CN110982879B - LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method thereof - Google Patents

LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method thereof Download PDF

Info

Publication number
CN110982879B
CN110982879B CN201911235748.9A CN201911235748A CN110982879B CN 110982879 B CN110982879 B CN 110982879B CN 201911235748 A CN201911235748 A CN 201911235748A CN 110982879 B CN110982879 B CN 110982879B
Authority
CN
China
Prior art keywords
lamp
dna
motif
hdna
electrochemical
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911235748.9A
Other languages
Chinese (zh)
Other versions
CN110982879A (en
Inventor
许文菊
滑笑雨
廖羽梦
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Southwest University
Original Assignee
Southwest University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Southwest University filed Critical Southwest University
Priority to CN201911235748.9A priority Critical patent/CN110982879B/en
Publication of CN110982879A publication Critical patent/CN110982879A/en
Application granted granted Critical
Publication of CN110982879B publication Critical patent/CN110982879B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/6825—Nucleic acid detection involving sensors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813—Hybridisation assays
    • C12Q1/6816—Hybridisation assays characterised by the detection means
    • C12Q1/682—Signal amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N21/00—Investigating or analysing materials by the use of optical means, i.e. using sub-millimetre waves, infrared, visible or ultraviolet light
    • G01N21/75—Systems in which material is subjected to a chemical reaction, the progress or the result of the reaction being investigated
    • G01N21/76—Chemiluminescence; Bioluminescence

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Immunology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • General Physics & Mathematics (AREA)
  • Plasma & Fusion (AREA)
  • Pathology (AREA)

Abstract

The invention relates to an LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and a construction method thereof, wherein a conventional LAMP technology and electrochemical detection are combined, a double dumbbell-shaped structure intermediate formed by extending short-chain DNA of a target object is utilized for LAMP amplification, and a by-product H is generated + The i-motif conformation conversion is induced to realize the obvious change and amplification output of ratio type electrochemical signals, the complexity and the limitation of the conventional LAMP technology template DNA and primer design are avoided, the high specificity, simplicity, convenience and rapidness of LAMP are ensured, and the detection sensitivity is improved. The signal ratio of the two electrochemical probes can effectively reduce background signals, and ensure high specificity, high sensitivity, good stability and reproducibility. The electrochemical detection method established by the invention is simple, convenient and quick; other auxiliary reactants are not required to be introduced, the specificity and the sensitivity of quantitative detection are improved, the analysis time is shortened, and the detection cost is reduced.

Description

LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method
Technical Field
The invention belongs to the technical field of biosensors, and relates to a LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and a construction method thereof.
Background
In recent years, some genetic diseases, malignant tumors and the like seriously threaten the life health of human beings and cause serious economic burden to society. Wherein the AIDS is caused by Human Immunodeficiency Virus (HIV). According to the statistics of the world health organization, about 3700 ten thousand people are infected with HIV in 2016, and about 70 ten thousand people are in China. Numerous studies have demonstrated a significant increase in the risk of HIV-infected people co-infecting other viruses, such as human papillomavirus. Therefore, the method can sensitively, quickly, conveniently and accurately detect HIV specific markers (such as DNA, RNA, protein and the like), and has extremely important practical significance and social value for early diagnosis, treatment, disease tracking and the like.
Loop-mediated isothermal amplification (LAMP) is a powerful nucleic acid amplification technique that can be accomplished in closed tubes at 65 ℃ for 45min to 1 h. The amplification mechanism is that a gene sequence with the length of 150 or even more than 200 bases is taken as a target object template, under the action of DNA polymerase, 3'-OH at the tail end of a primer chain initiates nucleophilic attack on alpha-phosphorus atoms of deoxynucleotide triphosphates (dNTPs), H on the 3' -OH is replaced by nucleotide bases to release H + And pyrophosphate ion, primer does notElongation is broken to realize 10 9 And (4) magnification. Thus, a large amount of H is produced in addition to the main product of double-stranded DNA of varying length + (also, H is produced by hydrolysis of pyrophosphate) + ) Causes the pH of the LAMP reaction solution to change (LAMP-H) + )。
The LAMP technology has high specificity, simple operation, high speed and high efficiency, does not need special expensive instruments, and is widely used for detecting bacteria, viruses, biological enzyme activity, small organic molecules and transgenic food, diagnosing clinical diseases, identifying embryo sex and the like. However, there are many disadvantages, such as too long template of the amplified target, high requirement for primer design, poor recognition capability for single nucleotide polymorphism, and difficulty in accurate directional control of the amplified product. Common direct detection methods such as gel electrophoresis, nephelometry, colorimetry and fluorescence, and indirect pH meter determination greatly limit the practical application capability of the LAMP method due to low quantitative sensitivity, poor stability, inconvenient operation and the like. By changing the LAMP reaction device, such as combining with a micro-fluidic or capillary tube, the equipment is complex and has high cost, complex operation and high technical requirement; biological ligase or cutting enzyme is introduced in the LAMP reaction process, or magnetic beads form an emulsion microreactor, and then the steps of centrifugation, magnetic separation, emulsion breaking, elution and the like are performed, so that the process is complicated and time-consuming, a new reagent is introduced, the LAMP reaction process can be changed, the uncertainty and complexity of the reaction system dynamics process are increased, the LAMP reaction solution is more diversified, more potential interference and false positive signals are brought to subsequent quantitative detection, and the specificity and sensitivity of the LAMP technology are reduced to a certain extent. Recently, a double dumbbell structure DNA is formed by a target miRNA with only about 20-30 basic groups through a strand hybridization reaction through reverse transcription and a ligation reaction to initiate LAMP reaction, the design of a DNA template and a primer is greatly simplified, and the application range of LAMP is widened, but the LAMP amplification process and the product composition are complicated by the reverse transcription and the ligation reaction. Recently, LAMP-H was introduced + After dimer i-motif is induced to form, modified electrode surface is introduced to start enzyme-supported DNA walking amplification, and the electrochemical biosensor for detecting influenza virus DNA is established. The method is an electrochemical method which can amplify LAMP and has the advantages of simplicity, rapidness, high sensitivity and wide signal windowThe combination of the chemical analysis and the establishment of a novel DNA electrochemical biosensor provides a new idea and a new way. However, LAMP-H is not yet available + Report on the ratiometric electrochemical assay of the converted signal.
Disclosure of Invention
In view of the above, the invention aims to provide a LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and a construction method thereof.
In order to achieve the purpose, the invention provides the following technical scheme:
1. a method for constructing an LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor comprises the steps of reacting two single-stranded DNAs marked by different electroactive substances, dripping an obtained product onto the surface of an electrode, and dripping an LAMP reaction solution onto the surface of the electrode to complete construction of the sensor; the LAMP reaction solution is prepared by the following method: amplifying hDNA and two special stem-loop hairpin DNA templates and precursors to prepare a special double dumbbell DNA structure with an inner primer binding site, and performing LAMP amplification by taking the structure as an initial template to obtain a large amount of by-product H + The LAMP reaction solution of (1). The nucleotide sequence of hDNA is shown in SEQ ID NO. 1.
hDNA: 5'-ACTGCTAGAGATTTTCCACAT-3', as shown in SEQ ID NO. 1.
Preferably, the two single-stranded DNAs (S1 and S2) are respectively marked by ferrocene Fc and methylene blue MB to obtain Fc-S1 and MB-S2, which are electrochemical signal probes. Each nucleotide sequence is as follows:
S1：5’-SH-(CH 2 ) 6 -AATGCAGTGGGAGGGGAAGGGAGGGGACTGCATT-3' as shown in SEQ ID NO. 6;
s2: 5'-CCCCTCCCTTCCCCTCCC-3', as shown in SEQ ID NO. 7.
Further preferably, the reaction temperature of Fc-S1 and MB-S2 is room temperature (25 ℃), the reaction time is 2 hours, and the resulting product is added dropwise to the electrode surface and incubated for 16 hours.
Further preferably, the Fc-S1 is modified with thiol (-SH) and Fc at the 5 'end and 3' end of S1, respectively, the conformation in the free state is a hairpin structure, and Fc-S1 is bound to the electrode surface through Au — S bond; the MB-S2 modifies MB at the 3' end of S2, 18 bases of which are rich in 14C bases, can form an i-motif structure having a pH response, and is complementary to 18 bases of the stem and loop of Fc-S1, and can open and hybridize with Fc-S1.
Preferably, the inner primers are BIP and FIP.
Further preferably, the hybridization reaction conditions are: the PCR instrument was used to perform a closed tube reaction at 50 ℃ for 20 minutes.
Further preferably, the HT is a DNA template containing a stem-loop hairpin structure designed based on the base sequence (containing 21 bases) of hDNA, and the 3' end of the DNA template is provided with a phosphate group (PO) 4 3- ) Modifying, namely, a complementary sequence of hDNA is arranged near the 3' end; the HP is a DNA precursor containing a stem-loop hairpin structure, and 21 bases in the 3' end direction of the HP can be hybridized with 21 bases close to a complementary sequence of the hDNA in the HT; the base sequence of BIP is a section B1C-B2 of HT; the base sequence of FIP is a section F1C-F2 of HP. Each nucleotide sequence is as follows:
DNA template HT: 5'-ATCGTCGTGACTGTTTGTAATAGGACAGAGCCCCGCACTTTCAGTCACGACGATTTTATG TCTGGTCTAGGGATTATG-3', as shown in SEQ ID NO. 2;
DNA precursor HP: 5 '-CGACAGCAGAGGATTTGTTGTGTGGAAGTGTGAGCGGATTTTCCTCTGCTGTCGTTTTC ATAATCCCTAGACCAGACATCACACTTATGTGGAAAATCTCTAGCAGT-phosphate-3' as shown in SEQ ID NO. 3;
the inner primer BIP: 5'-ATCGTCGTGACTGTTTGTAATAGGACAGAGCCCCGCAC-3', as shown in SEQ ID NO. 4;
inner primer FIP: 5'-CGACAGCAGAGGATTTGTTGTGTGGAAGTGTGAGCGGA-3', as shown in SEQ ID NO. 5.
Preferably, the reaction conditions for LAMP amplification are: the reaction was carried out in a PCR apparatus at 65 ℃ for 40 minutes with the tube closed.
Preferably, the specific steps are as follows:
(1) preparing a special double dumbbell DNA structure which has the BIP and FIP binding sites of the inner primers and can be extended;
(2) adding inner primers BIP and FIP, taking the double dumbbell DNA structure as an initial template, and performing rapid, simple and efficient extension and amplificationIncreasing to obtain a product containing a large amount of a byproduct H + The LAMP reaction solution of (1);
(3) reacting the two electrochemical signal probes Fc-S1 and MB-S2 at room temperature for 2 hours, and then dropwise adding the two electrochemical signal probes Fc-S1 and MB-S2 onto the surface of a glassy carbon electrode with gold electrodeposited;
(4) and dropwise adding an LAMP reaction solution on the surface of the electrode.
Further preferably, in the step (1), the preparation method of the special double dumbbell DNA structure is as follows: the target hDNA and two special stem-loop hairpin DNA templates HT, a DNA precursor HP, DNA polymerase Bst and dNTPs react in a PCR instrument at 50 ℃ in a closed tube for 20 minutes to form a special double dumbbell DNA structure which has binding sites of the inner primers BIP and FIP and can be extended.
2. The LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor constructed by the method is provided.
3. The sensor is applied to the quantitative detection of HIV marker DNA.
4. A LAMP hydrogen ion driven i-motif conversion ratio type quantitative detection method utilizes the sensor to measure electrochemical response signals of the two electroactive substances, thereby realizing quantitative detection of hDNA.
Preferably, the specific method is as follows: after the sensor was gently washed, the Square Wave Voltammetric (SWV) electrochemical responses of Fc and MB were measured in phosphate buffered saline (PBS, pH 7.0) and quantitative detection of hDNA was achieved by the ratio of the two current signals.
The invention has the beneficial effects that:
the invention combines the conventional LAMP amplification technology with high-sensitivity electrochemical detection, and performs LAMP amplification through a double dumbbell structure intermediate formed by extending short-chain DNA of a target object, wherein a byproduct H is generated + The i-motif conformation conversion is induced to realize the obvious change and amplified output of ratio type electrochemical signals, the complexity and the limitation of the design of template DNA and primers in the conventional LAMP technology are avoided, the design of the template and the primers is simplified, the application range of the LAMP technology is widened, the high specificity, the simplicity, the convenience and the rapidness of LAMP are ensured, the detection sensitivity is improved, and the condition that the LAMP reaction byproduct H is not utilized is compensated + Ratiometric electrochemical analysis of converted signalsBlank of (2). The signal ratio of the two electrochemical probes can effectively reduce background signals, and ensure high specificity, high sensitivity, good stability and reproducibility. The electrochemical detection method established by the invention is simple, convenient and quick; other auxiliary reactants are not required to be introduced, the detection specificity and sensitivity are improved, the analysis time is shortened, and the detection cost is reduced. The summary is as follows:
(1) the invention combines the LAMP amplification with simplicity, convenience, rapidness and high electrochemical sensitivity, performs LAMP amplification through a double dumbbell structure intermediate formed by extending the short-chain DNA of the target object, does not need complex and expensive instruments, greatly simplifies the design of DNA templates and primers, and has the advantages of high efficiency, low cost, simple steps and easy operation.
(2) The invention utilizes the ratio of signal change of two signal probes, has low background signal, high sensitivity, accuracy and specificity, good stability, reproducibility and universality, and provides a new thought and way for detecting other disease marker DNA or RNA similar to hDNA.
Drawings
In order to make the object, technical scheme and beneficial effect of the invention more clear, the invention provides the following drawings for explanation:
FIG. 1 shows hairpin structures of HT, HP and Fc-S1.
FIG. 2 is a schematic diagram of the formation (A) of a LAMP reaction double dumbbell structure template and the LAMP reaction process (B). The inset shows that the white precipitate of magnesium pyrophosphate in LAMP reaction proves (+), (-) is the comparison of LAMP reaction solution without hDNA participation.
FIG. 3 is a schematic diagram of the assembly process of the ratiometric hDNA electrochemical biosensor: dripping the solution after LAMP reaction initiated by hDNA on the surface of the modified electrode, LAMP-H + Inducing i-motif structural transformation, leading the MB-S2 signal probe to leave the surface of the electrode, and reducing SWV signal; meanwhile, Fc-S1 is folded into a hairpin structure, Fc is close to the electrode surface, and the SWV signal of Fc is enhanced. The inset is a comparison of the SWV response curves of the ratiometric sensor in the absence and presence of the target hDNA.
FIG. 4 is a schematic diagram of cyclic voltammetry curves, AC impedance plots, and electrode construction process. Wherein A and B are each independentlyThe stepwise modification of the constructed ratiometric sensor was carried out at 5mM Fe (CN) 6 3-/4- The cyclic voltammetry Curves (CV) and alternating current impedance plots (EIS) are measured in the solution, and the electrodes corresponding to the curves a to e are respectively a bare Glass Carbon Electrode (GCE), depAu/GCE, S1: S2/depAu/GCE, HT/S1: S2/depAu/GCE and LAMP-H + (ii)/HT/S1: S2/depAu/GCE; c is a schematic representation of the corresponding electrode construction process (note: the S1 and S2 unmodified Fc and MB used).
FIG. 5 is a diagram of a ratio sensor constructed in phosphate buffered saline (pH 7.0, PBS containing 10mM Na) 2 HPO 4 ，10mM KH 2 PO 4 And 2mM MgCl 2 ) The electrodes corresponding to the curves b-f are depAu/GCE, Fc-S1, MB-S2/depAu/GCE, HT/Fc-S1, MB-S2/depAu/GCE and LAMP-H + MB-S2/depAu/GCE without target hDNA (blank) and with target hDNA (at a concentration of 10 pM).
FIG. 6 is a LAMP reaction gel electrophoresis, Lane M is DNA-markers (25, 50, 75, 100, 150, 200, 300, 400 and 500 bp); lane 1 target hDNA concentration 10 nM; lane 2 target hDNA concentration 1.0 pM.
Detailed Description
Preferred embodiments of the present invention will be described in detail below with reference to the accompanying drawings.
The term "room temperature" as used herein means 25 ℃.
Example (b):
(1) sequence design:
taking HIV marker DNA (hDNA) as an example, in NUPACK website (A)www.nupack.org) All base related sequences based on hDNA were designed. As shown in table 1.
TABLE 1 DNA base sequences
Figure BDA0002304830640000051
Figure BDA0002304830640000061
The hairpin structures of HT, HP and Fc-S1 are shown in FIG. 1.
(2) Formation of double dumbbell structure DNA (LAMP reaction template) (fig. 2):
in a 20. mu.L microcentrifuge tube, a total volume of 12. mu.L of various concentrations of hDNA, 0.4. mu.M HT, 0.4. mu.M HP, 2.8mM dNTPs, 8U Bst enzyme and 20mM Tris-HCl buffer solution (pH 7.4) were contained. Tris-HCl solution containing 10mM KCl, 10mM (NH) 4 ) 2 SO 4 ，4mM MgSO 4 And Triton X-100 with a mass concentration of 0.1%. The uniformly mixed solution was reacted in a PCR machine set at 50 ℃ for 20min, and then cooled to room temperature.
(3) LAMP reaction:
to the above solution was added the prepared solution (total volume 8 μ L): contains 4. mu.M BIP, 4. mu.M FIP, and 1M betaine. After the solutions were mixed uniformly, they were reacted at 65 ℃ for 40min in a PCR instrument and then cooled to room temperature. Storing at 4 deg.C for use.
(4) Electrode modification and feasibility verification (fig. 3):
bare glassy carbon electrodes (diameter 4mm) were treated with 0.3 μm and 0.05 μm Al, respectively 2 O 3 Grinding the powder, washing with secondary distilled water, and performing ultrasonic treatment in anhydrous ethanol and secondary distilled water for 20 min; putting the washed glassy carbon electrode in HAuCl with the mass concentration of 1% 4 Carrying out electrodeposition for 30s in the solution at a constant potential of-0.2V; dropwise adding the solution obtained after the Fc-S1 and the MB-S2 react at room temperature for 2 hours to the surface of the modified electrode, and standing at room temperature for 16 hours; then 10 mul of hexanethiol (concentration 0.1 mM, 96%, HT) is dripped for 30min, and nonspecific adsorption sites are closed; continuously dropwise adding 10 mu L of the solution after LAMP reaction, sealing and placing for 1 hour at room temperature, and storing the prepared electrode at 4 ℃ for later use.
Specifically, the following description is provided:
to verify successful modification of the electrodes, the electrodes were incubated with probe DNA without Fc and MB modification (S1 and S2), washed gently with double distilled water at each step, and then incubated in a medium containing 5mM [ Fe (CN) 6 ] 3-/4- In 1.0mL of a PBS solution (pH 7.0) to determine CV and EIS; the potential scanning range of CV is-0.2 to 0.6V, and the scanning speed is 100mV s -1 (ii) a EIS frequency range of 10 -1 ～10 5 Hz, trigger signalNumber 5mV, apparent potential 220 mV. (FIG. 4)
(5) Electrochemical detection and analytical performance:
after the electrode is washed mildly, square wave volt-ampere (SWV) electrochemical signals of Fc and MB are measured in 1.0mL PBS (pH 7.0) with the concentration of 1.0mL, the potential scanning range is-0.5-0.6V, and the frequency is 15 Hz; comparing the result with an SWV signal before incubation of the LAMP solution; after the LAMP reaction is carried out by measuring hDNA with different concentrations, the SWV signal of the electrode is modified, the quantitative detection of the hDNA is realized through the peak current ratio of Fc and MB, and the analysis performances such as the linear range, the lower detection limit (10 times of parallel measurement) and the like are determined. (FIG. 5)
(6) Gel electrophoresis analysis:
the LAMP reaction products of two different concentrations of hDNA were analyzed by gel electrophoresis. At room temperature, using agarose with the mass concentration of 8% and 1 xTBE buffer solution to dye by using loading buffer, adding 12 mu L of sample mixed solution, and then performing 90min at the voltage of 120V; then observed with a gel imaging system and photographed (fig. 6). It can be seen that both concentrations of hDNA (10 nM and 1pM) exhibited "ladder-like" bands (Lane 1 and Lane 2) after LAMP reaction, compared to DNA marker (Lane M, 25, 50, 75, 100, 150, 200, 300, 400 and 500 bp); that is, when hDNA exists in the detection system, LAMP amplification can occur, and amplification products with different lengths and different molecular weights and different base numbers are generated, which shows that the LAMP amplification releases H + The feasibility of (3).
Finally, it is noted that the above-mentioned preferred embodiments illustrate rather than limit the invention, and that, while the invention has been described in detail with reference to the above-mentioned preferred embodiments, it will be understood by those skilled in the art that various changes in form and detail may be made therein without departing from the scope of the invention as defined by the appended claims.
Sequence listing
<110> university of southwest
<120> LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method
<160> 7
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
actgctagag attttccaca t 21
<210> 2
<211> 78
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atcgtcgtga ctgtttgtaa taggacagag ccccgcactt tcagtcacga cgattttatg 60
tctggtctag ggattatg 78
<210> 3
<211> 107
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
cgacagcaga ggatttgttg tgtggaagtg tgagcggatt ttcctctgct gtcgttttca 60
taatccctag accagacatc acacttatgt ggaaaatctc tagcagt 107
<210> 4
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
atcgtcgtga ctgtttgtaa taggacagag ccccgcac 38
<210> 5
<211> 38
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
cgacagcaga ggatttgttg tgtggaagtg tgagcgga 38
<210> 6
<211> 34
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aatgcagtgg gaggggaagg gaggggactg catt 34
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cccctccctt cccctccc 18

Claims (7)

1. A method for constructing an LAMP hydrogen ion-driven i-motif conversion ratio type electrochemical sensor is characterized in that two DNA single chains marked by different electroactive substances are reacted, then the obtained product is dripped to the surface of an electrode, and finally LAMP reaction solution is dripped on the surface of the electrode, so that the construction of the sensor can be completed; the LAMP reaction solution is prepared by the following method: amplifying hDNA with a template HT and a precursor HP to prepare a special double dumbbell DNA structure with an inner primer binding site, and performing LAMP amplification by taking the structure as an initial template to obtain a large amount of by-product H + The LAMP reaction solution of (1);
the two DNA single chains are S1 and S2 which are respectively marked by ferrocene Fc and methylene blue MB to obtain Fc-S1 and MB-S2 which are electrochemical signal probes, the Fc-S1 is respectively modified by sulfydryl (-SH) and Fc at the 5 'end and the 3' end of S1, the conformation in a free state is a hairpin structure, and the Fc-S1 is combined to the surface of an electrode through Au-S bond; the MB-S2 modifies MB at the 3' end of S2, 18 bases of the MB are rich in 14C bases, can form an i-motif structure with pH response, is complementary to 18 bases of a stem and a loop of Fc-S1, and can open and hybridize with Fc-S1;
the HT is a DNA template which is designed according to the base sequence of the hDNA and contains a stem-loop hair clip structure, and the 3' end of the HT is provided with a phosphate group (PO 4) 3- ) Modifying, namely, a complementary sequence of hDNA is arranged near the 3' end; the HP is a DNA precursor containing a stem-loop hairpin structure, and 21 bases in the 3' end direction of the HP can be hybridized with 21 bases close to the complementary sequence of the hDNA in HT.
2. The method of claim 1, wherein the reaction temperature of Fc-S1 and MB-S2 is room temperature, the reaction time is 2 hours, and the resulting product is dripped onto the electrode surface and incubated for 16 hours.
3. The method of claim 1, wherein the inner primers are BIP and FIP.
4. The construction method according to claim 1, wherein the LAMP amplification reaction conditions are as follows: the reaction was closed in a PCR apparatus at 65 ℃ for 40 minutes.
5. The construction method according to claim 1, characterized by comprising the following specific steps:
(1) preparing a special double dumbbell DNA structure which has the BIP and FIP binding sites of the inner primers and can be extended;
(2) adding BIP and FIP as inner primers and the double dumbbell DNA structure as initial template, extending and amplifying to obtain the product containing great amount of side product H + The LAMP reaction solution of (1);
(3) reacting the two electrochemical signal probes Fc-S1 and MB-S2 at room temperature for 2 hours, and then dropwise adding the two electrochemical signal probes Fc-S1 and MB-S2 onto the surface of a glassy carbon electrode with gold electrodeposited;
(4) and dropwise adding an LAMP reaction solution on the surface of the electrode.
6. The method for constructing a double dumbbell DNA structure according to claim 5, wherein the method for preparing the special double dumbbell DNA structure is as follows: the target hDNA and two special stem-loop hairpin DNA templates HT, a DNA precursor HP, DNA polymerase Bst and dNTPs react in a PCR instrument at 50 ℃ in a closed tube for 20 minutes to form a special double dumbbell DNA structure which has binding sites of the inner primers BIP and FIP and can be extended.
7. The LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor constructed by the method of any one of claims 1 to 6.
CN201911235748.9A 2019-12-05 2019-12-05 LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method thereof Active CN110982879B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911235748.9A CN110982879B (en) 2019-12-05 2019-12-05 LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911235748.9A CN110982879B (en) 2019-12-05 2019-12-05 LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method thereof

Publications (2)

Publication Number Publication Date
CN110982879A CN110982879A (en) 2020-04-10
CN110982879B true CN110982879B (en) 2022-09-23

Family

ID=70090376

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911235748.9A Active CN110982879B (en) 2019-12-05 2019-12-05 LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method thereof

Country Status (1)

Country Link
CN (1) CN110982879B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN116908265B (en) * 2023-09-11 2023-12-12 常州先趋医疗科技有限公司 Preparation method of electrochemical biosensor for detecting LAMP amplification products of nucleic acids

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102937613B (en) * 2012-11-03 2015-07-01 福建医科大学 Electrochemistry ampere detection method for quantitively detecting polymerase chain reaction (PCR) based on methylene blue indicator
CN109797200B (en) * 2019-02-13 2022-07-19 中国科学院苏州生物医学工程技术研究所 Ratio type telomerase activity quantitative detection method

Also Published As

Publication number Publication date
CN110982879A (en) 2020-04-10

Similar Documents

Publication Publication Date Title
Kang et al. Advances in nucleic acid amplification techniques (NAATs): COVID-19 point-of-care diagnostics as an example
CN109321635B (en) Nucleic acid detection method based on multiple hybrid chain reactions and application
CN109738503B (en) Positive feedback amplification electrochemical sensor based on exonuclease III
CN109439735B (en) Fluorescent detection probe and kit for abasic endonuclease 1 and application of fluorescent detection probe and kit
CN105821138A (en) Method for constructing double-stem-loop structure DNA template to detect nucleic acid based on ligation reaction
Ma et al. Rapid, sensitive and highly specific label-free fluorescence biosensor for microRNA by branched rolling circle amplification
CN114381538B (en) LAMP primer group and detection kit for detecting nocardia meliloti
Cheng et al. Enzyme-free electrochemical biosensor based on amplification of proximity-dependent surface hybridization chain reaction for ultrasensitive mRNA detection
Zhang et al. Hybridization chain reaction circuit-based electrochemiluminescent biosensor for SARS-cov-2 RdRp gene assay
CN108588284B (en) Method for detecting HTLV-II DNA based on enzyme catalysis controllable self-assembly biological bar code
Li et al. Electrophoresis separation assisted G-quadruplex DNAzyme-based chemiluminescence signal amplification strategy on a microchip platform for highly sensitive detection of microRNA
Qin et al. Ultrasensitive fluorescent detection of nucleic acids based on label-free enzymatic-assisted cascade signal amplification
Lu et al. A dual-functional fluorescent biosensor based on enzyme-involved catalytic hairpin assembly for the detection of APE1 and miRNA-21
Li et al. A simple and rapid method to assay SARS-CoV-2 RNA based on a primer exchange reaction
CN110982879B (en) LAMP hydrogen ion driven i-motif conversion ratio type electrochemical sensor and construction method thereof
Fu et al. Electrochemical biosensing of DENV nucleic acid amplified with triplet nanostructure-mediated dendritic hybridization chain reaction
Liao et al. LAMP-H+-responsive electrochemical ratiometric biosensor with minimized background signal for highly sensitive assay of specific short-stranded DNA
KR101820440B1 (en) Method for detection of target nucleic acids
Kashefi-Kheyrabadi et al. Ultrasensitive and amplification-free detection of SARS-CoV-2 RNA using an electrochemical biosensor powered by CRISPR/Cas13a
CN109136334B (en) Rapid microRNA detection method based on Y-type DNA structure
CN111060577B (en) Ratio type electrochemical biosensor for eliminating LAMP background interference, construction method and application
ZHANG et al. Highly sensitive fluorescent aptasensor for thrombin detection based on competition triggered rolling circle amplification
Zhang et al. Dual-target nucleic acid sequences responsive electrochemiluminescence biosensor using single type carbon dots as probe for SARS-CoV-2 detection based on series catalytic hairpin assembly amplification
Wen et al. An ATP-fueled nucleic acid signal amplification strategy for highly sensitive microRNA detection
Yan et al. Electrochemical sensor propelled by exonuclease III for highly efficient microRNA-155 detection

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant