CN110982912A - Method for detecting cattle carcass and meat quality traits by using RRAD genetic marker - Google Patents
Method for detecting cattle carcass and meat quality traits by using RRAD genetic marker Download PDFInfo
- Publication number
- CN110982912A CN110982912A CN202010097319.6A CN202010097319A CN110982912A CN 110982912 A CN110982912 A CN 110982912A CN 202010097319 A CN202010097319 A CN 202010097319A CN 110982912 A CN110982912 A CN 110982912A
- Authority
- CN
- China
- Prior art keywords
- rrad
- gene
- carcass
- dna
- beef
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Analytical Chemistry (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a method for detecting beef carcass meat quality traits by utilizing RRAD gene genetic markers, in particular to a method for detecting beef carcass meat quality and meat quality molecular markers by SNPs of RRAD gene 3 'untranslated region (3' UTR) sequences, which comprises the steps of carrying out PCR amplification by taking a beef genome DNA mixed pool or individual DNA as a template, detecting by adopting a DNA sequencing method, disclosing 1 SNP1 locus, carrying out genotyping and correlation analysis results of beef carcass and meat quality traits on the basis of SNP1 of each individual, providing a molecular marker which can screen early and predict beef carcass and meat quality traits on the DNA level, and applying to the molecular breeding and early breeding of beef; the invention uses SNP1 (3' UTR 198G > A) of RRAD gene as a method for detecting beef cattle carcass and meat quality trait genetic markers, and lays a foundation for genetic breeding research, production and breeding early-stage breeding of high-quality cattle individuals and improvement of beef quality and carcass traits.
Description
Technical Field
The invention discloses a method for detecting beef carcass meat quality traits by utilizing RRAD gene genetic markers, in particular relates to a detection method by taking SNPs of a RRAD gene 3 'untranslated region (3' UTR) sequence as beef carcass meat quality and carcass trait molecular markers, and belongs to the technical field of breeding prediction and breeding beef carcass and meat quality traits.
Background
With the continuous development of animal husbandry and cattle raising industry, the breeding of high-grade high-quality beef cattle and the production of high-quality beef are concerned more and more by producers and consumers; the related traits of carcass and meat quality of beef cattle are important indexes for meat quality analysis, the improvement of meat quality traits is a research hotspot in the breeding field of cattle, and the important standard for further measuring the meat quality grade in the field of food science.
In order to accelerate the growth speed of cattle and improve the beef quality, the genetic marker of molecules is used for breeding beef cattle from the gene angle, which is a main means for researching the carcass and meat quality traits of cattle; single Nucleotide Polymorphism (SNPs) labeling technology plays an important role in the field of animal genetic breeding research as the currently most widely used genetic labeling technology. The detection methods commonly used for SNPs include direct DNA sequencing, restriction fragment length polymorphism polymerase chain reaction (RFLP-PCR), and the like. Aiming at the two methods, the current method for detecting SNPs by directly sequencing DNA is simpler, quicker and more accurate, and is suitable for detecting large-population animal samples.
The expression of RRAD in 4000 cDNA clones was identified as the only gene overexpressed in type 2 diabetic individuals compared to non-diabetic or type 1 diabetic individuals by subtractive cloning techniques, because, in cultured cardiomyocytes, overexpression of RRAD reduced insulin-stimulated glucose uptake by 50-90% due to the reduced intrinsic activity of glucose transporter 4 (insulin-dependent glucose transporter), which is found in transgenic mice overexpressing RRAD in skeletal muscle due to the increased production of insulin-stimulated glucose uptake by feeding the transgenic mice with high-fat glucose transporter 4 (insulin-dependent glucose transporter), which is also found to be resistant to the full-length glucose transporter gene, which is found to be resistant to the full-length glucose transporter gene, and to be resistant to the full-length glucose transporter gene, which is also found to be resistant to the expression of the gene of RRAD, which is found to be involved in human chromosome 16, and one of the most striking metabolic syndrome and calcium homeostasis disorder of calpons.RRAD in muscle cells, the gene encodes small GTPase directly binds calcium channel β subunit to regulate intracellular calcium signaling.RRAD by interacting with calmodulin the calponins.
Disclosure of Invention
The invention provides a method for detecting beef carcass and meat quality traits by RRAD gene molecular markers, which uses the RRAD gene markers as a method for predicting and breeding the beef carcass and meat quality traits, and lays a foundation for early breeding of genetic workers and meat quality improvement so as to further improve the economic benefit of beef cattle breeding.
