherein the DNA sequence of the genes is shown as SEQ ID NO: 1, the position of the genome is scaffold 1:26758-26364(395bp), and the CDS sequence is shown as SEQ ID NO:2, the protein sequence is shown as SEQ ID NO:3, and establishing a sensitive and accurate PCR detection technical system based on the new target.
The PCR detection primer composition used by the detection technology system comprises the following components: the upstream primer Phi-F and the downstream primer Phi-R have the following sequences:
Phi-F：ATGACGCCGACACGTTGTAA(SEQ ID NO：4)
Phi-R:TCATTGGTCAGCCAATCCGA(SEQ ID NO：5)
extracting DNA of a microorganism to be detected, taking 1 mu L of DNA solution, adding the detection solution in a 23 mu L kit and 1 mu L of sterilized deionized water, wherein the total volume is 25 mu L, the PCR amplification procedure comprises denaturation at 94 ℃ for 5 minutes, denaturation at 94 ℃ for 1 minute, annealing at 60 ℃ for 30 seconds, extension at 72 ℃ for 1 minute, 35 cycles and extension at 72 ℃ for 7 minutes, wherein the 1mL of detection solution comprises 2000 mu M of 4 dNTPs, 100 mu L of 10 × PCR reaction buffer solution and 80mM Mg, and the detection solution comprises the following components of2+100 mu L of 1% B SA, 50 units of Taq enzyme (TaKaRa), and 20 mu M primer of a specific primer Phi-F/Phi-R for molecular detection of phytophthora hibernalis are added with ultrapure water to prepare 1mL of detection solution.
After the reaction, 7. mu.L of the amplified product was electrophoresed in 1.0% agarose gel for 30min (100V), detected on a gel imaging system and photographed. Each experiment was repeated at least 3 times.
Example 2
In order to verify the specific primer sequence of phytophthora hibernalis, 2 strains of phytophthora hibernalis, 22 other oomycetes and 14 pathogenic fungi are taken as test materials (table 1) in the embodiment, and the DNA of the phytophthora hibernalis in the pathogenic tissues is extracted by adopting a CTAB method. The specific method comprises the following steps: adding 900 μ L2% CTAB extractive solution and 90 μ L10% SDS into a small amount of mycelium powder, mixing, and turning upside down every 10min in 55 deg.C water bath for 1 h. Centrifuging at 12000rpm for 10min, collecting supernatant, adding equal volume of phenol/chloroform/isoamyl alcohol (25: 24: 1), mixing by inversion, and centrifuging at 12000rpm for 10 min; the supernatant was transferred to a new tube, added with an equal volume of chloroform, mixed by gentle inversion and centrifuged at 12000rpm for 5 min. The supernatant was transferred to a new tube, 2 volumes of absolute ethanol and 1/10 volumes of 3M NaAc (pH5.2) were added, and the precipitate was precipitated at-20 ℃ (>1 h). Centrifuging at 12000rpm for 10min, decanting the supernatant, washing the precipitate with 70% ethanol twice, and air drying at room temperature. Adding appropriate amount of sterilized ultrapure water or TE (pH 8.0) to dissolve precipitate (containing 20 μ g/mL RNase), treating at 37 deg.C for 1h, and storing at-20 deg.C for use.
TABLE 1 fungus and oomycete strains for PCR detection of Phytophthora hibernalis and detection results
As shown in FIGS. 1 and 2, the PCR detection results show that all the strains of P.hibernalis can specifically amplify a 395bp band, and the agarose gel electrophoresis of the rest 22 kinds of oomycetes and 14 kinds of pathogenic fungi does not show the amplified band. Selecting different species from phytophthora hibernalis (P.cryptogea), phytophthora litchi (P.litchii), phytophthora palmae (P.palmivora), phytophthora drechsleri (P.drechsleri), phytophthora infestans (P.infestans), phytophthora nicotianae (P.nicotianae), phytophthora macrostema (P.megasperma), phytophthora ramie (P.boehmeriae), phytophthora capsici (P.capsci), etc. and different species of bacteria (Fusarium oxysporum (Fusarium equiseti), Pythium ultimum (Pyrolutum ulmum), Fusarium equisetosum (Fusarium oxysporum), Colletotrichum (Collybum truncatum), Rhizoctonia solani (Rhizoctonia solani), Fusarium graminum graminearum (Fusarium roseum), Fusarium japonicum (Fusarium japonicum) and adding a DNA into a test solution with a volume of 25 mu L and a 1 mu L of deionized water; the PCR amplification procedure is 94 ℃ denaturation for 5 minutes and 94 ℃ denaturation for 1 minute; annealing at 60 ℃ for 30 seconds; extension at 72 ℃ for 1 min; 35 cycles, and a final extension at 72 ℃ for 7 minutes.
The designed specific primers, namely the upstream primer Phi-F and the downstream primer Phi-R PCR specific primers are proved to have species specificity, and the Phibe _ s00001g00026.1 is a new detection target with stronger specificity. The primer group can be used for quickly and reliably detecting and identifying the phytophthora hibernalis in production practice or entry-exit inspection and quarantine. When the method is used for extracting the DNA of the phytophthora hibernalis in the diseased tissue, the method adopts a NaOH rapid cracking method to extract the DNA of the phytophthora hibernalis, and the specific process is as follows: a section of diseased plant tissue is taken, 10 mu L of 0.5M NaOH is added into each milligram of tissue, the tissue is fully ground in a mortar and then transferred to a 1.5mL EP tube, the tissue is centrifuged at 12000rpm for 5min, 5 mu L of supernatant is taken, 495 mu L of 0.1mM Tris (pH 8.0) is added into the supernatant, and 1 mu L of supernatant is taken and directly used for PCR reaction after being mixed evenly. Each reaction was repeated at least three times, while confirming that no PCR inhibitor was present in the plants.
Example 3
Aiming at the selection of specific detection targets of phytophthora hibernalis and the design of a PCR primer group, the invention initially selects 6 targets (Phibe _ s00001g00026.1, Phibe _ s00001g00031.1, Phibe _ s00041g00025.1, Phibe _ s00041g00026.1 and Phibe _ s00041g00028.1) together, designs a plurality of pairs of qualified primers based on the 6 targets, finally screens 1 new specific detection target Phibe _ s00001g00026.1, and designs 1 group of most specific and extremely high-sensitivity primers based on the targets, namely the primer composition (the upstream primer Phi-F and the downstream primer Phi-R) used in the embodiment 1. The primers designed by the other 5 detection targets are adopted, the PCR detection result shows that the specificity is not high, taking the target Phibe _ s00001g00031.1 as an example, the actual primer sequence is as follows: Phi-31F: 5'-TCCGGGTGCTGGGAACTCCG-3' (SEQ ID NO: 6); Phi-31R: TCAGCCAGGTGGGAACATTA-3' (SEQ ID NO: 7); the strains used in example 2 were test materials (2 strains of P.hibernalis and 22 other oomycetes and 24 pathogenic fungi) and the PCR test showed poor specificity for the remaining selected primers, as shown in FIG. 3.
The remaining primers designed for detecting the target Phibe _ s00001g00026.1 using high confidence specific molecules were as follows: Phi-2F: 5'-CGTTGTAACTACATCCTGTT-3' (SEQ ID NO: 8); Phi-2R: 5'-TGGTCAGCCAATCCGACATT-3' (SEQ ID NO: 9), and using the strain used in example 2 as a test material (2 strains of P.hibernalis and 22 other oomycetes and 24 pathogenic fungi), the PCR detection results showed that the specificity of the primer was high, but the sensitivity was poor, only 1ng, and the results are shown in FIG. 4.
The invention finally screens out a high-reliability specific molecule detection target Phibe _ s00001g00026.1 and a specific primer (Phi-F/Phi-R) designed based on the target, and through sensitivity detection, a 25 mu L reaction system respectively contains 1ng, 100pg, 10pg, 1pg, 100fg, 10fg and 1fg of phytophthora hibernalis DNA; and (3) performing PCR amplification by using the genome DNA of the standard strain of the winter phytophthora with different concentrations as an amplification template, and repeating the reaction for 3 times. The results of 3 replicates were consistent and the amplification results are shown in FIG. 5. The genomic DNA concentration was 100 pg. mu.L-1In the process, PCR detection can detect a specific band, so that specific amplification is proved to occur, and the detection result is judged to be positive. And the concentration of the genomic DNA was 10 pg. mu.L-1Then, no specific band is found in the PCR product through detection, which proves that no specific amplification occurs, the detection result is judged to be negative, namely the sensitivity of the PCR method for detecting the genome DNA of the phytophthora hibernalis is 100pg mu L-1。
Example 4 PCR detection of Phytophthora hibernalis in Living tissue
The DNA of the pathogenetic pine needle inoculated with the phytophthora hibernalis is extracted by adopting an NaOH alkaline lysis method and is used as a template for PCR amplification. A PCR reaction was carried out in the same manner as in example 3 using 1uLDNA solution. The results are shown in FIG. 6, in which FIG. 6A is a citrus artificially inoculated with Phytophthora hibernalis, FIG. 6B is a citrus artificially inoculated with an agar block, and FIG. 6C is a PCR electrophoretogram. The result shows that a 395bp band can be specifically amplified by adopting a specific primer upstream primer Phi-F and a specific primer downstream primer Phi-R in the diseased citrus inoculated with the phytophthora hibernalis; while healthy citrus and negative controls had no specific amplified bands.
Unless specifically stated otherwise, the numerical values set forth in these examples do not limit the scope of the invention. In all examples shown and described herein, unless otherwise specified, any particular value should be construed as merely illustrative, and not restrictive, and thus other examples of example embodiments may have different values.
SEQUENCE LISTING
<110> Nanjing university of forestry
<120> Phytophthora hibernalis specific detection target Phibe _ s00001g00026.1 and application thereof
<130>2019
<160>9
<170>PatentIn version 3.3
<210>1
<211>395
<212>DNA
<213> Phytophthora hibernalis)
<400>1
atgacgccga cacgttgtaa ctacatcctg ttctttgatg gggggatcac gtggaaaccc 60
gagtcctgga ggtgcaagga ctgtcgttat cggcattgta ggggatgatg gcagtcacca 120
agtagtgtgg gctgccagca tgtcgtatgc ggtgatcacg actacgaaca acatatcaga 180
aaaatgggtc tattcacggg gtttaaggcg tgcgggtagc agggcttctc tccggttcat 240
atcgtggggg attgcgagat gatcatacgg cagcaccgtg cctacctgaa gccggtctac 300
tggcaatacc aaagggcgat ctcgaaagcg gcggtggtgt catggacgca tcaccttcgc 360
caatacaaca gaatgtcgga ttggctgacc aatga 395
<210>2
<211>381
<212>DNA
<213> Phytophthora hibernalis)
<400>2
atgacgccga cacgttgtaa ctacatcctg ttctttgatg gggggatcac gtggaaaccc 60
gagtcctgga ggtgcaagga ctgtcgttat cggcattggg atgatggcag tcaccaagta 120
gtgtgggctg ccagcatgtc gtatgcggtg atcacgacta cgaacaacat atcagaaaaa 180
tgggtctatt cacggggttt aaggccaggg cttctctccg gttcatatcg tgggggattg 240
cgagatgatc atacggcagc accgtgccta cctgaagccg gtctactggc aataccaaag 300
ggcgatctcg aaagcggcgg tggtgtcatg gacgcatcac cttcgccaat acaacagaat 360
gtcggattgg ctgaccaatg a 381
<210>3
<211>126
<212>PRT
<213> Phytophthora hibernalis)
<400>3
Met Thr Pro Thr Arg Cys Asn Tyr Ile Leu Phe Phe Asp Gly Gly Ile
1 5 10 15
Thr Trp Lys Pro Glu Ser Trp Arg Cys Lys Asp Cys Arg Tyr Arg His
20 25 30
Trp Asp Asp Gly Ser His Gln Val Val Trp Ala Ala Ser Met Ser Tyr
35 40 45
Ala Val Ile Thr Thr Thr Asn Asn Ile Ser Glu Lys Trp Val Tyr Ser
50 55 60
Arg Gly Leu Arg Pro Gly Leu Leu Ser Gly Ser Tyr Arg Gly Gly Leu
65 70 75 80
Arg Asp Asp His Thr Ala Ala Pro Cys Leu Pro Glu Ala Gly Leu Leu
85 90 95
Ala Ile Pro Lys Gly Asp Leu Glu Ser Gly Gly Gly Val Met Asp Ala
100 105 110
Ser Pro Ser Pro Ile Gln Gln Asn Val Gly Leu Ala Asp Gln
115 120 125
<210>4
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>4
atgacgccga cacgttgtaa 20
<210>5
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>5
tcattggtca gccaatccga 20
<210>6
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>6
tccgggtgct gggaactccg 20
<210>7
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>7
tcagccaggt gggaacatta 20
<210>8
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>8
cgttgtaact acatcctgtt 20
<210>9
<211>20
<212>DNA
<213> Artificial sequence (Artificial sequence)
<400>9
tggtcagcca atccgacatt 20
Claims (7)
1. A specific detection target Phytophthora hibernalis (Phytophthora hibernalis) Phybe _ s00001g00026.1 is characterized in that the DNA sequence of the detection target is shown as SEQ ID NO: 1 is shown.
2. A primer combination for detecting phytophthora hibernalis (P.hibernalis), which is characterized in that the sequence of a forward primer Phi-F is shown as SEQ ID NO: 4, the sequence of the reverse primer Phi-R is shown as SEQ ID NO: 5, respectively.
3. Use of the primer combination of claim 2 for the detection of phytophthora hibernalis (p.
4. A kit for detecting Phytophthora hibernalis (P.hibernalis), comprising 1 or more times of a detection solution comprising the primer combination of claim 2.
5. The kit of claim 4, wherein the detection solution comprises 20. mu.M primer combination, 2000. mu.M each of 4 dNTPs, 100. mu.L of 10 × PCR reaction buffer, 80mM Mg2+100 μ L of 1% BSA, 50 units Taq enzyme.
6. Use of the kit according to claim 4 or 5 for the detection of phytophthora hibernalis (p.
7. A method of detecting phytophthora hibernalis (p.hibernalis), comprising the steps of: adding 23 μ L of the detection solution of claim 5 and 1 μ L of sterilized deionized water to 1 μ L of the DNA solution to be detected, wherein the total volume is 25 μ L; the PCR amplification procedure is 94 ℃ denaturation for 5 minutes and 94 ℃ denaturation for 1 minute; annealing at 60 ℃ for 30 seconds; extension at 72 ℃ for 1 min; 35 cycles, and a final extension at 72 ℃ for 7 minutes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911393216.8A CN111004859B (en) | 2019-12-30 | 2019-12-30 | Phytophthora hibernalis specific detection target Phibe _ s00001g00026.1 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911393216.8A CN111004859B (en) | 2019-12-30 | 2019-12-30 | Phytophthora hibernalis specific detection target Phibe _ s00001g00026.1 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111004859A CN111004859A (en) | 2020-04-14 |
| CN111004859B true CN111004859B (en) | 2020-10-02 |
Family
ID=70118263
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911393216.8A Active CN111004859B (en) | 2019-12-30 | 2019-12-30 | Phytophthora hibernalis specific detection target Phibe _ s00001g00026.1 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111004859B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114277174B (en) * | 2021-12-28 | 2022-07-12 | 南京林业大学 | Specific detection target Psyrin _ s00001g00016.1 of citrus pathogen phytophthora syringae and application |
| CN116254260B (en) * | 2023-03-16 | 2024-02-13 | 南京林业大学 | Specific detection target g7300 of phytophthora parasitica and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103031383A (en) * | 2012-12-28 | 2013-04-10 | 中华人民共和国湖北出入境检验检疫局 | Method for detecting phytophthora hibernalis carne and sphaeropsis tumefaciens hedges |
| CN103725762A (en) * | 2012-10-11 | 2014-04-16 | 中国检验检疫科学研究院 | Primer pair and probe used for detecting phytophthora hibernalis and detection method for phytophthora hibernalis |
| EP3415006A1 (en) * | 2010-08-26 | 2018-12-19 | Adama Makhteshim Ltd | Synergistic fungicidal composition |
-
2019
- 2019-12-30 CN CN201911393216.8A patent/CN111004859B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3415006A1 (en) * | 2010-08-26 | 2018-12-19 | Adama Makhteshim Ltd | Synergistic fungicidal composition |
| CN103725762A (en) * | 2012-10-11 | 2014-04-16 | 中国检验检疫科学研究院 | Primer pair and probe used for detecting phytophthora hibernalis and detection method for phytophthora hibernalis |
| CN103031383A (en) * | 2012-12-28 | 2013-04-10 | 中华人民共和国湖北出入境检验检疫局 | Method for detecting phytophthora hibernalis carne and sphaeropsis tumefaciens hedges |
Non-Patent Citations (2)
| Title |
|---|
| A recombinase polymerase amplification-lateral flow dipstick assay for rapid detection of the quarantine citrus pathogen in China,Phytophthora hibernalis;Tingting Dai;《PEER J》;20191118;第18卷(第7期);全文 * |
| Loop-mediated isothermal amplification (LAMP) detection of Phytophthora hibernalis, P-syringae and P-cambivora;Li, GR等;《JOURNAL OF PLANT PATHOLOGY》;20190228;第101卷(第1期);全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111004859A (en) | 2020-04-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Gervais et al. | Different waves of effector genes with contrasted genomic location are expressed by Leptosphaeria maculans during cotyledon and stem colonization of oilseed rape | |
| CN102643925B (en) | Loop-mediated isothermal amplification (LAMP) primer composition for detecting phytophthora rot and application thereof | |
| Carlucci et al. | Characterization of Botryosphaeriaceae species as causal agents of trunk diseases on grapevines | |
| CN111004859B (en) | Phytophthora hibernalis specific detection target Phibe _ s00001g00026.1 and application thereof | |
| CN102676511B (en) | Detection target sequence A3apro of phytophthora sojae, and specific LAMP (loop-mediated isothermal amplification) primer composition and application thereof | |
| CN104372104B (en) | A kind of LAMP detection primer composition of camphor tree phytophthora and LAMP detection kit thereof and LAMP detection method | |
| CN113528543B (en) | Pine resin ulcer disease pathogenic bacteria detection target Fcir _ CM004512.1.g2067.t1 and application | |
| CN108676910A (en) | A kind of LAMP detection primer of fusarium prolifertum and its application | |
| Li et al. | The dual roles of zinc sulfate in mitigating peach gummosis | |
| CN106868164B (en) | Primer for detecting phytophthora camphorata and nested PCR detection method | |
| Papavasileiou et al. | Proteomic analysis upon peach fruit infection with Monilinia fructicola and M. laxa identify responses contributing to brown rot resistance | |
| CN104372099B (en) | A kind of LAMP detection primer compositionss of Phytophthora cactorum bacterium and its LAMP detection kit and LAMP detection method | |
| CN104232634B (en) | A kind of I primer pair of pine tree bee specificity SS-CO and rapid molecular detection method | |
| CN108220475A (en) | Cherry ash arrhizus bacteria detection method and detection primer special based on RPA technologies | |
| CN114457186A (en) | Specific detection target Ppini _05588 for rhododendron root rot pathogenic bacteria and application | |
| CN112322768A (en) | Method for diagnosing hippophae rhamnoides branch wilt and rapidly detecting RPA (resilient root antigen) of pathogenic bacteria | |
| CN101805796A (en) | Primer for detecting the soybean phytophthora and kit and method thereof | |
| CN114015804B (en) | Specific detection target Psyrin _ s00018g00015.1 of phytophthora syringae and application of specific detection target Psyrin _ s00018g00015.1 | |
| CN113150087B (en) | Plant immune activator protein Fg62 secreted by fusarium graminearum and application thereof | |
| CN114277174B (en) | Specific detection target Psyrin _ s00001g00016.1 of citrus pathogen phytophthora syringae and application | |
| CN111961674B (en) | Tobacco PVY early warning gene Ntab0224260 and application thereof | |
| CN109897911B (en) | LAMP (loop-mediated isothermal amplification) detection primer and detection kit for phytophthora P.hydropathica and application of LAMP detection primer and detection kit | |
| CN105274241A (en) | Molecular detection primer and quick detection method for thielaviopsis basicola | |
| CN111118038B (en) | Phytophthora hibernalis specific detection new target Phibe _ s00003g00002.1 and application thereof | |
| CN108588265A (en) | The LAMP detection primer composition and its LAMP detection kit and LAMP detection method of a kind of cloves phytophthora |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20200414 Assignee: Nanjing Guangmin Technology Co.,Ltd. Assignor: NANJING FORESTRY University Contract record no.: X2020980008844 Denomination of invention: Phibe, a specific target for detection of Phytophthora infestans_ S00001g0026.1 and its application Granted publication date: 20201002 License type: Common License Record date: 20201204 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20200414 Assignee: Rui test precision medical testing (Shanghai) Co.,Ltd. Assignor: NANJING FORESTRY University Contract record no.: X2020980009032 Denomination of invention: Phibe, a specific target for detection of Phytophthora infestans_ S00001g0026.1 and its application Granted publication date: 20201002 License type: Common License Record date: 20201210 |
|
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20200414 Assignee: Nanjing Guangxuan Biotechnology Co.,Ltd. Assignor: NANJING FORESTRY University Contract record no.: X2020980009394 Denomination of invention: Phibe, a specific target for detection of Phytophthora infestans_ S00001g0026.1 and its application Granted publication date: 20201002 License type: Common License Record date: 20201215 |