CN110982723A - Recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol - Google Patents
Recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol Download PDFInfo
- Publication number
- CN110982723A CN110982723A CN201911395507.0A CN201911395507A CN110982723A CN 110982723 A CN110982723 A CN 110982723A CN 201911395507 A CN201911395507 A CN 201911395507A CN 110982723 A CN110982723 A CN 110982723A
- Authority
- CN
- China
- Prior art keywords
- saccharomyces cerevisiae
- bisabolol
- leu
- recombinant saccharomyces
- mrbbs
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/88—Lyases (4.)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P7/00—Preparation of oxygen-containing organic compounds
- C12P7/02—Preparation of oxygen-containing organic compounds containing a hydroxy group
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y205/00—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5)
- C12Y205/01—Transferases transferring alkyl or aryl groups, other than methyl groups (2.5) transferring alkyl or aryl groups, other than methyl groups (2.5.1)
- C12Y205/0101—(2E,6E)-Farnesyl diphosphate synthase (2.5.1.10), i.e. geranyltranstransferase
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y402/00—Carbon-oxygen lyases (4.2)
- C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
- C12Y402/03138—(+)-Epi-alpha-bisabolol synthase (4.2.3.138)
Abstract
The invention discloses a recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol, belongs to the technical field of biology, and provides a recombinant saccharomyces cerevisiae S-P capable of highly producing α -bisabololTEF1‑MrBBS‑PTEF2-ispA, recombinant S-P of saccharomyces cerevisiaeTEF1‑MrBBS‑PTEF2The ispA is inoculated into a fermentation medium for fermentation for 100 hours, so that the yield of α -bisabolol in the fermentation liquid can reach 10.26g/L, the invention provides a recombinant saccharomyces cerevisiae S-MrBBS-ispA capable of producing α -bisabolol at high yield, and the recombinant saccharomyces cerevisiae S-MrBBS-ispA is usedThe yeast S-MrBBS-ispA is inoculated into a fermentation medium for fermentation for 100 hours, and the yield of α -bisabolol in the fermentation liquid can reach 9.88 g/L.
Description
Technical Field
The invention relates to recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol, belonging to the technical field of biology.
Background
α -bisabolol (α -bisabolol), also called as bisabolol and ledebouriella seselol, is one of the more unsaturated sesquiterpene compounds existing in nature, and has been widely used in the fields of medicine and cosmetics due to its functions of diminishing inflammation, inhibiting bacteria, healing ulcer, dissolving gallstone, etc.
At present, methods for producing α -bisabolol mainly include extraction methods and biological synthesis methods, wherein the extraction methods mainly separate and extract α -bisabolol-rich plants such as chamomile and chamomile to obtain high-purity α -bisabolol, however, the method for producing α -bisabolol requires obtaining a large amount of α -bisabolol-rich plants such as chamomile and chamomile, which involves transportation, storage and other steps, and is high in cost, and moreover, the method for producing α -bisabolol requires using a large amount of extractant, so that the product is easy to have medicament residues, and besides, the habitat of α -bisabolol-rich plants such as chamomile and chamomile is reduced, and the method also causes difficulty in continuously obtaining α -bisabolol from the nature.
The biological method mainly comprises the steps of heterologously expressing α -bisabolol synthetase in microorganisms, and then fermenting the microorganisms heterologously expressing α -bisabolol synthetase to obtain α -bisabolol, compared with an extraction method, the biological method has the advantages of low cost, easily obtained raw materials, no medicament residue and the like, however, the existing biological method still has certain defects, for example, in a 'Fermentative production and direct extraction of (-) - α -biochemical involved in cultured Escherichia coli', GuiHwan Han and the like, constructs a recombinant Escherichia coli capable of producing α -bisabolol, and the recombinant Escherichia coli is fermented for 48h, so that the α -bisabolol content in the fermentation liquid can only reach 0.342g/L, and the yield is low.
The above-mentioned drawbacks make the current biological method unable to really realize large-scale industrial production of α -bisabolol, and therefore, it is urgently needed to find a microorganism capable of producing α -bisabolol with high yield to overcome the above-mentioned drawbacks.
Disclosure of Invention
[ problem ] to
The technical problem to be solved by the invention is to provide the recombinant saccharomyces cerevisiae capable of producing α -bisabolol with high yield.
[ solution ]
In order to solve the technical problems, the invention provides a recombinant saccharomyces cerevisiae, which takes saccharomyces cerevisiae as a host to express a gene for coding α -bisabolol synthetase and a gene for coding farnesyl diphosphate synthase.
In one embodiment of the present invention, the amino acid sequence of α -bisabolol synthase is shown in SEQ id No. 1.
In one embodiment of the present invention, the amino acid sequence of the farnesyl diphosphate synthase is shown in SEQ ID No. 2.
In one embodiment of the present invention, the nucleotide sequence of the gene encoding α -bisabolol synthase is represented by SEQ ID No. 3.
In one embodiment of the present invention, the nucleotide sequence of the gene encoding farnesyl diphosphate synthase is shown in SEQ ID No. 4.
In one embodiment of the present invention, the recombinant saccharomyces cerevisiae uses saccharomyces cerevisiae as a host, uses the pRS305 plasmid, the pRS303 plasmid, the pRS403 plasmid, the pRS405 plasmid or the pYC48 plasmid as a vector to express a gene encoding α -bisabolol synthase, and uses the pRS305 plasmid, the pRS303 plasmid, the pRS403 plasmid, the pRS405 plasmid or the pYC48 plasmid as a vector to express a gene encoding farnesyl diphosphate synthase.
In one embodiment of the present invention, the recombinant saccharomyces cerevisiae uses saccharomyces cerevisiae as a host, uses the pRS305 plasmid as a vector to express a gene encoding α -bisabolol synthase, and uses the pRS303 plasmid as a vector to express a gene encoding farnesyl diphosphate synthase.
In one embodiment of the present inventionThe promoter P on the pRS305 plasmidT7Is replaced by promoter PTEF1Promoter PTEF2Or the promoter PADH1。
In one embodiment of the invention, the promoter P on the pRS303 plasmidT7Is replaced by promoter PTEF1Promoter PTEF2Or the promoter PADH1。
In one embodiment of the invention, the promoter PTEF1The nucleotide sequence of (A) is shown as SEQ ID No. 5.
In one embodiment of the invention, the promoter PTEF2The nucleotide sequence of (A) is shown as SEQ ID No. 6.
In one embodiment of the invention, the promoter PADH1The nucleotide sequence of (A) is shown as SEQ ID No. 7.
In one embodiment of the invention, the promoter PT7The nucleotide sequence of (A) is shown as SEQ ID No. 8.
In one embodiment of the invention, the Saccharomyces cerevisiae is Saccharomyces cerevisiae CEN. PK2-1C.
The invention also provides a method for producing α -bisabolol, which comprises the steps of inoculating the recombinant saccharomyces cerevisiae into a culture medium for fermentation to obtain a fermentation liquid containing α -bisabolol, and then extracting the fermentation liquid containing α -bisabolol to obtain α -bisabolol.
In one embodiment of the present invention, the fermentation temperature is 28 to 30 ℃, the pH is 6.0 to 8.0, and the rotation speed is 200 to 220 rpm.
The invention also provides the application of the recombinant saccharomyces cerevisiae or the method in the production of α -bisabolol.
[ advantageous effects ] (1)
(1) The invention provides a recombinant saccharomyces cerevisiae S-P capable of producing α -bisabolol with high yieldTEF1-MrBBS-PTEF2-ispA, recombinant S-P of saccharomyces cerevisiaeTEF1-MrBBS-PTEF2Inoculating ispA into a fermentation culture medium for fermentation for 100 hours, and obtaining the α -bisabolol yield in the fermentation liquidUp to 10.26 g/L.
(2) The invention provides a recombinant saccharomyces cerevisiae S-MrBBS-ispA capable of highly producing α -bisabolol, which is inoculated into a fermentation medium for fermentation for 100 hours, so that the yield of α -bisabolol in fermentation liquor can reach 9.88 g/L.
Drawings
FIG. 1: plasmid map of recombinant plasmid pRS 303-ispA.
FIG. 2: plasmid map of recombinant plasmid pRS 305-MrBBS.
FIG. 3 shows the content of α -bisabolol in fermentation broth obtained by fermentation of different recombinant Saccharomyces cerevisiae, wherein 1 is recombinant Saccharomyces cerevisiae S-MrBBS-ispA, and 2 is recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-ispA, 3 is recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-ispA, 4 is recombinant Saccharomyces cerevisiae S-PTEF2-MrBBS-ispA, 5 is recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-PTEF1-ispA, 6 is recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-PTEF2-ispA。
Detailed Description
Escherichia coli (Escherichia coli) JM109, Saccharomyces cerevisiae (Saccharomyces cerevisiae) CEN. PK2-1C referred to in the following examples were purchased from China center for Industrial culture Collection of microorganisms; pRS303 plasmid and pRS305 plasmid referred to in the following examples were purchased from proetin Biotechnology (Beijing) Co., Ltd.
The media involved in the following examples are as follows:
LB liquid medium: 10g/L of peptone and 5g/L, NaCl 10g/L of yeast extract.
LB solid medium: 10g/L of peptone, 5g/L, NaCl 10g/L of yeast extract and 15g/L of agar.
YPD liquid medium: 10g/L of yeast extract, 20g/L of tryptone and 20g/L of glucose.
YPD solid Medium: 10g/L of yeast extract, 20g/L of tryptone, 20g/L of glucose and 20g/L of agar.
Fermentation medium: yeast powder 10g/L, peptone 20g/L, initial glucose 40g/L, potassium phosphate buffer 100mmol/L, MnSO42g/L, 100 XAmmonia10ml/L of amino acid mixed solution; wherein, 100 × amino acid mixed solution: 0.5g of L-histidine, L-glutamic acid, L-glutamine, L-methionine, L-lysine, L-leucine and L-isoleucine are dissolved in 100mL of water, and filtered and sterilized. .
The detection methods referred to in the following examples are as follows:
α -determination of bisabolol content:
preparing a standard sample: preparing 10g/L of bisabolol standard sample, diluting into standard samples with concentrations of 5, 10, 20, 40 and 80mg/L respectively, and passing 1mL of the standard sample through a membrane to be tested;
sample preparation: centrifuging 1mL of fermentation liquor for 2min at the rotating speed of 1000rpm, and carrying out solid-liquid separation; centrifuging the supernatant in boiling water bath for 10min at 14000rpm for 10min, and allowing the supernatant to pass through a membrane to be tested; suspending the bacteria with 1mL of 20mM tris-HCl with pH of 7.5, crushing the cells, centrifuging at 14000rpm for 10min, and passing the supernatant through a membrane to be tested;
the high performance liquid chromatography detection method comprises the following steps: column: a C18 chromatography column; mobile phase A: 85% methanol, mobile phase B: methanol; sample introduction amount: 10 mu L of the solution; column temperature: 30 ℃; flow rate: 1 mL/min; detection wavelength: 220 nm; the detection time of each sample is 20 min; mobile phase a was used for testing the sample and mobile phase B was used for column retention.
Determination of glucose concentration: and detecting by using a glucose analyzer.
Example 1: construction of recombinant Saccharomyces cerevisiae
Synthesizing a gene ispA (nucleotide sequence is shown as SEQID No.4) of coding farnesyl diphosphate synthase (Jinweizhi company); taking ispA-F (nucleotide sequence is shown as SEQ ID No.9) and ispA-R (nucleotide sequence is shown as SEQ ID No.10) as primers, and carrying out PCR amplification on gene ispA for coding farnesyl diphosphate synthase; connecting the amplification product to the Not I site and the Pst I site of the pRS303 plasmid by Gibson assembly to obtain a connection product; transforming Escherichia coli (Escherichia coli) JM109 with the ligation product to obtain a transformation product; the transformation product was plated on LB solid medium (containing 50. mu.g.mL)-1Kanamycin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant; selecting transformants, inoculating the transformants into an LB liquid culture medium, and performing shake-flask culture for 8-12 h at 37 ℃ and 120-180 rpmThen extracting the plasmid, carrying out enzyme digestion verification and sequencing verification, and obtaining the recombinant plasmid pRS303-ispA (the plasmid map is shown in figure 1) after the verification is correct;
chemically synthesizing (Jinwei Zhi Co., Ltd.) gene MrBBS (nucleotide sequence shown as SEQ ID No. 3) coding α -bisabolol synthetase, carrying out PCR amplification on the gene MrBB coding α -bisabolol synthetase by using MrBBS-F (nucleotide sequence shown as SEQ ID No.11) and MrBBS-R (nucleotide sequence shown as SEQ ID No.12) as primers, connecting the amplified product to Not I and Pst I sites of pRS305 plasmid by Gibson assembly to obtain a connecting product, transforming the connecting product into Escherichia coli (Escherichia coli) JM109 to obtain a transformed product, and coating the transformed product on LB solid culture medium (containing 50. mu.g mL)-1Kanamycin), and performing inverted culture in a constant-temperature incubator at 37 ℃ for 8-12 h to obtain a transformant; selecting a transformant, inoculating the transformant to an LB liquid culture medium, performing shake-flask culture for 8-12 h at 37 ℃ and 120-180 rpm, extracting a plasmid, performing enzyme digestion verification and sequencing verification, and obtaining a recombinant plasmid pRS305-MrBBS (a plasmid map is shown in figure 2) after verification is correct;
integrating the linearized recombinant plasmid pRS305-MrBBS into the genome of Saccharomyces cerevisiae (Saccharomyces cerevisiae) CEN. PK2-1C by yeast self-integration to obtain a transformation product; the transformation product was applied to YPD solid medium (containing 50 mg. L)-1Leucine), and performing inverted culture in a constant temperature incubator at 30 ℃ for 48 hours to obtain a transformant, namely the recombinant saccharomyces cerevisiae S-MrBBS.
Integrating the linearized recombinant plasmid pRS303-ispA into the genome of the recombinant saccharomyces cerevisiae S-MrBBS through yeast self-integration to obtain a transformation product; the transformation product was applied to YPD solid medium (containing 50 mg. L)-1Leucine) and performing inverted culture in a constant-temperature incubator at 30 ℃ for 48 hours to obtain a transformant, namely the recombinant saccharomyces cerevisiae S-MrBBS-ispA (the genes and the primers can be shown in the table 1).
TABLE 1 nucleotide sequences of genes and primers
Example 2: verification of recombinant Saccharomyces cerevisiae
The recombinant Saccharomyces cerevisiae S-MrBBS-ispA obtained in example 1 was picked and inoculated into YPD liquid medium, and cultured at 30 ℃ and 200rpm to OD600Obtaining a culture solution; inoculating the culture solution into fresh YPD liquid medium to OD of the fresh YPD liquid medium600Cultured at 30 ℃ and 200rpm to OD 4600Obtaining a seed solution; inoculating the seed solution into a 3L fermentation tank containing 1L fermentation medium at an inoculation amount of 15% (v/v) for fermentation for 100h to obtain a fermentation solution; in the whole fermentation process, the fermentation temperature is controlled to be 30 ℃, the pH value is controlled to be 6, the ventilation volume is controlled to be 2vvm, the stirring rotating speed is related to dissolved oxygen, the dissolved oxygen is controlled to be 30% (v/v), the stirring rotating speed is controlled to be 300-900 rpm, the glucose concentration is measured by sampling every 6 hours, glucose is supplemented in time according to the consumption speed of the glucose, the glucose concentration is stabilized at 1-2 g/L, and the fermentation period is 96 hours; wherein the acid solution for adjusting the pH is 10% (v/v) phosphoric acid, and the alkali solution is 20% (v/v) ammonia water.
The content of α -bisabolol in the fermentation broth obtained by fermentation of the recombinant Saccharomyces cerevisiae S-MrBBS-ispA was detected (see FIG. 3 for the detection result).
As shown in FIG. 3, the recombinant Saccharomyces cerevisiae S-MrBBS-ispA was inoculated into the fermentation medium and fermented for 100 hours, so that the yield of α -bisabolol in the fermentation broth was as high as 9.88 g/L.
Example 3 Effect of promoter type on α -bisabolol production
On the basis of the recombinant plasmids pRS303-ispA and pRS305-MrBBS obtained in example 1, the promoter P on pRS305 plasmid and/or pRS303 plasmid was separated by PCRT7Replacement by promoter PTEF1Promoter PTEF2Or the promoter PADH1Obtaining the recombinant plasmid pRS303-PADH1-ispA、pRS303-PTEF1-ispA、pRS303-PTEF2ispA and pRS305-PADH1-MrBBS、pRS305-PTEF1-MrBBS、pRS305-PTEF2MrBBS (see Table 2 for the above promoters and primers).
The procedure of example 1 was repeated to obtain recombinant plasmid pRS303-ispA、pRS305-MrBBS、pRS303-PADH1-ispA、pRS303-PTEF1-ispA、pRS303-PTEF2ispA and pRS305-PADH1-MrBBS、pRS305-PTEF1-MrBBS、pRS305-PTEF2Combining the MrBBS and integrating the combined MrBBS into the genomes of Saccharomyces cerevisiae (Saccharomyces cerevisiae) CEN. PK2-1C to obtain the recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-ispA(pRS305-PADH1-MrBBS + pRS303-ispA), recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-ispA(pRS305-PTEF1-MrBBS + pRS303-ispA), recombinant Saccharomyces cerevisiae S-PTEF2-MrBBS-ispA(pRS305-PTEF2-MrBBS + pRS303-ispA), recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-PTEF1-ispA(pRS305-PADH1-MrBBS+pRS303-PTEF1-ispA), recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-PTEF2-ispA(pRS305-PTEF1-MrBBS+pRS303-PTEF2-ispA)。
Recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-ispA, recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-ispA, recombinant Saccharomyces cerevisiae S-PTEF2-MrBBS-ispA, recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-PTEF1-ispA, recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-PTEF2Marking ispA on YPD solid culture medium respectively, and culturing at 30 ℃ for 48h to obtain single colony; inoculating single colony into YPD liquid medium, and culturing at 30 deg.C and 200rpm to OD600Obtaining a culture solution; inoculating the culture solution into fresh YPD liquid medium to OD of the fresh YPD liquid medium600Cultured at 30 ℃ and 200rpm to OD 4600Obtaining a seed solution; inoculating the seed solution into a 3L fermentation tank containing 1L fermentation medium at an inoculation amount of 15% (v/v) for fermentation for 100h to obtain a fermentation solution; in the whole fermentation process, the fermentation temperature is controlled to be 30 ℃, the pH value is controlled to be 6, the ventilation volume is controlled to be 2vvm, the stirring rotating speed is related to dissolved oxygen, the dissolved oxygen is controlled to be 30% (v/v), the stirring rotating speed is controlled to be 300-900 rpm, the glucose concentration is measured by sampling every 6 hours, glucose is supplemented in time according to the consumption speed of the glucose, the glucose concentration is stabilized at 1-2 g/L, and the fermentation period is 96 hours; wherein the acid solution for adjusting the pH value is 10 percent(v/v) phosphoric acid, 20% (v/v) ammonia in alkaline solution.
Detection of recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-ispA, recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-ispA, recombinant Saccharomyces cerevisiae S-PTEF2-MrBBS-ispA, recombinant Saccharomyces cerevisiae S-PADH1-MrBBS-PTEF1-ispA, recombinant Saccharomyces cerevisiae S-PTEF1-MrBBS-PTEF2The content of α -bisabolol in the fermentation broth obtained by ispA fermentation (see FIG. 3 for the results of the detection).
As can be seen from FIG. 3, recombinant S-P of Saccharomyces cerevisiaeADH1Inoculating the-MrBBS-ispA into a fermentation culture medium for fermentation for 100 hours, so that the yield of α -bisabolol in the fermentation liquid can reach 8.33g/L, and recombining the saccharomyces cerevisiae S-PTEF1Inoculating the-MrBBS-ispA into a fermentation culture medium for fermentation for 100 hours, so that the yield of α -bisabolol in the fermentation liquid can reach 4.75g/L, and recombining the saccharomyces cerevisiae S-PTEF2Inoculating the-MrBBS-ispA into a fermentation culture medium for fermentation for 100 hours, so that the yield of α -bisabolol in the fermentation liquid can reach 6.52g/L, and recombining the saccharomyces cerevisiae S-PADH1-MrBBS-PTEF1Inoculating ispA into a fermentation culture medium for fermentation for 100h, leading the yield of α -bisabolol in the fermentation liquid to reach 3.33g/L, and recombining saccharomyces cerevisiae S-PTEF1-MrBBS-PTEF2The ispA is inoculated into a fermentation medium for fermentation for 100 hours, the yield of α -bisabolol in the fermentation liquid can reach 10.26g/L, only recombinant saccharomyces cerevisiae S-P is visibleTEF1-MrBBS-PTEF2The α -bisabolol yield of the-ispA is improved compared with that of the recombinant saccharomyces cerevisiae S-MrBBS-ispA, and the rest are reduced.
TABLE 2 nucleotide sequences of promoters and primers
Although the present invention has been described with reference to the preferred embodiments, it should be understood that various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.
Sequence listing
<110> Jiangsu thunder Biotech Co., Ltd
<120> recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol
<160>24
<170>PatentIn version 3.3
<210>1
<211>572
<212>PRT
<213> Artificial sequence
<400>1
Met Ser Thr Leu Ser Val Ser Thr Pro Ser Phe Ser Ser Ser Pro Leu
1 5 10 15
Ser Ser Val Asn Lys Asn Ser Thr Lys Gln His Val Thr Arg Asn Ser
20 25 30
Val Ile Phe His Asp Ser Ile Trp Gly Asp Gln Phe Leu Glu Tyr Lys
35 40 45
Glu Lys Phe Asn Val Ala Thr Glu Lys Gln Leu Ile Glu Glu Leu Lys
50 55 60
Glu Glu Val Arg Asn Glu Leu Met Ile Arg Ala Cys Asn Glu Ala Ser
65 70 75 80
Arg Tyr Ile Lys Leu Ile Gln Leu Ile Asp Val Val Glu Arg Leu Gly
85 90 95
Leu Ala Tyr His Phe Glu Lys Glu Ile Glu Glu Ser Leu Gln His Ile
100 105 110
Tyr Val Thr Tyr Gly His Lys Trp Thr Asn Tyr Asn Asn Ile Glu Ser
115 120 125
Leu Ser Leu Trp Phe Arg Leu Leu Arg Gln Asn Gly Phe Asn ValSer
130 135 140
Ser Asp Ile Phe Glu Asn His Ile Asp Glu Lys Gly Asn Phe Gln Glu
145 150 155 160
Ser Leu Cys Asn Asp Pro Gln Gly Met Leu Ala Leu Tyr Glu Ala Ala
165 170 175
Tyr Met Arg Val Glu Gly Glu Ile Ile Leu Asp Lys Ala Leu Glu Phe
180 185 190
Thr Lys Leu His Leu Gly Ile Ile Ser Asn Asp Pro Ser Cys Asp Ser
195 200 205
Ser Leu Arg Thr Glu Ile Lys Gln Ala Leu Lys Gln Pro Leu Arg Arg
210 215 220
Arg Leu Pro Arg Leu Glu Ala Val Arg Tyr Ile Ala Ile Tyr Gln Gln
225 230 235 240
Lys Ala Ser His Ser Glu Val Leu Leu Lys Leu Ala Lys Leu Asp Phe
245 250 255
Asn Val Leu Gln Glu Met His Lys Asp Glu Leu Ser Gln Ile Cys Lys
260 265 270
Trp Trp Lys Asp Leu Asp Ile Arg Asn Lys Leu Pro Tyr Val Arg Asp
275 280 285
Arg Leu Ile Glu Gly Tyr Phe Trp Ile Leu Gly Ile Tyr Phe Glu Pro
290 295 300
Gln His Ser Arg Thr Arg Met Phe Leu Met Lys Thr Cys Met Trp Leu
305 310 315 320
Ile Val Leu Asp Asp Thr Phe Asp Asn Tyr Gly Thr Tyr Glu Glu Leu
325 330 335
Glu Ile Phe Thr Gln Ala Val Glu Arg Trp Ser Ile Thr Cys Leu Asp
340 345 350
Glu Leu Pro Glu Tyr Met Lys Leu Ile Tyr His Glu Gln Phe Arg Val
355 360 365
His Gln Glu Met Glu Glu Ser Leu Glu Lys Glu Gly Lys Ala Tyr Gln
370 375 380
Ile His Tyr Ile Lys Glu Met Ala Lys Glu Gly Thr Arg Ser Leu Leu
385 390 395 400
Leu Glu Ala Lys Trp Leu Lys Glu Gly Tyr Met Pro Thr Leu Asp Glu
405 410 415
Tyr Leu Ser Asn Ser Leu Val Thr Cys Gly Tyr Ala Leu Met Thr Ala
420 425 430
Arg Ser Tyr Val Ala Arg Asp Asp Gly Ile Val Thr Glu Asp Ala Phe
435 440 445
Lys Trp Val Ala Thr His Pro Pro Ile Val Lys Ala Ala Cys Lys Ile
450 455 460
Leu Arg Leu Met Asp Asp Ile Ala Thr His Lys Glu Glu Gln Glu Arg
465 470 475 480
Gly His Ile Ala Ser Ser Ile Glu Cys Tyr Arg Lys Glu Thr Gly Ala
485 490 495
Ser Glu Glu Glu Ala Cys Met Asp Phe Leu Lys Gln Val Glu Asp Gly
500 505 510
Trp Lys Val Ile Asn Gln Glu Ser Leu Met Pro Thr Asp Val Pro Phe
515 520 525
Pro Leu Leu Ile Pro Ala Ile Asn Leu Ala Arg Val Ser Asp Thr Leu
530 535 540
Tyr Lys Asp Asn Asp Gly Tyr Asn His Ala Asp Lys Glu Val Ile Gly
545 550 555 560
Tyr Ile Lys Ser Leu Phe Val His Pro Met Ile Val
565 570
<210>2
<211>299
<212>PRT
<213> Artificial sequence
<400>2
Met Asp Phe Pro Gln Gln Leu Glu Ala Cys Val Lys Gln Ala Asn Gln
1 5 10 15
Ala Leu Ser Arg Phe Ile Ala Pro Leu Pro Phe Gln Asn Thr Pro Val
20 25 30
Val Glu Thr Met Gln Tyr Gly Ala Leu Leu Gly Gly Lys Arg Leu Arg
35 40 45
Pro Phe Leu Val Tyr Ala Thr Gly His Met Phe Gly Val Ser Thr Asn
50 55 60
Thr Leu Asp Ala Pro Ala Ala Ala Val Glu Cys Ile His Ala Tyr Ser
65 70 75 80
Leu Ile His Asp Asp Leu Pro Ala Met Asp Asp Asp Asp Leu Arg Arg
85 90 95
Gly Leu Pro Thr Cys His Val Lys Phe Gly Glu Ala Asn Ala Ile Leu
100 105 110
Ala Gly Asp Ala Leu Gln Thr Leu Ala Phe Ser Ile Leu Ser Asp Ala
115 120 125
Asp Met Pro Glu Val Ser Asp Arg Asp Arg Ile Ser Met Ile Ser Glu
130 135 140
Leu Ala Ser Ala Ser Gly Ile Ala Gly Met Cys Gly Gly Gln Ala Leu
145 150 155 160
Asp Leu Asp Ala Glu Gly Lys His Val Pro Leu Asp Ala Leu Glu Arg
165 170 175
Ile His Arg His Lys Thr Gly Ala Leu Ile Arg Ala Ala Val Arg Leu
180 185 190
Gly Ala Leu Ser Ala Gly Asp Lys Gly Arg Arg Ala Leu Pro Val Leu
195 200 205
Asp Lys Tyr Ala Glu Ser Ile Gly Leu Ala Phe Gln Val Gln Asp Asp
210 215 220
Ile Leu Asp Val Val Gly Asp Thr Ala Thr Leu Gly Lys Arg Gln Gly
225 230 235 240
Ala Asp Gln Gln Leu Gly Lys Ser Thr Tyr Pro Ala Leu Leu Gly Leu
245 250 255
Glu Gln Ala Arg Lys Lys Ala Arg Asp Leu Ile Asp Asp Ala Arg Gln
260 265 270
Ser Leu Lys Gln Leu Ala Glu Gln Ser Leu Asp Thr Ser Ala Leu Glu
275 280 285
Ala Leu Ala Asp Tyr Ile Ile Gln Arg Asn Lys
290 295
<210>3
<211>1719
<212>DNA
<213> Artificial sequence
<400>3
atgtcaactt tatcagtttc tactccttcc ttttcttcat ctccattgtc ttctgttaat 60
aagaatagca cgaagcaaca tgttactcgc aacagtgtca tcttccacga tagtatatgg 120
ggggatcaat ttcttgaata taaggagaaa ttcaatgtag ctactgagaa acagctaatc 180
gaggagctca aagaagaagt gagaaacgaa ctaatgataa gagcttgtaa tgaagcaagc 240
cgatatataa agcttataca actcattgat gtagttgaac gccttggcct agcctatcat 300
tttgaaaagg agatcgagga atccttgcaa catatctatg ttacatatgg ccataaatgg 360
accaactata acaacattga aagcctttcg ctgtggtttc gactgctacg acaaaatggc 420
ttcaacgtat catctgatat attcgagaac catatagatg agaagggaaa ctttcaggaa 480
tctttatgta atgatcctca agggatgctt gctttatacg aagcagcata tatgagggtg 540
gaaggagaaa taatactaga taaggcactc gagttcacca aactacacct tggcatcata 600
tccaatgatc cttcttgtga ctcttctcta agaacagaaa taaaacaagc tctaaagcag 660
ccgcttcgta gaaggttgcc aaggctagag gcggtgcgct acatagcaat ctaccaacaa 720
aaagcttctc acagtgaggt cttgttaaag cttgcaaagt tagacttcaa cgtgcttcaa 780
gaaatgcaca aagacgagct tagccaaatc tgcaaatggt ggaaagattt ggacattcga 840
aacaagttac catatgttcg agacagattg attgaaggct acttttggat attgggaatc 900
tatttcgagc ctcaacattc tcgtacaaga atgttcttaa tgaaaacatg catgtggtta 960
attgttttag atgatacatt tgataattat ggtacttatg aggaactcga gatatttaca 1020
caagctgtcg aaagatggtc cataacctgc ttggatgagc tgccagagta catgaaacta 1080
atatatcatg aacagtttcg tgttcaccaa gaaatggagg aatcacttga gaaggaggga 1140
aaagcatatc aaatccatta tattaaggag atggcgaaag agggcacacg cagcctttta 1200
ttagaagccaaatggttgaa agagggatac atgccaacat tagacgagta cctgtctaat 1260
tcactagtta cttgtggata tgcattgatg acagcaagat cttatgttgc ccgggatgac 1320
ggtatagtca ccgaggatgc ctttaaatgg gtggccacac atcctcctat tgtgaaagct 1380
gcatgtaaaa ttttaagact tatggatgat attgccaccc acaaggagga acaagaaaga 1440
ggccatattg cttcaagcat tgaatgctac cgaaaggaaa ctggtgcatc agaggaggaa 1500
gcatgcatgg atttcttaaa acaagtcgaa gatggttgga aggttataaa tcaggagtcg 1560
ctcatgccta cagatgtacc atttcctctc cttattcctg caatcaacct tgcgcgtgtg 1620
agtgatacct tatataaaga caatgatggc tacaatcatg ctgataaaga agtcattggt 1680
tacatcaaat cgctcttcgt tcaccctatg attgtctag 1719
<210>4
<211>900
<212>DNA
<213> Artificial sequence
<400>4
atggactttc cgcagcaact cgaagcctgc gttaagcagg ccaaccaggc gctgagccgt 60
tttatcgccc cactgccctt tcagaacact cccgtggtcg aaaccatgca gtatggcgca 120
ttattaggtg gtaagcgcct gcgacctttc ctggtttatg ccaccggtca tatgttcggc 180
gttagcacaa acacgctgga cgcacccgct gccgccgttg agtgtatcca cgcttactca 240
ttaattcatg atgatttacc ggcaatggat gatgacgatc tgcgtcgcgg tttgccaacc 300
tgccatgtga agtttggcga agcaaacgcg attctcgctg gcgacgcttt acaaacgctg 360
gcgttctcga ttttaagcga tgccgatatg ccggaagtgt cggaccgcga cagaatttcg 420
atgatttctg aactggcgag cgccagtggt attgccggaa tgtgcggtgg tcaggcatta 480
gatttagacg cggaaggcaa acacgtacct ctggacgcgc ttgagcgtat tcatcgtcat 540
aaaaccggcg cattgattcg cgccgccgtt cgccttggtg cattaagcgc cggagataaa 600
ggacgtcgtg ctctgccggt actcgacaag tatgcagaga gcatcggcct tgccttccag 660
gttcaggatg acatcctgga tgtggtggga gatactgcaa cgttgggaaa acgccagggt 720
gccgaccagc aacttggtaa aagtacctac cctgcacttc tgggtcttga gcaagcccgg 780
aagaaagccc gggatctgat cgacgatgcc cgtcagtcgc tgaaacaact ggctgaacag 840
tcactcgata cctcggcact ggaagcgcta gcggactaca tcatccagcg taataaataa 900
<210>5
<211>15
<212>DNA
<213> Artificial sequence
<400>5
aacacccaag cacag 15
<210>6
<211>14
<212>DNA
<213> Artificial sequence
<400>6
acacccagac cgcg 14
<210>7
<211>25
<212>DNA
<213> Artificial sequence
<400>7
acaatatgga cttcctcttt tctgg 25
<210>8
<211>19
<212>DNA
<213> Artificial sequence
<400>8
taatacgact cactatagg 19
<210>9
<211>40
<212>DNA
<213> Artificial sequence
<400>9
ccaccgcggt ggcggccgca tggactttcc gcagcaactc 40
<210>10
<211>45
<212>DNA
<213> Artificial sequence
<400>10
ataagcttga tatcgaattc ttatttatta cgctggatga tgtag 45
<210>11
<211>46
<212>DNA
<213> Artificial sequence
<400>11
tccaccgcgg tggcggccgc atgtcaactt tatcagtttc tactcc 46
<210>12
<211>45
<212>DNA
<213> Artificial sequence
<400>12
tcgacggtat cgataagctt ctagacaatc atagggtgaa cgaag 45
<210>13
<211>65
<212>DNA
<213> Artificial sequence
<400>13
aaaacgacgg ccagtgaatt gacaatatgg acttcctctt ttctgggcga attggagctc 60
caccg 65
<210>14
<211>25
<212>DNA
<213> Artificial sequence
<400>14
caattcactg gccgtcgttt tacaa 25
<210>15
<211>69
<212>DNA
<213> Artificial sequence
<400>15
ttgtaaaacg acggccagtg aattgacaat atggacttcc tcttttctgg gcgaattgga 60
gctccaccg 69
<210>16
<211>25
<212>DNA
<213> Artificial sequence
<400>16
caattcactg gccgtcgttt tacaa 25
<210>17
<211>55
<212>DNA
<213> Artificial sequence
<400>17
aaaacgacgg ccagtgaatt gaacacccaa gcacaggcga attggagctc caccg 55
<210>18
<211>25
<212>DNA
<213> Artificial sequence
<400>18
caattcactg gccgtcgttt tacaa 25
<210>19
<211>59
<212>DNA
<213> Artificial sequence
<400>19
ttgtaaaacg acggccagtg aattgaacac ccaagcacag gcgaattgga gctccaccg 59
<210>20
<211>25
<212>DNA
<213> Artificial sequence
<400>20
caattcactg gccgtcgttt tacaa 25
<210>21
<211>54
<212>DNA
<213> Artificial sequence
<400>21
aaaacgacgg ccagtgaatt gacacccaga ccgcggcgaa ttggagctcc accg 54
<210>22
<211>25
<212>DNA
<213> Artificial sequence
<400>22
caattcactg gccgtcgttt tacaa 25
<210>23
<211>58
<212>DNA
<213> Artificial sequence
<400>23
ttgtaaaacg acggccagtg aattgacacc cagaccgcgg cgaattggag ctccaccg 58
<210>24
<211>25
<212>DNA
<213> Artificial sequence
<400>24
caattcactg gccgtcgttt tacaa 25
Claims (10)
1. A recombinant saccharomyces cerevisiae is characterized in that the recombinant saccharomyces cerevisiae takes saccharomyces cerevisiae as a host to express a gene for coding α -bisabolol synthetase and a gene for coding farnesyl diphosphate synthetase.
2. The recombinant saccharomyces cerevisiae as claimed in claim 1, wherein the amino acid sequence of α -bisabolol synthase is shown as SEQ ID No.1, and the amino acid sequence of farnesyl diphosphate synthase is shown as SEQ ID No. 2.
3. The recombinant Saccharomyces cerevisiae of claim 1 or 2, wherein the recombinant Saccharomyces cerevisiae uses Saccharomyces cerevisiae as a host, pRS305, pRS303, pRS403, pRS405 or pYC48 as a vector to express a gene encoding α -bisabolol synthase, and pRS305, pRS303, pRS403, pRS405 or pYC48 as a vector to express a gene encoding farnesyl diphosphate synthase.
4. The recombinant Saccharomyces cerevisiae as claimed in any of claims 1-3, wherein the recombinant Saccharomyces cerevisiae uses Saccharomyces cerevisiae as host, uses pRS305 plasmid as vector to express the gene encoding α -bisabolol synthase, and uses pRS303 plasmid as vector to express the gene encoding farnesyl diphosphate synthase.
5. The recombinant Saccharomyces cerevisiae as claimed in any of claims 1-4, wherein the promoter P on the pRS305 plasmidT7Is replaced by promoter PTEF1Promoter PTEF2Or the promoter PADH1。
6. The recombinant Saccharomyces cerevisiae as claimed in any of claims 1-5, wherein the promoter P on the pRS303 plasmidT7Is replaced by promoter PTEF1Promoter PTEF2Or the promoter PADH1。
7. The recombinant Saccharomyces cerevisiae yeast according to any of claims 1-6, wherein said promoter PTEF1The nucleotide sequence of (A) is shown as SEQ ID No. 5.
8. The recombinant Saccharomyces cerevisiae yeast according to any of claims 1-7, wherein said promoter PTEF2The nucleotide sequence of (A) is shown as SEQ ID No. 6.
9. A method for producing α -bisabolol, which comprises inoculating the recombinant saccharomyces cerevisiae of any one of claims 1-8 into a culture medium for fermentation to obtain a fermentation broth containing α -bisabolol, and extracting the fermentation broth containing α -bisabolol to obtain α -bisabolol.
10. Use of the recombinant saccharomyces cerevisiae according to any of claims 1-8 or the method according to claim 9 for the production of α -bisabolol.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911395507.0A CN110982723A (en) | 2019-12-30 | 2019-12-30 | Recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911395507.0A CN110982723A (en) | 2019-12-30 | 2019-12-30 | Recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110982723A true CN110982723A (en) | 2020-04-10 |
Family
ID=70078934
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911395507.0A Pending CN110982723A (en) | 2019-12-30 | 2019-12-30 | Recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110982723A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877228A (en) * | 2021-01-22 | 2021-06-01 | 浙江工业大学 | Saccharomyces cerevisiae engineering bacterium for high yield of bisabolene and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300726A (en) * | 2018-01-08 | 2018-07-20 | 苏州大学 | α-bisabolol synthetic plasmid and its construction method and colibacillus engineering strain |
| CN109913380A (en) * | 2019-03-25 | 2019-06-21 | 南京工业大学 | Produce (-)-α-bisabolol recombination Yarrowia lipolytica and its construction method and application |
| CN110016458A (en) * | 2019-04-24 | 2019-07-16 | 江南大学 | A kind of fermentation synthesis α-bisabolol engineered strain and its construction method |
| KR102016056B1 (en) * | 2018-04-19 | 2019-08-29 | 국민대학교 산학협력단 | Method for producing bisabolol using transformed yeast |
-
2019
- 2019-12-30 CN CN201911395507.0A patent/CN110982723A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108300726A (en) * | 2018-01-08 | 2018-07-20 | 苏州大学 | α-bisabolol synthetic plasmid and its construction method and colibacillus engineering strain |
| KR102016056B1 (en) * | 2018-04-19 | 2019-08-29 | 국민대학교 산학협력단 | Method for producing bisabolol using transformed yeast |
| CN109913380A (en) * | 2019-03-25 | 2019-06-21 | 南京工业大学 | Produce (-)-α-bisabolol recombination Yarrowia lipolytica and its construction method and application |
| CN110016458A (en) * | 2019-04-24 | 2019-07-16 | 江南大学 | A kind of fermentation synthesis α-bisabolol engineered strain and its construction method |
Non-Patent Citations (3)
| Title |
|---|
| AIG92846.1: "sesquiterpene synthase 1 [Matricaria chamomilla var. recutita]", 《NCBI_BLAST》 * |
| WP_000347217.1: "MULTISPECIES: (2E,6E)-farnesyl diphosphate synthase [Proteobacteria]", 《NCBI_BLAST》 * |
| YOUNG-JIN SON 等: "Enantioselective microbial synthesis of the indigenous natural product ( − )-α-bisabolol by a sesquiterpene synthase from chamomile (Matricaria recutita)", 《BIOCHEMICAL SOCIETY》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112877228A (en) * | 2021-01-22 | 2021-06-01 | 浙江工业大学 | Saccharomyces cerevisiae engineering bacterium for high yield of bisabolene and application thereof |
| CN112877228B (en) * | 2021-01-22 | 2022-06-21 | 浙江工业大学 | Saccharomyces cerevisiae engineering bacterium for high yield of bisabolene and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110106209B (en) | Method for positioning and synthesizing terpenoid by using yarrowia lipolytica pathway | |
| CN113234652B (en) | Construction method and application of engineering bacteria for efficiently synthesizing ergothioneine | |
| CN113755354B (en) | Recombinant saccharomyces cerevisiae for producing gastrodin by utilizing glucose and application thereof | |
| CN113151024A (en) | Saccharomyces cerevisiae engineering strain for fermenting and synthesizing tetrahydropyrimidine | |
| CN114196646B (en) | Olive alcohol synthetase variant A and application thereof | |
| CN110982723A (en) | Recombinant saccharomyces cerevisiae and application thereof in production of α -bisabolol | |
| CN112661820B (en) | Rhizobium tianshanense transcription regulation protein MsiR mutant protein and application thereof in canavanine biosensor | |
| CN111004730A (en) | Method for producing ergothioneine | |
| CN112708569B (en) | Yeast engineering bacterium for producing chondroitin sulfate by fermentation and application thereof | |
| CN112175919A (en) | Lactone hydrolase mutant and application thereof | |
| CN112080479A (en) | 17 beta-hydroxysteroid dehydrogenase mutant and application thereof | |
| CN105647958B (en) | Saccharomyces cerevisiae engineering bacterium for producing 2-phenylethyl alcohol and preparation method and application thereof | |
| CN111172089A (en) | Method for synthesizing trehalose by using recombinant trehalose synthase | |
| CN115873836A (en) | Nerolidol synthetase and application thereof | |
| CN111349575B (en) | Pichia pastoris engineering bacteria for constitutive expression of porcine pepsinogen C and application thereof | |
| CN109337852B (en) | Application of recombinant Klebsiella in production of 1, 3-propylene glycol | |
| CN111718884A (en) | BVG90_08615 gene-deleted serratia marcescens engineering bacterium | |
| CN112029782A (en) | Beta-carotene hydroxylase, gene and application thereof | |
| CN111718948B (en) | Gene and application thereof in production of mannich | |
| CN114231429B (en) | Recombinant bacterium for expressing candida glycerinogenes RNA helicase and application thereof | |
| CN113549643B (en) | Method for improving synthesis of prodigiosin by Serratia marcescens through overexpression of gene psrB | |
| CN102352337B (en) | Recombinant bacteria expressed by escherichia coli genome N-acetylase by control of heterogenous promoter, and use thereof | |
| CN111349576B (en) | Pichia pastoris engineering bacteria for constitutive expression of porcine pepsinogen A and application thereof | |
| CN115074302A (en) | Recombinant gene engineering bacterium for producing (-) -alpha-bisabolol and preparation method and application thereof | |
| CN113736789A (en) | Application of N-terminal sequence element in regulation and control of saccharomyces cerevisiae protein expression |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200410 |
|
| RJ01 | Rejection of invention patent application after publication |