The invention provides an application of RRAD gene molecular marker as beef quality and carcass traits, which is characterized in that:
the molecular marker of the gene is G/A mutation at 198bp of the 3' untranslated region (UTR) of the bovine RRAD gene, namely SNP 1: 3' UTR 198G > A.
3. The RRAD gene SNP1 as a molecular marker for detecting the beef quality trait according to claim 1 comprises the following steps:
the first step is as follows: collecting a whole blood or tissue sample of a cow to be detected, and extracting genomic DNA (deoxyribonucleic acid) by using the whole blood or tissue sample of the cow;
the second step is that: a pair of primers designed according to the sequence of the cattle RRAD gene is as follows:
RRAD-F：５’ACCCACTCACCTTTTGCTTAC３’；
RRAD-R：５’GAGTCCTCTCCCCATTCACA３’；
the third step: using the cattle genome DNA as a template, and carrying out PCR amplification by using the primer synthesized in the previous step to obtain a PCR product containing a cattle RRAD gene target fragment; and (3) PCR reaction system: 10 mu L of Taq PCR Mix, 0.5 mu L of each of the upstream primer and the downstream primer, 2 mu L of mixed pool DNA/individual DNA and 7 mu L of deionized water, and 20 mu L of the mixed pool DNA/individual DNA are fully and uniformly mixed for PCR amplification; the PCR reaction program is: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30 s, annealing at 60 deg.C for 30 s, extension at 72 deg.C for 1 min, and circulating for 35 times; extending at 72 ℃ for 10 min; storing at 4 deg.C; checking the length and quality of the PCR amplification product fragment by agarose gel electrophoresis, and keeping the PCR amplification product fragment at 4 ℃ or-20 ℃ for later use;
the fourth step: sequencing the PCR product by adopting a DNA sequencing technology, searching the position of an SNP (Single nucleotide polymorphism) site of a 3' untranslated region of an RRAD gene in a sequencing result by using sequence analysis software, carrying out genotype analysis on a detected cattle group or individual sample according to a molecular marker SNP1 of the RRAD gene, namely GG genotype, GA genotype or AA genotype, and finally evaluating and predicting the carcass and meat quality traits of cattle through the genotypes.
The invention has the positive effects that:
PCR amplification is carried out on a bovine genome DNA mixed pool or an individual DNA as a template, a DNA sequencing method is adopted for detection, 1 SNP1 locus is disclosed, and a molecular marker capable of screening and predicting bovine carcass and meat quality traits at an early stage on a DNA level is provided based on the correlation analysis result of genotyping and bovine carcass and meat quality traits carried out on the SNP1 of each individual, and is applied to molecular breeding and early breeding of cattle; the invention uses SNP1 (3' UTR 198G > A) of RRAD gene as a method for detecting beef cattle carcass and meat quality trait genetic markers, and lays a foundation for genetic breeding research, production and breeding early-stage breeding of high-quality cattle individuals and improvement of beef quality and carcass traits.
Drawings
FIG. 1 is a 1.2% agarose gel electrophoresis of the PCR product of the RRAD gene of Simmental cattle in the example of the present invention (note: 1-8 are the PCR products of part of RRAD gene; M: DL2000 Marker);
FIG. 2 is a diagram showing the sequencing detection of RRAD gene as 3' UTR 198A > G mutation sites (note: A. GA genotype; B. GG genotype).
Detailed Description
The following is a further detailed description of the invention, which is to be construed as illustrative and not restrictive.
Example 1
1. Test reagents and assay software
Agarose (bioquest); a genome blood extraction kit, 2 XTaq PCR Master mix and DNA Marker2000 were purchased from TIANGEN;
PCR primer design software: primer Premier 6.0; data analysis software: IBM SPSS standards 19.0; sequence analysis software: DNASTAR LaserGene 8.0.
2. Test method
Selecting a certain large cattle farm cattle group in the inner Mongolia Wula Gaster region by taking a Chinese Simmental cattle group as a detection object, and collecting a sample by adopting a venous blood collection mode; extracting genome DNA from blood of a Simmental cattle in China by using a TIANGEN blood genome DNA extraction kit to obtain 137 individual cattle DNA samples, and numbering the DNA samples;
extracting genome DNA, operating according to the instruction of a blood genome DNA extraction kit of TIANGEN company, and detecting the quality of the genome DNA by using 1.2% agarose gel electrophoresis, and storing the genome DNA at-80 ℃ for later use;
primer synthesis and PCR amplification
Synthesized by Jinzhi Biotechnology, Inc.; the primer sequence is as follows:
RRAD-F：５’ACCCACTCACCTTTTGCTTAC３’；
RRAD-R：５’GAGTCCTCTCCCCATTCACA３’；
PCR amplification using the synthesized RRAD gene primers:
the reaction system is a 20 mu L system, and is shown in a table 1;
table 1: and (3) PCR reaction system:
the reaction procedure is as follows: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30 s, annealing at 60 ℃ for 30 s, extension at 72 ℃ for 60 s, and 35 cycles; extending at 72 deg.C for 10 min, and storing at 4 deg.C;
sequencing analysis of PCR amplification products
Mixing PCR amplification products of different templates by adopting a Sanger sequencing technology, sequencing, checking a sequencing result peak diagram by adopting sequencing analysis software, and finding out whether G/A mutation exists at the 3' UTR 198bp position of the RRAD gene; if the mutation site exists in the population, performing PCR amplification on each bovine DNA sample respectively, wherein the reaction system and the reaction procedure are the same as those of mixed pool amplification; after DNA sequencing, the genotype of each PCR product sequencing result is analyzed, and the genotype of each cattle individual SNP1 site is determined.
Statistical analysis
The genotype data obtained by the method is counted with the meat quality and carcass traits of corresponding Chinese Simmental cattle individuals, SPSS 19.0 is adopted to carry out correlation analysis between the individual genotype and the meat quality and carcass traits,p<0.05 defined as significantly different.
3. Results
PCR products containing RRAD gene sequences with the length of 610bp are obtained through PCR amplification, the sizes of the PCR amplification products are consistent with that of expected fragments as shown by a 1.2% agarose gel electrophoresis result, and partial electrophoresis results are shown in a figure 1 and a sequence table. According to the PCR sequencing result of the RRAD product, finding out 1 SNP site SNP1 of the RRAD gene in the Simmental cattle group in China, namely the G > A mutation site existing at 198bp of 3' UTR;
through the analysis of the PCR product sequencing result of each individual cow, in the detected Simmental cattle population, the SNP1 analysis result shows that the GG wild type has 124 heads, the AG type has 13 heads, the AA type has 0 head, and the peak image results of the two genotypes are shown in a figure 2. The results of the statistical analysis of genotype and gene frequency showed that GG had a genotype frequency of 0.91, AA had a genotype frequency of 0, AG had a genotype frequency of 0.09, G allele frequency of 0.96, and C allele frequency of 0.045, and G allele predominated in the test population, with wild-type GG as the predominant genotype, and the results are shown in Table 2:
table 2: the gene and genotype frequency of RRAD gene SNP1 in the Western Meniere cattle population in China:
the correlation between the RRAD gene SNP1 and meat quality and carcass traits of Simmental cattle is verified by adopting SPSS 19.0 software, and the result shows that the correlation exists after 18 meat quality and carcass correlation traits including the SNP1 locus of the RRAD gene and hair weight, carcass weight, bone weight, head weight, front hoof weight, back hoof weight, skin weight, tumor net abomasum, omasum stomach, penis bovis seu Bubali, cow tail weight, carcass depth, carcass chest depth, back leg length, thigh meat thickness, waist meat thickness, marble pattern and eye muscle area of Chinese Simmental cattle are analyzed (the significant correlation exists after 18 meat quality and carcass correlation traits including the SNP1 locus of the RRAD gene and the carcass correlation traits of Chinese Simmental cattle are analyzed ((the significant correlation exists)p<0.05), as shown in table 3:
table 3: the correlation analysis between RRAD gene SNP1 and Chinese Simmental cattle meat quality and carcass traits is as follows:
the genetic analysis and verification results of the 3 'UTR of the RRAD gene of 137 Chinese Simmental cattle show that SNP1 of the RRAD gene, namely 3' UTR-198G > A, is obviously related to 18 important meat quality and carcass traits including the carcass depth, the carcass chest depth, the rear leg length, the thigh thickness, the waist thickness, marbling, the eye muscle area and the like of cattle, and the molecular marker can be used for early screening and predicting the carcass and meat quality traits of the cattle on the DNA level and can be applied to molecular breeding of cattle with excellent traits.
Sequence listing
<110> Jilin university
<120> method for detecting cattle carcass and meat quality traits by using RRAD genetic marker
<160>3
<170>SIPOSequenceListing 1.0
<210>1
<211>611
<212>DNA
<213> cattle (cattle)
<400>1
acccactcac cttttgctta ctgatgtgtg cctgtctccc acccccgcca cacacaccag 60
agggccgggc ctgtgccgtt gtctttgact gcaagttcat cgagacgtcg gctgcactgc 120
accacaacgt ccaggcactg ttcgagggtg tcgtgcgtca gatacgcctg cgcagggaca 180
gcaaagaggc caacgcgcgt cggcaagcgg gtacccggcg gcgagagagc ctgggcaaga 240
aggcgaagcg cttcctgggc cgcatcgtcg ctcgaaacag ccgcaagatg gccatgcgtg 300
ccaagtccaa gtcctgccat gacctatcgg tgctctagac cctggggcac ttgctgtatt 360
gtgcagacag atgggctgat tggtgggctg gcccagccaa ccgcccaagg tgcctcagag 420
ctggctcaga ctctgggcgt cccccagctc acggtcatgg acagacagac agtgctgccc 480
agggaggcgg ctcccagtgg ccgttgaggg ctgggcccac caagatgcct gtgccggccc 540
gtgtgcatcc caagcagcag gctgacccca gccagccctt ggggacaggc ctgtgaatgg 600
ggagaggact c 611
<210>2
<211>25
<212>DNA
<213> Artificial primer (Artificial primer)
<400>2
rradacccac tcaccttttg cttac 25
<210>3
<211>20
<212>DNA
<213> Artificial primer (Artificial primer)
<400>3
gagtcctctc cccattcaca 20
Claims (3)
- Use of RRAD gene as a molecular marker for beef quality and carcass traits, characterized in that:the SNP locus of the gene is 198bp of the 3 'UTR of the bovine RRAD gene, and the SNP locus 3' UTR-198G > A.
- A method for detecting the single nucleotide polymorphism of RRAD gene as a molecular marker of beef quality traits, which is characterized by comprising the following steps: a pair of primers designed according to the sequence of the cattle RRAD gene is as follows:RRAD-F：５’ACCCACTCACCTTTTGCTTAC３’；RRAD-R：５’GAGTCCTCTCCCCATTCACA３’。
- 3. the method for detecting the single nucleotide polymorphism of the RRAD gene as the molecular marker of the beef quality trait according to claim 2, comprising the following steps:the first step is as follows: collecting a whole blood or tissue sample of a cow to be detected, and extracting genomic DNA (deoxyribonucleic acid) by using the whole blood or tissue sample of the cow;the second step is that: synthesizing a primer according to the sequence provided in claim 2;the third step: using the cattle genome DNA as a template, and carrying out PCR amplification by using the primer synthesized in the previous step to obtain a PCR product containing a cattle RRAD gene target fragment;and (3) PCR reaction system: 10 mu L of Taq PCR Mix, 0.5 mu L of each of the upstream primer and the downstream primer, 2 mu L of mixed pool DNA/individual DNA and 7 mu L of deionized water, and 20 mu L of the mixed pool DNA/individual DNA are fully and uniformly mixed for PCR amplification; the PCR reaction program is: pre-denaturation at 95 deg.C for 5min, denaturation at 95 deg.C for 30 s, annealing at 60 deg.C for 30 s, extension at 72 deg.C for 1 min, and circulating for 35 times; extending at 72 ℃ for 10 min; storing at 4 deg.C; checking the length and quality of the PCR amplification product fragment by agarose gel electrophoresis, and keeping the PCR amplification product fragment at 4 ℃ or-20 ℃ for later use;the fourth step: sequencing the PCR product by adopting a DNA sequencing technology, searching the position of the SNP locus of the 3' untranslated region of the RRAD gene in a sequencing result by using sequence analysis software, carrying out genotype analysis on a detected cattle group or individual sample according to the molecular marker SNP1 of the RRAD gene in claim 1, namely GG genotype, GA genotype or AA genotype, and finally evaluating and predicting the carcass and meat quality traits of cattle through the genotypes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010097319.6A CN110982912B (en) | 2020-02-18 | 2020-02-18 | Method for detecting cattle carcass and meat quality traits by using RRAD genetic marker |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010097319.6A CN110982912B (en) | 2020-02-18 | 2020-02-18 | Method for detecting cattle carcass and meat quality traits by using RRAD genetic marker |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110982912A true CN110982912A (en) | 2020-04-10 |
| CN110982912B CN110982912B (en) | 2022-12-27 |
Family
ID=70081286
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010097319.6A Active CN110982912B (en) | 2020-02-18 | 2020-02-18 | Method for detecting cattle carcass and meat quality traits by using RRAD genetic marker |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110982912B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100818166B1 (en) * | 2006-11-16 | 2008-03-31 | 상지대학교산학협력단 | Devolopment of molecualar marker for diagnosis of korean cattle producing high meat amount |
| CN104630341A (en) * | 2014-11-24 | 2015-05-20 | 吉林大学 | Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality |
| CN106319063A (en) * | 2016-09-14 | 2017-01-11 | 吉林大学 | Method for detecting beef carcass and meat quality characters by aid of PRSS2 (protease, serine, 2) gene markers |
-
2020
- 2020-02-18 CN CN202010097319.6A patent/CN110982912B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR100818166B1 (en) * | 2006-11-16 | 2008-03-31 | 상지대학교산학협력단 | Devolopment of molecualar marker for diagnosis of korean cattle producing high meat amount |
| CN104630341A (en) * | 2014-11-24 | 2015-05-20 | 吉林大学 | Chinese Simmental cattle FGF-1 gene as genetic markers of carcass meat quality |
| CN106319063A (en) * | 2016-09-14 | 2017-01-11 | 吉林大学 | Method for detecting beef carcass and meat quality characters by aid of PRSS2 (protease, serine, 2) gene markers |
Non-Patent Citations (3)
| Title |
|---|
| 佚名: "Accession No. NM_001045913.1", 《GENBANK》 * |
| 佚名: "rs381311706", 《ENSEMBL RELEASE 98》 * |
| 蔡明成等: "SNP在肉牛育种中的应用进展", 《中国农学通报》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110982912B (en) | 2022-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110257529B (en) | SNP molecular marker related to lean meat percentage, eye muscle area and eye muscle thickness on pig No. 6 chromosome and application | |
| CN103898107B (en) | Major SNP (single nucleotide polymorphism) marker influencing growth traits of pigs and application thereof in genetic improvement of productivity of breeding pigs | |
| CN110218798B (en) | SNP molecular marker located on pig chromosome 7 and related to eye muscle area and eye muscle thickness and application | |
| CN113913538B (en) | SNP molecular marker related to chicken carcass traits and application | |
| CN112176070B (en) | UCP3 gene related to pig intramuscular fat character, molecular marker and application thereof | |
| CN112195253B (en) | SNP (Single nucleotide polymorphism) locus for increasing content of fatty acid C14:0 in chicken and method for breeding high-quality chicken strain by using SNP locus | |
| CN110468212B (en) | SNP (single nucleotide polymorphism) site related to content of fatty acid C14:0 on chromosome 19 of meat Simmental cattle and application | |
| CN110144408B (en) | SNP molecular marker located on pig chromosome 7 and related to total papilla number and application | |
| KR100804310B1 (en) | 4 DNA marker of adipocyte-fatty acid binding protein gene related the intramuscular fat content in beef cattle | |
| CN110923332B (en) | Molecular marker influencing early growth of sheep, detection method and application thereof | |
| CN116179714B (en) | Molecular marker related to chicken slaughtering and meat quality characteristics and breeding method of high-quality slaughtering and processing type novel variety | |
| CN114921568B (en) | SNP molecular marker related to Qinchuan cattle body ruler and meat quality traits and application thereof | |
| CN113528675A (en) | Molecular marker for identifying duck slaughter traits based on myostatin gene MSTN, and identification method and application thereof | |
| CN110438237B (en) | SNP (single nucleotide polymorphism) site related to posttendinosus and fashion head weight on chromosome 6 of meat Simmental cattle and application | |
| CN110982912A (en) | Method for detecting cattle carcass and meat quality traits by using RRAD genetic marker | |
| CN110982908B (en) | Molecular marking method for fat deposition and meat quality characters of lean type fixed-distance pig strain | |
| CN111118180B (en) | Method for detecting cattle fat character by using SDC3 promoter genetic marker | |
| CN111154896A (en) | SNP marker related to Gansu golden trout growth traits and method application thereof | |
| CN113699248A (en) | SNP molecular marker related to pig backfat thickness and application thereof | |
| CN113736890A (en) | SNP molecular marker related to Jian' er number and survival rate and application thereof | |
| CN106319063B (en) | A method of ox meat quality is detected using PRSS2 genetic marker | |
| CN111808974B (en) | SNP molecular marker located on pig chromosome 9 and related to scrotal hernia and application | |
| CN114854867B (en) | Molecular marker related to abdominal fat character of yellow-feathered broiler chicken and application thereof | |
| CN112266968B (en) | Copy number variation molecular marker influencing weight age in days and daily gain on pig chromosome 13 and application | |
| CN108707675B (en) | Molecular marking method for pig growth traits |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |