CN110982901A - Circulating circular RNA marker for invasive papillary thyroid carcinoma diagnosis and application - Google Patents

Abstract

The invention belongs to the technical field of biological detection, and particularly discloses a circulating circular RNA marker for invasive papillary thyroid carcinoma diagnosis and application thereof, wherein the circulating circular RNA marker for invasive papillary thyroid carcinoma diagnosis is circulating circular RNA which is circ _0058090 and circ _ 0014188. The biomarker has high sensitivity and specificity, can be effectively used for diagnosing invasive PTC, and can obviously improve the survival of patients.

Description

Circulating circular RNA marker for invasive papillary thyroid carcinoma diagnosis and application

Technical Field

The invention belongs to the field of biomedicine, and particularly relates to a biomarker for invasive papillary thyroid carcinoma diagnosis and application thereof.

Background

Thyroid cancer is one of common endocrine system malignant tumors, the incidence rate of the thyroid cancer is increased year by year, more than 53990 new cases occur every year, the main histological type of the thyroid cancer is papillary cancer, and the thyroid cancer accounts for more than 75% of all cases. Although the prognosis of most patients with Papillary Thyroid Cancer (PTC) is good, the 5-year survival rate is as high as 95%, 13-15% of patients still show extrathyroid invasion characteristics, easily invade important organ structures such as larynx, trachea, esophagus, neck great vessels and the like, easily generate regional lymph nodes and distant metastasis, the invasion characteristics cause higher recurrence rate and mortality rate of diseases, and local uncontrollable severe extrathyroid invasion is a main cause of death of the patients.

Extrathyroid invasion (ETE) is an independent predictor of poor prognosis in PTC patients. In general, an active diagnosis and treatment mode is required for invasive PTC, so it is urgently needed to perform early diagnosis on highly invasive PTC, and PTC must be properly evaluated before an operation to identify invasive PTC and non-invasive PTC, and know the possibility and degree of invasive PTC, so as to prevent over-treatment and avoid under-treatment.

Currently, the conventional B-ultrasound and fine needle puncture pathology examinations before surgery cannot effectively identify this highly invasive PTC in the early stage. In the context of molecular biological research, there is a lack of high-level research to screen reliable molecular markers for diagnosis and identification of PTCs with highly invasive characteristics. Therefore, the identification of novel biomarkers for early diagnosis of invasive PTC plays an important role in improving clinical treatment strategies and improving prognosis for such patients.

Circular RNA (circRNA) is a class of endogenous non-coding RNA different from linear RNA, which is a covalently closed circular RNA molecule formed by reverse splicing, has no 5 'end cap and 3' end polyA tail structure, is not influenced by RNA exonuclease, and is stably and widely present in the biological world. High throughput sequencing technology has identified thousands of circrnas in eukaryotes with high sequence conservation and cell type specific expression. Recent studies have found that circRNA plays multiple roles in cell biology, such as miRNA sponges, transcription regulators, RBP binding molecules, protein translation templates, and immune regulators. The circRNA plays an important role in the process of disease occurrence such as nervous system disorder, diabetes, tumor and the like. With the progress of high-throughput chip and RNA sequencing technologies as well as bioinformatics. Clinically, a large number of abnormally expressed circRNAs have been identified as being associated with clinical pathological features in cancers such as breast, liver, stomach, colorectal and lung cancers. As the circRNAs have the characteristics of high stability, exonuclease resistance and the like, the circRNAs have been reported as novel biomarkers for cancer diagnosis and prognosis. Recent studies have shown that circRNA is enriched in human peripheral blood and that circRNA in blood components can be used as a biomarker. In colorectal cancer (CRC), upregulation of Hsa _ circ _001569 correlates with the aggressive profile of CRC. In PTC, has _ circ _0008274, hsa _ circ _0004458, hsa _ circ _0072088 expression is deregulated and associated with poor prognosis. In gastric cancer, hsa _ circ _0000190 was down-regulated on the expression level in gastric cancer tissues and plasma samples, and its expression level correlated with tumor diameter, lymphatic metastasis, distant metastasis, TNM staging and CA19-9 level, and could be a novel non-invasive biomarker for gastric cancer.

To date, despite extensive research into biomarkers for PTC, there has been little focus on the diagnostic effects of circulating circRNAs of invasive PTC.

Disclosure of Invention

Extrathyroid invasion (ETE) is an independent predictor of poor prognosis in PTC patients. This aggressive profile not only leads to a higher recurrence rate of the disease, but also to a higher mortality rate in this type of patient. Although invasive PTCs are relatively common and have a great impact on clinical outcome, the conventional B-ultrasonography and fine needle puncture pathology before surgery cannot effectively identify the highly invasive PTCs at an early stage, and there is no high-level research for screening reliable molecular markers for early diagnosis and identification of PTCs with invasive characteristics in the aspect of molecular biology research. Therefore, the identification of novel biomarkers for early diagnosis of invasive PTC plays an important role in improving clinical treatment strategies and improving prognosis for such patients. The invention aims to overcome the defects and provide a diagnosis of circulating circRNAs related biomarkers for early diagnosis of invasive PTC, so that through the work, invasive and non-invasive PTC can be distinguished early, PTC can be properly evaluated before operation, possibility and degree of invasion can be known, over-treatment can be prevented, under-treatment can be avoided, and effective basis is provided for accurate treatment of papillary thyroid cancer.

In the present invention, we investigated the potential use of circulating circRNAs in plasma as invasive PTC biomarkers. First, we integrated the data for aberrant expression of circRNA in both samples by analyzing the ceRNA chip data from circulating and tissue samples from invasive, non-invasive PTC patients. Real-time quantitative PCR (RT-qPCR) techniques were then used to validate in the plasma of more aggressive and non-aggressive PTC patients. Finally, we screened and validated a panel of differentially expressed circRNAs in plasma, which could serve as a novel biomarker for diagnosing invasive PTC.

The aim of the invention is realized by the following method:

a circulating circular RNA marker for invasive papillary thyroid cancer diagnosis, the marker being circulating circular RNA, the circulating circular RNA being circ _0058090 and circ _ 0014188.

The circulating circular RNA marker is applied to diagnosis of invasive papillary thyroid carcinoma.

The circulating circular RNA marker can also be applied to preparation of an invasive papillary thyroid carcinoma diagnostic kit or a medicament for treating invasive papillary thyroid carcinoma.

The primer of the circulating circular RNA marker related to diagnosis of invasive papillary thyroid carcinoma comprises a primer of a circulating circular RNA of circ _0058090 and circ _ 0014188. The primer is applied to diagnosis of invasive papillary thyroid carcinoma or preparation of a diagnosis kit of invasive papillary thyroid carcinoma.

The invasive papillary thyroid carcinoma diagnostic kit contains primers for circ _0058090 and circ _0014188 circulating circular RNA in circulating circular RNA. The kit also comprises reagents commonly used in PCR technology.

The steps of the present invention for diagnosing invasive papillary thyroid carcinoma comprise: extracting total RNA from tissues and plasma; carrying out reverse transcription on the total RNA, and carrying out QRT-PCR; risk score analysis to assess the correlation between plasma circRNA expression levels.

Compared with the prior art, the invention has the beneficial effects that:

1. in the invention, the potential use of circulating circRNAs in plasma as invasive PTC biomarkers is provided. The detection of circulating biomarkers in plasma belongs to a liquid biopsy method, can be frequently detected for multiple times, and can be used for guiding the long-term screening of tumor patients and the evaluation of treatment response. The method belongs to the minimally invasive category, is non-invasive, saves surgical biopsy and puncture biopsy for patients, reduces the medical cost and reduces the waste of medical resources.

2. The high-sensitivity and specific biomarker is used for invasive PTC detection and prognosis evaluation, can improve the survival of patients and meets the current urgent need.

Drawings

FIG. 1 is the circRNA expression profile in circulating and tissue samples. In the figure, the position of the upper end of the main shaft,

a: cluster analysis and volcano plots of differentially expressed circRNAs (4 pairs of aggressive PTC tumor tissue and paracancerous normal tissue).

B: cluster analysis and volcano plots of differentially expressed circRNAs (4 invasive PTC tumor tissues and 4 non-invasive PTC tumor tissues).

C: cluster analysis and volcano plots of differentially expressed circRNAs (plasma samples from 3 invasive PTC and 3 non-invasive PTC patients).

D: venny analysis circRNAs with increased expression in cycling and tissue samples.

FIG. 2 is a validation graph of candidate circRNAs in the test group.

In the figure, RT-qPCR confirmed the expression levels of circRNA candidates in plasma of 20 invasive PTC patients and 20 non-invasive PTC patients, and the data are presented as mean ± SEM. Data analysis was verified using Student's t. n.s. indicates no significant difference, indicates p <0.05, indicates p < 0.01.

FIG. 3 is a validation graph of candidate circRNAs in circulating and tissue samples.

In the figure, the circRNA candidates were validated using RT-qPCR in 20 tissue samples (invasive PTC tumor tissue and non-invasive PTC tumor tissue) and 20 cycle samples (invasive PTC and non-invasive PTC patients). Data analysis was verified using Student's t. n.s. indicates no significant difference, indicates p <0.05, indicates p < 0.01. FIG. 4 is a validation graph of candidate circRNAs in the validation set.

In the figure, the expression levels of the circRNA candidates in plasma of 120 invasive PTC patients and 120 non-invasive PTC patients were verified by RT-qPCR, and the data are expressed as mean ± SEM. Data analysis was verified using Student's t. n.s. indicates no significant difference, indicates p <0.05, indicates p < 0.01.

Fig. 5 is a graph of ROC analysis of two potential biomarkers of invasive PTC by risk score analysis.

In the figure, A: ROC curve analysis distinguishes invasive PTC cases from controls by two circRNA expressions. ROC curve analysis of the expression of the two circrnas in the test group distinguished 20 pairs of invasive PTC cases from non-invasive controls, AUC shown on the a-graph. The integration curves represent the combination of two circRNAs, hsa _ circ _0058090 and hsa _ circ _ 0014188. B: ROC curve analysis of the expression of both circrnas distinguished 120 pairs of invasive PTC cases from non-invasive controls, AUC as shown on the B-plot. The integration curves represent the combination of two circRNAs, hsa _ circ _0058090 and hsa _ circ _ 0014188.

Detailed Description

In order to make the technical problems, technical solutions and advantageous effects to be solved by the present invention more clearly apparent, the present invention is further described in detail below with reference to the following embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and are not intended to limit the invention.

Preferred embodiments of the present invention will be described in more detail with reference to specific examples.

In one aspect, the embodiments of the present invention provide a biomarker for invasive papillary thyroid cancer diagnosis, wherein the biomarker is circulating circular RNA.

By the circBase database, it can be known that: the corresponding positions on the human chromosome and the nucleotide sequences are shown below:

hsa _ circ _0058090 and hsa _ circ _0014188 sequences:

>hsa_circ_0058090|NM_002026|FN1

ACCGCTGCCATGAAGGGGGTCAGTCCTACAAGATTGGTGACACCTGGAGGAGACCACATGAGACTGGTGGTTACATGTTAGAGTGTGTGTGTCTTGGTAATGGAAAAGGAGAATGGACCTGCAAGCCCATAGCTGAGAAGTGTTTTGATCATGCTGCTGGGACTTCCTATGTGGTCGGAGAAACGTGGGAGAAGCCCTACCAAGGCTGGATGATGGTAGATTGTACTTGCCTGGGAGAAGGCAGCGGACGCATCACTTGCACTTCTAGAAATAGATGCAACGATCAGGACACAAGGACATCCTATAGAATTGGAGACACCTGGAGCAAGAAGGATAATCGAGGAAACCTGCTCCAGTGCATCTGCACAGGCAACGGCCGAGGAGAGTGGAAGTGTGAGAGGCACACCTCTGTGCAGACCACATCGAGCGGATCTGGCCCCTTCACCGATGTTCGTGCAGCTGTTTACCAACCGCAGCCTCACCCCCAGCCTCCTCCCTATGGCCACTGTGTCACAGACAGTGGTGTGGTCTACTCTGTGGGGATGCAGTGGCTGAAGACACAAGGAAATAAGCAAATGCTTTGCACGTGCCTGGGCAACGGAGTCAGCTGCCAAGAGACAGCTGTAACCCAGACTTACGGTGGCAACTCAAATGGAGAGCCATGTGTCTTACCATTCACCTACAATGGCAGGACGTTCTACTCCTGCACCACAGAAGGGCGACAGGACGGACATCTTTGGTGCAGCACAACTTCGAATTATGAGCAGGACCAGAAATACTCTTTCTGCACAGACCACACTGTTTTGGTTCAGACTCGAGGAGGAAATTCCAATGGTGCCTTGTGCCACTTCCCCTTCCTATACAACAACCACAATTACACTGATTGCACTTCTGAGGGCAGAAGAGACAACATGAAGTGGTGTGGGACCACACAGAACTATGATGCCGACCAGAAGTTTGGGTTCTGCCCCATGGCTGCCCACGAGGAAATCTGCACAACCAATGAAGGGGTCATGTACCGCATTGGAGATCAGTGGGATAAGCAGCATGACATGGGTCACATGATGAGGTGCACGTGTGTTGGGAATGGTCGTGGGGAATGGACATGCATTGCCTACTCGCAGCTTCGAGATCAGTGCATTGTTGATGACATCACTTACAATGTGAACGACACATTCCACAAGCGTCATGAAGAGGGGCACATGCTGAACTGTACATGCTTCGGTCAGGGTCGGGGCAGGTGGAAGTGTGATCCCGTCGACCAATGCCAGGATTCAGAGACTGGGACGTTTTATCAAATTGGAGATTCATGGGAGAAGTATGTGCATGGTGTCAGATACCAGTGCTACTGCTATGGCCGTGGCATTGGGGAGTGGCATTGCCAACCTTTACAGACCTATCCAAGCTCAAGTGGTCCTGTCGAAGTATTTATCACTGAGACTCCGAGTCAGCCCAACTCCCACCCCATCCAGTGGAATGCACCACAGCCATCTCACATTTCCAAGTACATTCTCAGGTGGAGACCTAAAAATTCTGTAGGCCGTTGGAAGGAAGCTACCATACCAGGCCACTTAAACTCCTACACCATCAAAGGCCTGAAGCCTGGTGTGGTATACGAGGGCCAGCTCATCAGCATCCAGCAGTACGGCCACCAAGAAGTGACTCGCTTTGACTTCACCACCACCAGCACCAGCACACCTGTGACCAGCAACACCGTGACAGGAGAGACGACTCCCTTTTCTCCTCTTGTGGCCACTTCTGAATCTGTGACCGAAATCACAGCCAGTAGCTTTGTGGTCTCCTGGGTCTCAGCTTCCGACACCGTGTCGGGATTCCGGGTGGAATATGAGCTGAGTGAGGAGGGAGATGAGCCACAGTACCTGGATCTTCCAAGCACAGCCACTTCTGTGAACATCCCTGACCTGCTTCCTGGCCGAAAATACATTGTAAATGTCTATCAGATATCTGAGGATGGGGAGCAGAGTTTGATCCTGTCTACTTCACAAACAACAGCGCCTGATGCCCCTCCTGACACGACTGTGGACCAAGTTGATGACACCTCAATTGTTGTTCGCTGGAGCAGACCCCAGGCTCCCATCACAGGGTACAGAATAGTCTATTCGCCATCAGTAGAAGGTAGCAGCACAGAACTCAACCTTCCTGAAACTGCAAACTCCGTCACCCTCAGTGACTTGCAACCTGGTGTTCAGTATAACATCACTATCTATGCTGTGGAAGAAAATCAAGAAAGTACACCTGTTGTCATTCAACAAGAAACCACTGGCACCCCACGCTCAGATACAGTGCCCTCTCCCAGGGACCTGCAGTTTGTGGAAGTGACAGACGTGAAGGTCACCATCATGTGGACACCGCCTGAGAGTGCAGTGACCGGCTACCGTGTGGATGTGATCCCCGTCAACCTGCCTGGCGAGCACGGGCAGAGGCTGCCCATCAGCAGGAACACCTTTGCAGAAGTCACCGGGCTGTCCCCTGGGGTCACCTATTACTTCAAAGTCTTTGCAGTGAGCCATGGGAGGGAGAGCAAGCCTCTGACTGCTCAACAGACAACCAAACTGGATGCTCCCACTAACCTCCAGTTTGTCAATGAAACTGATTCTACTGTCCTGGTGAGATGGACTCCACCTCGGGCCCAGATAACAGGATACCGACTGACCGTGGGCCTTACCCGAAGAGGACAGCCCAGGCAGTACAATGTGGGTCCCTCTGTCTCCAAGTACCCACTGAGGAATCTGCAGCCTGCATCTGAGTACACCGTATCCCTCGTGGCCATAAAGGGCAACCAAGAGAGCCCCAAAGCCACTGGAGTCTTTACCACACTGCAGCCTGGGAGCTCTATTCCACCTTACAACACCGAGGTGACTGAGACCACCATTGTGATCACATGGACGCCTGCTCCAAGAATTGGTTTTAAGCTGGGTGTACGACCAAGCCAGGGAGGAGAGGCACCACGAGAAGTGACTTCAGACTCAGGAAGCATCGTTGTGTCCGGCTTGACTCCAGGAGTAGAATACGTCTACACCATCCAAGTCCTGAGAGATGGACAGGAAAGAGATGCGCCAATTGTAAACAAAGTGGTGACACCATTGTCTCCACCAACAAACTTGCATCTGGAGGCAAACCCTGACACTGGAGTGCTCACAGTCTCCTGGGAGAGGAGCACCACCCCAGACATTACTGGTTATAGAATTACCACAACCCCTACAAACGGCCAGCAGGGAAATTCTTTGGAAGAAGTGGTCCATGCTGATCAGAGCTCCTGCACTTTTGATAACCTGAGTCCCGGCCTGGAGTACAATGTCAGTGTTTACACTGTCAAGGATGACAAGGAAAGTGTCCCTATCTCTGATACCATCATCCCAGCTGTTCCTCCTCCCACTGACCTGCGATTCACCAACATTGGTCCAGACACCATGCGTGTCACCTGGGCTCCACCCCCATCCATTGATTTAACCAACTTCCTGGTGCGTTACTCACCTGTGAAAAATGAGGAAGATGTTGCAGAGTTGTCAATTTCTCCTTCAGACAATGCAGTGGTCTTAACAAATCTCCTGCCTGGTACAGAATATGTAGTGAGTGTCTCCAGTGTCTACGAACAACATGAGAGCACACCTCTTAGAGGAAGACAGAAAACAGGTCTTGATTCCCCAACTGGCATTGACTTTTCTGATATTACTGCCAACTCTTTTACTGTGCACTGGATTGCTCCTCGAGCCACCATCACTGGCTACAGGATCCGCCATCATCCCGAGCACTTCAGTGGGAGACCTCGAGAAGATCGGGTGCCCCACTCTCGGAATTCCATCACCCTCACCAACCTCACTCCAGGCACAGAGTATGTGGTCAGCATCGTTGCTCTTAATGGCAGAGAGGAAAGTCCCTTATTGATTGGCCAACAATCAACAGTTTCTGATGTTCCGAGGGACCTGGAAGTTGTTGCTGCGACCCCCACCAGCCTACTGATCAGCTGGGATGCTCCTGCTGTCACAGTGAGATATTACAGGATCACTTACGGAGAGACAGGAGGAAATAGCCCTGTCCAGGAGTTCACTGTGCCTGGGAGCAAGTCTACAGCTACCATCAGCGGCCTTAAACCTGGAGTTGATTATACCATCACTGTGTATGCTGTCACTGGCCGTGGAGACAGCCCCGCAAGCAGCAAGCCAATTTCCATTAATTACCGAACAGAAATTGACAAACCATCCCAGATGCAAGTGACCGATGTTCAGGACAACAGCATTAGTGTCAAGTGGCTGCCTTCAAGTTCCCCTGTTACTGGTTACAGAGTAACCACCACTCCCAAAAATGGACCAGGACCAACAAAAACTAAAACTGCAGGTCCAGATCAAACAGAAATGACTATTGAAGGCTTGCAGCCCACAGTGGAGTATGTGGTTAGTGTCTATGCTCAGAATCCAAGCGGAGAGAGTCAGCCTCTGGTTCAGACTGCAGTAACCAACATTGATCGCCCTAAAGGACTGGCATTCACTGATGTGGATGTCGATTCCATCAAAATTGCTTGGGAAAGCCCACAGGGGCAAGTTTCCAGGTACAGGGTGACCTACTCGAGCCCTGAGGATGGAATCCATGAGCTATTCCCTGCACCTGATGGTGAAGAAGACACTGCAGAGCTGCAAGGCCTCAGACCGGGTTCTGAGTACACAGTCAGTGTGGTTGCCTTGCACGATGATATGGAGAGCCAGCCCCTGATTGGAACCCAGTCCACAGCTATTCCTGCACCAACTGACCTGAAGTTCACTCAGGTCACACCCACAAGCCTGAGCGCCCAGTGGACACCACCCAATGTTCAGCTCACTGGATATCGAGTGCGGGTGACCCCCAAGGAGAAGACCGGACCAATGAAAGAAATCAACCTTGCTCCTGACAGCTCATCCGTGGTTGTATCAGGACTTATGGTGGCCACCAAATATGAAGTGAGTGTCTATGCTCTTAAGGACACTTTGACAAGCAGACCAGCTCAGGGAGTTGTCACCACTCTGGAGAATGTCAGCCCACCAAGAAGGGCTCGTGTGACAGATGCTACTGAGACCACCATCACCATTAGCTGGAGAACCAAGACTGAGACGATCACTGGCTTCCAAGTTGATGCCGTTCCAGCCAATGGCCAGACTCCAATCCAGAGAACCATCAAGCCAGATGTCAGAAGCTACACCATCACAGGTTTACAACCAGGCACTGACTACAAGATCTACCTGTACACCTTGAATGACAATGCTCGGAGCTCCCCTGTGGTCATCGACGCCTCCACTGCCATTGATGCACCATCCAACCTGCGTTTCCTGGCCACCACACCCAATTCCTTGCTGGTATCATGGCAGCCGCCACGTGCCAGGATTACCGGCTACATCATCAAGTATGAGAAGCCTGGGTCTCCTCCCAGAGAAGTGGTCCCTCGGCCCCGCCCTGGTGTCACAGAGGCTACTATTACTGGCCTGGAACCGGGAACCGAATATACAATTTATGTCATTGCCCTGAAGAATAATCAGAAGAGCGAGCCCCTGATTGGAAGGAAAAAGACAGACGAGCTTCCCCAACTGGTAACCCTTCCACACCCCAATCTTCATGGACCAGAGATCTTGGATGTTCCTTCCACAGTTCAAAAGACCCCTTTCGTCACCCACCCTGGGTATGACACTGGAAATGGTATTCAGCTTCCTGGCACTTCTGGTCAGCAACCCAGTGTTGGGCAACAAATGATCTTTGAGGAACATGGTTTTAGGCGGACCACACCGCCCACAACGGCCACCCCCATAAGGCATAGGCCAAGACCATACCCGCCGAATGTAG>hsa_circ_0014188|NM_030918|SNX27

GAACCACGTGAATGTTGAGGGGGCGACACACAAGCAGGTGGTGGACCTGATTCGAGCAGGCGAGAAGGAATTGATCTTGACAGTGTTATCTGTACCTCCTCATGAGGCAGATAACCTAGATCCCAGTGACGACTCGTTGGGACAATCATTTTATGATTACACAGAAAAGCAAGCAGTGCCCATATCGGTCCCCAGATACAAACATGTGGAGCAGAATGGTGAGAAGTTTGTGGTATATAATGTTTACATGGCAGGGAGGCAGCTGTGTTCTAAGCGGTACCGGGAGTTTGCTATCCTACACCAGAACCTGAAGAGAGAGTTTGCCAACTTTACATTTCCTCGACTCCCAGGGAAGTGGCCATTTTCATTATCAGAACAACAATTAGATGCCCGACGTCGGGGATTGGAAGAATATCTAGAAAAAGTGTGTTCAATACGAGTAATTGGTGAGAGTGACATCATGCAGGAATTCCTATCAGAATCCGATGAGAACTACAATGGTGTGTCCGACGTAGAGCTGAGAGTAGCATTACCAGATGGAACAACGGTTACAGTCAGGGTTAAAAAGAACAGTACTACAGACCAAGTATATCAGGCTATCGCAGCAAAGGTTGGCATGGACAGTACGACAGTGAATTACTTTGCCTTATTTGAAGTGATCAGTCACTCCTTTGTACGTAAATTGGCACCTAATGAGTTTCCTCACAAACTCTACATTCAGAATTATACATCAGCTGTGCCAGGCACCTGCTTGACCATTCGAAAGTGGCTTTTTACAACAGAAGAAGAAATTCTCTTAAATGACAATGACCTTGCTGTTACCTACTTCTTTCATCAGGCAGTCGATGATGTGAAGAAAGGTTACATCAAAGCAGAAGAAAAGTCCTATCAATTACAGAAGCTATACGAACAAAGAAAAATGGTCATGTACCTCAACATGCTAAGGACTTGTGAGGGCTACAATGAAATCATCTTTCCCCACTGTGCCTGTGACTCCAGGAGGAAGGGGCACGTTATCACAGCCATCAGCATCACGCACTTTAAACTGCATGCCTGCACTGAAGAAGGACAGCTGGAGAACCAGGTAATTGCATTTGAATGGGATGAGATGCAGCGATGGGACACAGATGAAGAAGGGATGGCCTTCTGTTTCGAATATGCACGAGGAGAGAAGAAGCCCCGATGGGTTAAAATCTTCACGCCATATTTCAATTACATGCATGAGTGCTTCGAGAGGGTGTTCTGCGAGCTCAAGTGGAGAAAAGAG

example 1

1. Design of experiments

The invention is totally incorporated into 120 invasive PTC patients and 120 non-invasive PTC patients in neck surgery of Nanjing medical university subsidiary tumor hospital from 2014 to 2018. The study was conducted according to the declaration of helsinki of the world medical society (fifth revision, 10 months 2000) and approved by the ethical committee of the subsidiary tumor hospital of the university of medical, Nanjing. Written informed consent was provided by all study participants. These patients were all first-visit patients. The post-operative pathology was confirmed by papillary thyroid carcinoma. Each tissue specimen was stored in liquid nitrogen and the blood samples were stored in a-80 ℃ freezer. Each blood sample was placed in an EDTA-anticoagulation tube, plasma was separated by centrifugation at 800g for 10 minutes at room temperature, followed by centrifugation at 10000g for 15 minutes at high speed at room temperature to completely remove cell debris, and the supernatant was recovered and stored in a refrigerator at-80 ℃. Disease staging was performed according to the tenth edition of AJCC thyroid cancer TNM staging System.

2. Screening process

The screening process was divided into test and validation groups. The test group included 20 patients with invasive PTC and 20 patients with non-invasive PTC. The validation group included 120 invasive PTC patients and 120 non-invasive PTC patients.

3. Test group

The expression levels of all candidate genes were detected in the plasma and corresponding tumor tissue samples of 20 invasive PTC patients and 20 non-invasive PTC patients, respectively. All patients were pathologically diagnosed as papillary thyroid carcinoma. In thatAnalyzing the expression levels of these candidate genes in all samples, and using 2^-ΔΔCtThe method analyzes the differences between invasive and non-invasive patients.

4. Authentication group

The case-control study was designed to verify the difference in relative expression levels of the potential biomarker candidate genes in 120 invasive PTC patients and 120 non-invasive PTC patients.

RNA extraction

Total RNA was extracted from 50mg tissue with Trizol reagent and 400. mu.L plasma with serum/plasma kit (Qiagen). Total RNA from each sample was quantified by NanoDrop ND-1000(Thermo, CA, USA).

Cera chip and data analysis

The ceRNA chip experiments were performed by shanghai berhao biotechnology (SBC) according to the protocol of Agilent Technologies inc. (CA, USA). Both sample total RNAs were extracted and purified according to the manufacturer's instructions, and labeled cRNA was generated using the Low input quick Amp labelling kit (Agilent technologies, Santa Clara, Calif., US) for detection on the human CERNA chip (4X 180K). The labeled cRNA targets were hybridized to the slides and the slides were scanned by an Agilent microarray scanner (Agilent Technologies, CA, USA). Data were extracted using Feature Extraction software 12.0(Agilent Technologies, Calif., USA). Raw data were normalized by quantile algorithm, fold change of transcripts was calculated in R using the software package limma (v.10) and all differentially expressed genes were screened and cluster analyzed.

7. Real-time polymerase chain reaction (RT-PCR)

Total RNA was obtained from plasma samples using a serum/plasma kit (Qiagen) as described by the manufacturer (Invitrogen Life Technologies Co, Carlsbad, Calif., USA). Total RNA (500ng) was reverse transcribed using a reverse transcription kit (Takara, Tokyo, Japan). The 260/280nm absorbance ratio of the samples was limited to between 1.8-2.0. QRT-PCR was performed by using ABI Prism7900HT (Applied Biosystems, CA, USA).

8. Risk scoring analysis

A risk score analysis was performed to assess the correlation between plasma circRNA expression levels. The upper 95% reference interval for each circRNA value in the control group was set as a threshold to encode the expression level of the corresponding circRNA for each sample as 0 and 1 in the test group. The Risk Scoring Function (RSF) for predicting invasive PTC was defined according to the linear combination of each circRNA expression level. For example, the RSF of sample i using information from two circRNAs is: rsfi ═ Σ 2j-1wj. In the above equation, sij is the risk score of circRNA j in sample i, and Wj is the weight of the risk score of circRNA j. The risk score for both circRNAs is calculated based on the weight of the regression coefficients derived from a one-way logistic regression analysis of each circRNAs. Samples were divided into high risk groups (representing invasive PTC patients) and low risk groups (representing non-invasive PTC patients) according to RSF. The diagnostic efficacy was then evaluated using the frequency table and ROC curve and appropriate cut-off points were found and the programs and cut-off values in the next validation sample set were validated.

10. Statistical analysis

Data are presented as mean (SEM). Statistical differences between patients and controls were assessed using Student's t test and Mann-Whitney unpaired ANOVA. The predicted potency of circRNAs was assessed using area under ROC curve (AUC) analysis. Statistical analysis was performed using SPSS 22.0 and GraphPad prism software. Differences of P <0.05 were statistically significant in all cases.

Results of the experiment

1. Cerna chip detection of circulating and tissue circRNAs

The method comprises the steps of detecting circRNA from circulation and tissue samples by using a human ceRNA chip platform, randomly selecting plasma samples from preoperative and three non-invasive PTC patients of three invasive PTC patients, wherein the tissue samples comprise four paired invasive PTC tumor tissues, paracancerous normal tissues and four non-invasive PTC tumor tissues, obtaining an abnormal expression profile of the circRNA in the circulation and tissue samples as shown in figures 1A-1C, filtering the circRNA with the following parameters of ⑴ circRNA expression being more than 80%, ⑵ circRNA difference multiple being more than 1 and ⑶ circRNA expression being increased in the circulation and tissue samples in order to screen candidate biomarkers for predicting invasive PTC, and finding that the invasive PTC tumor tissues have 21648 abnormally increased expression compared with the paracancerous normal tissues as shown in figure 1D, the invasive PTC tumor tissues have 6391 abnormally increased expression compared with the non-invasive PTC tumor tissues, and 2429 have increased expression in the two groups, and the circulating RNA samples are only subjected to further verification in the subsequent high-invasive PTC tumor samples.

RT-qPCR validation of significantly different circRNAs in plasma

To validate the RNA sequencing data in plasma, we validated their expression levels by RT-qPCR in the plasma of 20 invasive PTC patients and 20 non-invasive PTC patients. There was no significant difference in the distribution of age and sex between invasive PTC patients and invasive PTC patients. The results showed that of the 9 circrnas candidates, 4 proved to be significantly different in the circulating samples (fig. 2). Next, these 4 circrnas candidates were confirmed in tissue samples and circulation samples of 20 pairs of patients with invasive PTC and non-invasive PTC. Only 2 circrnas demonstrated increased expression in plasma samples and tumor tissues of invasive PTC patients (fig. 3). Finally, we validated their expression levels in the plasma of an additional 120 invasive PTC patients and 120 non-invasive PTC patients for 2 circRNAs that were aberrantly expressed. As shown in fig. 4, the 2 circRNAs were identified as significant differences, including hsa _ circ _0058090 and hsa _ circ _ 0014188.

3. Risk scoring analysis

Further studies were conducted to explore the accuracy and specificity of these two circrnas as potential features of invasive PTC. These two circRNAs may be considered as potential features of invasive PTC diagnostics throughout the heterogeneous testing and analysis. The diagnostic value of both circrnas was assessed using a risk scoring formula. First, the control group and the case group in the test group were divided into 95% confidence intervals according to the 95% confidence interval (95% CI) of the control group. The risk score was calculated based on Logistic regression analysis. All plasma samples were then divided into invasive PTC high risk and low risk groups. We define the cutoff as the maximum of sensitivity and specificity. ROC curve analysis was used to evaluate the predictive diagnostic value of circRNAs for invasive PTC. The areas under the ROC curves for the two circrnas verified were 0.838 and 0.805, respectively, while the combination of the two had better discrimination between invasive PTC patients and controls, with an area under the ROC curve of 0.857 (fig. 5A). ROC curve analysis was used to evaluate the predictive diagnostic value of circRNAs in the validation group for invasive PTC. The areas under the ROC curve for the 2 circRNAs verified were 0.733 and 0.631 respectively, while the combination of these two factors gave better discrimination between invasive PTC patients and controls, with an area under the ROC curve of 0.812 (fig. 5B).

Sequence listing

<110> tumor hospital in Jiangsu province

<120> circulating circular RNA marker for invasive papillary thyroid carcinoma diagnosis and application

<150>2019107501352

<151>2019-08-14

<160>2

<170>SIPOSequenceListing 1.0

<210>1

<211>5826

<212>DNA

<213>Homo sapiens

<400>1

accgctgcca tgaagggggt cagtcctaca agattggtga cacctggagg agaccacatg 60

agactggtgg ttacatgtta gagtgtgtgt gtcttggtaa tggaaaagga gaatggacct 120

gcaagcccat agctgagaag tgttttgatc atgctgctgg gacttcctat gtggtcggag 180

aaacgtggga gaagccctac caaggctgga tgatggtaga ttgtacttgc ctgggagaag 240

gcagcggacg catcacttgc acttctagaa atagatgcaa cgatcaggac acaaggacat 300

cctatagaat tggagacacc tggagcaaga aggataatcg aggaaacctg ctccagtgca 360

tctgcacagg caacggccga ggagagtgga agtgtgagag gcacacctct gtgcagacca 420

catcgagcgg atctggcccc ttcaccgatg ttcgtgcagc tgtttaccaa ccgcagcctc 480

acccccagcc tcctccctat ggccactgtg tcacagacag tggtgtggtc tactctgtgg 540

ggatgcagtg gctgaagaca caaggaaata agcaaatgct ttgcacgtgc ctgggcaacg 600

gagtcagctg ccaagagaca gctgtaaccc agacttacgg tggcaactca aatggagagc 660

catgtgtctt accattcacc tacaatggca ggacgttcta ctcctgcacc acagaagggc 720

gacaggacgg acatctttgg tgcagcacaa cttcgaatta tgagcaggac cagaaatact 780

ctttctgcac agaccacact gttttggttc agactcgagg aggaaattcc aatggtgcct 840

tgtgccactt ccccttccta tacaacaacc acaattacac tgattgcact tctgagggca 900

gaagagacaa catgaagtgg tgtgggacca cacagaacta tgatgccgac cagaagtttg 960

ggttctgccc catggctgcc cacgaggaaa tctgcacaac caatgaaggg gtcatgtacc 1020

gcattggaga tcagtgggat aagcagcatg acatgggtca catgatgagg tgcacgtgtg 1080

ttgggaatgg tcgtggggaa tggacatgca ttgcctactc gcagcttcga gatcagtgca 1140

ttgttgatga catcacttac aatgtgaacg acacattcca caagcgtcat gaagaggggc 1200

acatgctgaa ctgtacatgc ttcggtcagg gtcggggcag gtggaagtgt gatcccgtcg 1260

accaatgcca ggattcagag actgggacgt tttatcaaat tggagattca tgggagaagt 1320

atgtgcatgg tgtcagatac cagtgctact gctatggccg tggcattggg gagtggcatt 1380

gccaaccttt acagacctat ccaagctcaa gtggtcctgt cgaagtattt atcactgaga 1440

ctccgagtca gcccaactcc caccccatcc agtggaatgc accacagcca tctcacattt 1500

ccaagtacat tctcaggtgg agacctaaaa attctgtagg ccgttggaag gaagctacca 1560

taccaggcca cttaaactcc tacaccatca aaggcctgaa gcctggtgtg gtatacgagg 1620

gccagctcat cagcatccag cagtacggcc accaagaagt gactcgcttt gacttcacca 1680

ccaccagcac cagcacacct gtgaccagca acaccgtgac aggagagacg actccctttt 1740

ctcctcttgt ggccacttct gaatctgtga ccgaaatcac agccagtagc tttgtggtct 1800

cctgggtctc agcttccgac accgtgtcgg gattccgggt ggaatatgag ctgagtgagg 1860

agggagatga gccacagtac ctggatcttc caagcacagc cacttctgtg aacatccctg 1920

acctgcttcc tggccgaaaa tacattgtaa atgtctatca gatatctgag gatggggagc 1980

agagtttgat cctgtctact tcacaaacaa cagcgcctga tgcccctcct gacacgactg 2040

tggaccaagt tgatgacacc tcaattgttg ttcgctggag cagaccccag gctcccatca 2100

cagggtacag aatagtctat tcgccatcag tagaaggtag cagcacagaa ctcaaccttc 2160

ctgaaactgc aaactccgtc accctcagtg acttgcaacc tggtgttcag tataacatca 2220

ctatctatgc tgtggaagaa aatcaagaaa gtacacctgt tgtcattcaa caagaaacca 2280

ctggcacccc acgctcagat acagtgccct ctcccaggga cctgcagttt gtggaagtga 2340

cagacgtgaa ggtcaccatc atgtggacac cgcctgagag tgcagtgacc ggctaccgtg 2400

tggatgtgat ccccgtcaac ctgcctggcg agcacgggca gaggctgccc atcagcagga 2460

acacctttgc agaagtcacc gggctgtccc ctggggtcac ctattacttc aaagtctttg 2520

cagtgagcca tgggagggag agcaagcctc tgactgctca acagacaacc aaactggatg 2580

ctcccactaa cctccagttt gtcaatgaaa ctgattctac tgtcctggtg agatggactc 2640

cacctcgggc ccagataaca ggataccgac tgaccgtggg ccttacccga agaggacagc 2700

ccaggcagta caatgtgggt ccctctgtct ccaagtaccc actgaggaat ctgcagcctg 2760

catctgagta caccgtatcc ctcgtggcca taaagggcaa ccaagagagc cccaaagcca 2820

ctggagtctt taccacactg cagcctggga gctctattcc accttacaac accgaggtga 2880

ctgagaccac cattgtgatc acatggacgc ctgctccaag aattggtttt aagctgggtg 2940

tacgaccaag ccagggagga gaggcaccac gagaagtgac ttcagactca ggaagcatcg 3000

ttgtgtccgg cttgactcca ggagtagaat acgtctacac catccaagtc ctgagagatg 3060

gacaggaaag agatgcgcca attgtaaaca aagtggtgac accattgtct ccaccaacaa 3120

acttgcatct ggaggcaaac cctgacactg gagtgctcac agtctcctgg gagaggagca 3180

ccaccccaga cattactggt tatagaatta ccacaacccc tacaaacggc cagcagggaa 3240

attctttgga agaagtggtc catgctgatc agagctcctg cacttttgat aacctgagtc 3300

ccggcctgga gtacaatgtc agtgtttaca ctgtcaagga tgacaaggaa agtgtcccta 3360

tctctgatac catcatccca gctgttcctc ctcccactga cctgcgattc accaacattg 3420

gtccagacac catgcgtgtcacctgggctc cacccccatc cattgattta accaacttcc 3480

tggtgcgtta ctcacctgtg aaaaatgagg aagatgttgc agagttgtca atttctcctt 3540

cagacaatgc agtggtctta acaaatctcc tgcctggtac agaatatgta gtgagtgtct 3600

ccagtgtcta cgaacaacat gagagcacac ctcttagagg aagacagaaa acaggtcttg 3660

attccccaac tggcattgac ttttctgata ttactgccaa ctcttttact gtgcactgga 3720

ttgctcctcg agccaccatc actggctaca ggatccgcca tcatcccgag cacttcagtg 3780

ggagacctcg agaagatcgg gtgccccact ctcggaattc catcaccctc accaacctca 3840

ctccaggcac agagtatgtg gtcagcatcg ttgctcttaa tggcagagag gaaagtccct 3900

tattgattgg ccaacaatca acagtttctg atgttccgag ggacctggaa gttgttgctg 3960

cgacccccac cagcctactg atcagctggg atgctcctgc tgtcacagtg agatattaca 4020

ggatcactta cggagagaca ggaggaaata gccctgtcca ggagttcact gtgcctggga 4080

gcaagtctac agctaccatc agcggcctta aacctggagt tgattatacc atcactgtgt 4140

atgctgtcac tggccgtgga gacagccccg caagcagcaa gccaatttcc attaattacc 4200

gaacagaaat tgacaaacca tcccagatgc aagtgaccga tgttcaggac aacagcatta 4260

gtgtcaagtg gctgccttca agttcccctg ttactggtta cagagtaacc accactccca 4320

aaaatggacc aggaccaaca aaaactaaaa ctgcaggtcc agatcaaaca gaaatgacta 4380

ttgaaggctt gcagcccaca gtggagtatg tggttagtgt ctatgctcag aatccaagcg 4440

gagagagtca gcctctggtt cagactgcag taaccaacat tgatcgccct aaaggactgg 4500

cattcactga tgtggatgtc gattccatca aaattgcttg ggaaagccca caggggcaag 4560

tttccaggta cagggtgacc tactcgagcc ctgaggatgg aatccatgag ctattccctg 4620

cacctgatgg tgaagaagac actgcagagc tgcaaggcct cagaccgggt tctgagtaca 4680

cagtcagtgt ggttgccttg cacgatgata tggagagcca gcccctgatt ggaacccagt 4740

ccacagctat tcctgcacca actgacctga agttcactca ggtcacaccc acaagcctga 4800

gcgcccagtg gacaccaccc aatgttcagc tcactggata tcgagtgcgg gtgaccccca 4860

aggagaagac cggaccaatg aaagaaatca accttgctcc tgacagctca tccgtggttg 4920

tatcaggact tatggtggcc accaaatatg aagtgagtgt ctatgctctt aaggacactt 4980

tgacaagcag accagctcag ggagttgtca ccactctgga gaatgtcagc ccaccaagaa 5040

gggctcgtgt gacagatgct actgagacca ccatcaccat tagctggaga accaagactg 5100

agacgatcac tggcttccaa gttgatgccg ttccagccaa tggccagact ccaatccaga 5160

gaaccatcaa gccagatgtc agaagctaca ccatcacagg tttacaacca ggcactgact 5220

acaagatcta cctgtacacc ttgaatgaca atgctcggag ctcccctgtg gtcatcgacg 5280

cctccactgc cattgatgca ccatccaacc tgcgtttcct ggccaccaca cccaattcct 5340

tgctggtatc atggcagccg ccacgtgcca ggattaccgg ctacatcatc aagtatgaga 5400

agcctgggtc tcctcccaga gaagtggtcc ctcggccccg ccctggtgtc acagaggcta 5460

ctattactgg cctggaaccg ggaaccgaat atacaattta tgtcattgcc ctgaagaata 5520

atcagaagag cgagcccctg attggaagga aaaagacaga cgagcttccc caactggtaa 5580

cccttccaca ccccaatctt catggaccag agatcttgga tgttccttcc acagttcaaa 5640

agaccccttt cgtcacccac cctgggtatg acactggaaa tggtattcag cttcctggca 5700

cttctggtca gcaacccagt gttgggcaac aaatgatctt tgaggaacat ggttttaggc 5760

ggaccacacc gcccacaacg gccaccccca taaggcatag gccaagacca tacccgccga 5820

atgtag 5826

<210>2

<211>1267

<212>DNA

<213>Homo sapiens

<400>2

gaaccacgtg aatgttgagg gggcgacaca caagcaggtg gtggacctga ttcgagcagg 60

cgagaaggaa ttgatcttga cagtgttatc tgtacctcct catgaggcag ataacctaga 120

tcccagtgac gactcgttgg gacaatcatt ttatgattac acagaaaagc aagcagtgcc 180

catatcggtc cccagataca aacatgtgga gcagaatggt gagaagtttg tggtatataa 240

tgtttacatg gcagggaggc agctgtgttc taagcggtac cgggagtttg ctatcctaca 300

ccagaacctg aagagagagt ttgccaactt tacatttcct cgactcccag ggaagtggcc 360

attttcatta tcagaacaac aattagatgc ccgacgtcgg ggattggaag aatatctaga 420

aaaagtgtgt tcaatacgag taattggtga gagtgacatc atgcaggaat tcctatcaga 480

atccgatgag aactacaatg gtgtgtccga cgtagagctg agagtagcat taccagatgg 540

aacaacggtt acagtcaggg ttaaaaagaa cagtactaca gaccaagtat atcaggctat 600

cgcagcaaag gttggcatgg acagtacgac agtgaattac tttgccttat ttgaagtgat 660

cagtcactcc tttgtacgta aattggcacc taatgagttt cctcacaaac tctacattca720

gaattataca tcagctgtgc caggcacctg cttgaccatt cgaaagtggc tttttacaac 780

agaagaagaa attctcttaa atgacaatga ccttgctgtt acctacttct ttcatcaggc 840

agtcgatgat gtgaagaaag gttacatcaa agcagaagaa aagtcctatc aattacagaa 900

gctatacgaa caaagaaaaa tggtcatgta cctcaacatg ctaaggactt gtgagggcta 960

caatgaaatc atctttcccc actgtgcctg tgactccagg aggaaggggc acgttatcac 1020

agccatcagc atcacgcact ttaaactgca tgcctgcact gaagaaggac agctggagaa 1080

ccaggtaatt gcatttgaat gggatgagat gcagcgatgg gacacagatg aagaagggat 1140

ggccttctgt ttcgaatatg cacgaggaga gaagaagccc cgatgggtta aaatcttcac 1200

gccatatttc aattacatgc atgagtgctt cgagagggtg ttctgcgagc tcaagtggag 1260

aaaagag 1267

Claims (7)

1. A circulating circular RNA marker for invasive papillary thyroid cancer diagnosis, wherein the marker is circulating circular RNA, and the circulating circular RNA is circ _0058090 and circ _ 0014188.

2. Use of the circulating circular RNA marker of claim 1 for the diagnosis of invasive papillary thyroid carcinoma.

3. Use of the circulating circular RNA marker of claim 1 for the preparation of a diagnostic kit for invasive papillary thyroid carcinoma or a medicament for the treatment of invasive papillary thyroid carcinoma.

4. A primer for a circulating circular RNA marker associated with diagnosis of invasive papillary thyroid carcinoma, wherein the primer comprises a primer for circ _0058090 and circ _0014188 circulating circular RNA.

5. Use of the primer according to claim 4 for diagnosing invasive papillary thyroid carcinoma or for preparing a diagnostic kit for invasive papillary thyroid carcinoma.

6. A diagnostic kit for invasive papillary thyroid carcinoma is characterized in that the kit contains primers of circ _0058090 and circ _0014188 circular RNA in circular RNA.

7. The diagnostic kit of claim 6, wherein the kit further comprises reagents commonly used in PCR technology.

Images