CN110982713B - Leptospermum scoparium and application thereof - Google Patents
Leptospermum scoparium and application thereof Download PDFInfo
- Publication number
- CN110982713B CN110982713B CN202010039597.6A CN202010039597A CN110982713B CN 110982713 B CN110982713 B CN 110982713B CN 202010039597 A CN202010039597 A CN 202010039597A CN 110982713 B CN110982713 B CN 110982713B
- Authority
- CN
- China
- Prior art keywords
- southern
- cells
- cell
- strain
- hepg2
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K36/00—Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
- A61K36/06—Fungi, e.g. yeasts
- A61K36/07—Basidiomycota, e.g. Cryptococcus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Natural Medicines & Medicinal Plants (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Pharmacology & Pharmacy (AREA)
- Biochemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Botany (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Alternative & Traditional Medicine (AREA)
- Medical Informatics (AREA)
- Epidemiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a southern hetero-basidiomycete, which is classified and namedHeterobasidion australeAnd the strain is preserved in China general microbiological culture collection center in 2019, 12 and 23 months, and the preservation number is CGMCC 19148. Experiments prove that the southern iso-basidiomycetes has obvious inhibition effect on HepG2 cells and remarkable curative effect, so that the southern iso-basidiomycetes can be used as raw materials for preparing the medicine for inhibiting the tumor, such as: culturing the strain to obtain a culture, and processing with or without other medicines, adjuvants, etc. to obtain the microbial inoculum. The invention provides excellent strain resources for researching tumor inhibition mechanism, application, drug development and the like of the southern hetero-basidiomycetes.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a southern hetero-basidiomycete and application thereof.
Background
Liver cancer is a malignant tumor that occurs in the liver. According to related researches, about 100 ten thousand liver cancer patients exist in the world every year, the incidence rate of the liver cancer patients is about 50 percent in China, the morbidity rate is 3 rd in the world, and the mortality rate is 2 nd in the world, so that the liver cancer patients are one of the main cancers seriously threatening the health and the life of people. Surgical resection, chemotherapy, radiotherapy and the like are some traditional cancer treatment modes, but the treatment methods are determined according to the specific conditions of patients, are not generally applicable to all patients, and can achieve better effect by treating tumors through the surgical resection method, but the clinical treatment of patients suitable for surgical treatment only accounts for about 20%, so the surgical resection method cannot be popularized. The existing treatment mode is mature chemotherapy, but the side effect is large, and the harm to patients is high. Radiotherapy has a good inhibitory effect on local tumors, but has a poor therapeutic effect on metastatic tumors. In recent years, the incidence of liver cancer is on a continuous rising trend, and therefore, development of novel drugs for preventing and treating liver cancer is urgently needed.
China is wide in territory, has rich medicinal fungus resources, is the earliest country for treating diseases by using fungi as medicines, and has more than 2000 years of history today. The rapid development of modern science and technology enables more and more medicinal fungal species resources and active ingredient resources to be explored and applied, and many researches prove that some medicinal fungi have the effects of enhancing immunity, promoting tumor cell apoptosis and inhibiting tumor cell proliferation, show direct or indirect anti-tumor efficacy, have obvious effect on treating tumors, and become the research focus for developing medicaments for preventing and treating tumors.
The medicinal fungus has great difference with the traditional chemical and biological products used for treating the tumor, has comprehensive treatment effects of multiple links, multiple ways, multiple layers, multiple targets and multiple mechanisms on the tumor, and has better sensitivity and adaptability of human bodies to the medicinal fungus. The medicinal fungi as the medicine has the advantages of low toxic and side effects, no toxicity and harm to human bodies, and the characteristics of homology of food and medicine, and most of the medicinal fungi can be subjected to expanded culture by means of artificial cultivation or liquid fermentation and the like, and can provide stable raw material sources for development of related medicines, so that the development of new anti-tumor fungi medicines has wide and good market prospects, and the economic benefit and the social benefit are remarkable. The medicinal fungi can provide a wider space for treating tumors for human beings, and the research and development of novel antitumor medicines from medicinal fungi become a research focus in the field of biotechnology.
Disclosure of Invention
In order to solve the problems, the southern xenobasidium strain with a remarkable curative effect on HepG2 cells is obtained by screening, and the screened strain is determined to be the southern xenobasidium strain through identification.
The invention is realized by the following technical scheme:
a strain of southern hetero-basidiomycetes, which is classified and namedHeterobasidion australeThe strain has been preserved in China general microbiological culture Collection center (CGMCC) in 2019, 12 and 23 months, and the preservation number is CGMCC No. 19148.
Experiments prove that the southern iso-basidiomycetes has obvious inhibition effect on HepG2 cells and remarkable curative effect, so that the southern iso-basidiomycetes can be used as raw materials for preparing the medicine for inhibiting the tumor, such as: culturing the strain to obtain a culture, and processing with or without other medicines, adjuvants, etc. to obtain the microbial inoculum. The invention provides excellent strain resources for researching tumor inhibition mechanism, application, drug development and the like of the southern hetero-basidiomycetes.
Advantageous effects
According to the invention, the alcohol precipitation sample of the southern isobasidiomycetes is applied to the HepG2 cell, and the sample is added in a proper sample adding time, so that the southern isobasidiomycetes has an obvious inhibiting effect, and a theoretical support is provided for developing a novel anti-tumor drug, and a foundation is laid.
Information on strain preservation
Preservation time: 12 months and 23 days 2019;
the preservation unit: china general microbiological culture Collection center;
the preservation number is: CGMCC NO. 19148;
the address of the depository: the preservation address is microbial research institute of China academy of sciences No. 3 of Xilu No.1 of Beijing, Chaoyang district;
and (3) classification and naming: leptospira interrogans (berk.) KuntzeHeterobasidion australe。
Drawings
FIG. 1 HepG2 cell growth curve;
FIG. 2531 effect of time-varying sample treatment on the inhibition rate of HepG2 cell proliferation;
FIG. 3 inhibition of HepG2 cell proliferation after 2 d dosing;
FIG. 43 half inhibitory concentration of samples after treatment of HepG2 cells 2 d;
FIG. 5 cell morphology observation.
Detailed Description
The following examples are given for the detailed implementation and specific operation of the present invention, but the scope of the present invention is not limited to the following examples.
Southern hetero-basidiomycete Y04163 in the examples below2 collecting fruiting body on the stump of Chinese hemlock Tree in Huangshan forest park of Anhui province 10/13 days 2015, separately culturing on PDA culture medium by using fresh and clean fruiting body tissue to obtain pure culture of the strain, wherein the collection is classified under the name ofHeterobasidion australeThe microbial inoculum is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the microbial research institute of China academy of sciences No. 3, Xilu No.1, Beijing, Chaoyang, the preservation date is 2019, 12 and 23 days, and the preservation number is CGMCC NO. 19148.
Morphological characteristics of fruiting bodies: the fruiting body grows for many years, is flat to roll or has a mushroom cap, is usually covered with tile-shaped, is fresh, is leathery, is woody after being dried, and is tasteless. The pileus is semicircular to sector, can extend to 3 cm long and 7 cm wide, and the basal part reaches 7 mm thick. The surface of the pileus is white to cream color when young, and becomes reddish brown to dark brown after old, at least the basal part is reddish brown, the annular band is not obvious, the edge is white to cream color, and the shape is changed from sharp to blunt circle; the surface of the opening is white when fresh, and the dried cream is light yellow and has refraction reaction; the most of the fungus holes are all edges, occasionally, water caltrops are arranged, and each millimeter is 4-5; the fungus tube has thin wall and is not torn. The mushroom meat is creamy, hard and woody, and is not banded, the thickness is 2 mm, and the shell is very thin. The fungus tube cream is light yellow brown, hard wood, and the length is up to 5 mm.
The microstructure is characterized in that hyphae are multiple, the reproductive hyphae are not in locked joint, skeleton hyphae IKI-, CB +, hyphae are not changed in KOH, the reproductive hyphae in fungus meat are transparent, thin-walled and obviously and simply separated and branched, the width of 2-4 mu m is larger, the skeleton hyphae in fungus meat are obvious, transparent and thick-walled, have narrow inner cavities and few branches, and are obviously bent and arranged in an interlaced mode, and the width of 3.5-5 mu m is larger than that of the reproductive hyphae in a fungus tube, the thin-walled and obviously and simply separated and occasionally branched, the width of 2-3.5 mu m is larger than that of the reproductive hyphae in the fungus tube, the skeleton hyphae in the fungus tube are obvious, transparent and thick-walled, have medium and slightly narrow inner cavities, few branches and obviously bent and arranged in an interlaced mode, the width of 2-4.5 mu m is smaller than that of an cyst and a pseudocyst, the short stick shape of a basidiophore is cylindrical, the basidiophore has four basidiophore hyphae, the base has a simple separation, the size of 10-16- × -6 mu m, the basidiophore is similar to the shape of the basidiophore, but the smaller basidiophore is wider than that of the conidia, the hemisphere, the size of the average size of the (-3.5-6. sub-6. mu. sub-6. sub-5, the (-3.5 < 5 < 1.5 < 5.
And (3) identifying the strain molecules: extracting DNA from the sporocarp and the mycelium by using a kit, amplifying and sequencing by using ITS5/ITS4 primers, wherein the common rDNA-ITS sequence of the sporocarp and the mycelium is as follows:
CGAATATCGTGCAAGGTTGTCAGCTGGCCTCTCGGGGCATGTGCTCGCCTTGTTCATATATCCATCTCACACCTGTGCACACTCGCGTGGGTCGGTCGGGGGTTTTCTCTTTCGAGATCTCTCCCCTTCCGAGCCGCGTCTTCACACAAACACTTTGTATGTCTTCAGAATGGTATCAATGCTATAAAAACGCATCTAATACAACTTTCAACAATGGATCTCTCGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCACGCCTGTTTGAGTGTCGTGAAATTCTCAACCCTGTGCTTTTCTTGTGAAAGCGCGTGGGCTTGGACTTGGAGGCTTTGCTGGTCCTTGCGGATCGGCTCCTCTCAAATGCATTAGCGAGACCCTTGTGGTGCCGCCCCCGGTGTGATAATTGTCTACGCCGTGGTGGTGCGCCGCGATTGTGGGGGACCTGCTTCCAACCGTCGAAAGACAACTTTATCGAAAC。
example 1 alcohol precipitated sample of southern Isobasidiomycetes
Preparing an alcohol precipitation sample of the southern isopsoromyces:
1. activation of bacterial species
Taking one stored test tube mother seed, transferring a strain block with the diameter of 0.8cm into the prepared plate culture medium, culturing and activating in an electric heating constant temperature incubator at 25 ℃, inverting, and culturing for 6-7 days in a dark place.
And when the diameter of the plate activated hyphae is 4-6cm, activating liquid strains by using the activated plate strains.
500 ml triangular flask, each flask contains 100 plus 200 ml of culture medium, each flask is connected with 6-10 fungus blocks with the size of 0.8cm × 0.8.8 cm, and the mixture is placed on a double-layer full-temperature shaking table at 23-27 ℃ and is subjected to shake culture at 120 plus 150r/min for 5-6 days.
2. Liquid fermentation culture of southern hetero-basidiomycetes
Inoculating the activated liquid strain into a prepared sterile liquid culture medium (the formula of the culture medium comprises 1 percent of corn starch, 1 percent of glucose, 1 percent of maltose, 0.2 percent of peptone, 0.3 percent of yeast extract, 0.1 percent of potassium dihydrogen phosphate and 0.05 percent of magnesium sulfate) by an inoculation amount of 5-10 percent, placing the culture medium in a double-layer full-temperature shaking table at 23-27 ℃, shaking and culturing for 6-8 days at the temperature of 120-.
3. Preparation of southern iso-basidiomycete fermentation liquor alcohol precipitation sample
Taking out the shake flask after terminating fermentation, filtering the fungus balls by a 200-mesh gauze, concentrating the collected fermentation liquor under reduced pressure to 1/8-1/10 of the original volume, then adding 95% alcohol of 4-5 times into the concentrated fermentation liquor and fully mixing to ensure that the alcoholic strength of the mixed solution is about 65% -75%, and then standing and precipitating with alcohol for 24h at 4-15 ℃. And after the alcohol precipitation is finished, centrifuging for 10-30 min at the speed of 5000 r/min by using a low-speed large-capacity multi-tube centrifuge, and obtaining a precipitate, namely an alcohol precipitation sample of the southern iso-basidiomycete fermentation liquor.
Example 2
1 materials and methods
1.1 materials
1.1.1 test samples
The medicinal fungus southern iso-basidiomycete alcohol precipitation sample is numbered 531, the medicinal fungus microapertussis perennial fungus alcohol precipitation sample is numbered 525, and the medicinal fungus microapertussis harderian alcohol precipitation sample is numbered 526, and is provided by Shandong province of Qingdao agricultural university for fungus key laboratory.
1.1.2 test cell lines
Human liver cancer HepG2 cell, as a gift from Tianjin university.
1.1.3 drugs and reagents
TABLE 1 drugs
MTT solution 0.25 g MTT powder is accurately weighed by a high-precision electronic balance, dissolved in a centrifuge tube by a small amount of PBS buffer solution in an ultrasonic mode and then subjected to constant volume to 50 m L, filtered and sterilized by a 0.22 mu m microporous filter membrane in an ultrasonic workbench, subpackaged in a 1.5m L sterilized centrifuge tube and stored in a refrigerator at 4 ℃ in a dark place.
5-Fu solution: accurately weighing 0.25 g of 5-Fu powder with a high-precision electronic balance, adding a small amount of DMSO solution, and performing ultrasonic treatmentDissolving completely, diluting to 10 m L with DMEM complete culture medium to obtain 25 g/L of 5-Fu solution, mixing, collecting 40 μ L stock solution, diluting to 10 m L with DMEM complete culture medium to obtain 100 mg/L of 5-Fu solution, filtering with 0.22 μm microporous membrane in sterile environment for sterilization, and storing in 4 deg.C refrigerator[5]。
DMEM complete culture medium, namely adding 0.5 m L streptomycin mixed solution, 5m L fetal calf serum and 0.5 m L nonessential amino acid into a 50 m L centrifuge tube, fixing the volume to 50 m L by using a DMEM basic culture medium, filtering and sterilizing by using a 0.22 mu m microporous filter membrane, and storing in a refrigerator at 4 ℃ for later use.
0.25% trypsin solution, accurately weighing 0.25 g trypsin powder with a high-precision electronic balance, adding a small amount of PBS solution, carrying out ultrasonic treatment to fully dissolve the trypsin powder, fixing the volume to 100 m L with the PBS solution, carrying out filtration sterilization with a 0.22 mu m microporous filter membrane under the aseptic condition, subpackaging the sterilized solution into a centrifuge tube, and storing the centrifuge tube in a refrigerator at the temperature of-20 ℃ for later use.
The formula of the cell cryopreservation solution comprises: fetal bovine serum: DMSO, DMSO: DMEM medium = 9: 1: 1.
1.1.4 instruments and apparatus
TABLE 2 Instrument
1.2 methods
1.2.1 preparation of gradient drug-containing culture Medium with different concentrations
Accurately weighing 125 mg of sample by a high-precision electronic balance into a centrifuge tube containing 2 m L complete culture medium, carrying out ultrasonic treatment to fully dissolve the sample, centrifuging for 5 min at 5000 rpm, collecting supernatant, drying precipitate, weighing, filtering and sterilizing the supernatant in a super clean bench by using a 0.22 mu m microporous filter membrane to obtain 62.5 mg/m L sample solution, fully and uniformly mixing the sample solution, absorbing 200 mu L, adding the sample solution into the centrifuge tube containing 800 mu L complete culture medium to obtain 12.5 mg/m L sample solution, and sequentially diluting according to the method to obtain 2.5, 0.5, 0.1 and 0.02 mg/m L6 sample solutions, wherein 6 sample solutions with the concentration sequentially marked as C from low to high1-C6。
1.2.2 cell Resuscitation
The cryovial of HepG2 cells was removed from the freezer at ultra low temperature (-80 ℃) and placed in a 38 ℃ water bath for rapid thawing, shaking occasionally, and thawing thoroughly within 1 min. It was transferred to a centrifuge tube in an ultraclean bench and centrifuged at 1000 rpm for 5 min. Removing supernatant with sterilizing gun head, adding appropriate amount of DMEM complete culture medium, blowing with pipette, transferring cell suspension to cell culture bottle, adding appropriate amount of complete culture medium, and adding 5% CO2And culturing in a constant temperature and humidity incubator at 37 ℃.
1.2.3 cell passages
After the cells in the culture bottle overgrow with adherent cells, discarding the old culture solution in a super clean bench, adding 2 m L PBS for washing, repeating twice, adding 1.5m L0.25.25% pancreatin for 2 min, discarding the pancreatin solution, adding 2 m L complete culture medium to stop pancreatin digestion, fully blowing the cells with a pipette to prepare uniform cell suspension, sucking 1 m L suspension, transferring to a new cell culture bottle, adding a proper amount of complete culture medium, placing the culture bottle in a culture bottle containing 5% CO2And culturing in a constant temperature and humidity incubator at 37 ℃.
1.2.4 cell cryopreservation
Washing the adherent and overgrown cells with 2 m L PBS in a super clean workbench, repeating twice, adding a trypsin solution for digestion for 2 min, adding a complete culture medium to stop digestion, fully and uniformly blowing with a pipette gun, transferring the cell suspension into a centrifuge tube, centrifuging at 1000 rpm for 5 min, discarding the supernatant under aseptic conditions after centrifugation, adding a cell freezing solution, slightly blowing with a pipette gun to make the cells uniform, then subpackaging the cell suspension into a freezing tube, and storing in an ultra-low temperature refrigerator at-80 ℃.
1.2.5 mapping of HepG2 cell growth curves
Washing the adhered HepG2 cells in the culture plate by PBS, digesting by 0.25 percent trypsin solution, adding a proper amount of complete culture medium, repeatedly blowing the cells by a pipette gun to prepare uniform cell suspension, sucking a small amount of cell suspension into a blood counting chamber,counting under an optical microscope to obtain 2 × 104The cell suspension with the concentration of L per m is evenly inoculated into a 96-well plate, each well is inoculated with 100 mu L of the cell suspension, a blank group is paved on the outermost circle of wells, namely, 200 mu L of PBS solution is added into each well, and then the wells are placed at 37 ℃ and contain 5 percent CO2Constant temperature and humidity CO2Sequentially culturing 1, 2, 3, 4, 5, 6, 7, 8 and 9 days in an incubator, changing the culture solution every 3 days, measuring the light absorption value of cells in an enzyme-labeled analyzer every 1 day by using an MTT method, discarding the supernatant of each hole, adding 20 mu L5 mg/m L MTT solution and 80 mu L complete culture solution, placing at 37 ℃ and 5 percent CO2Constant temperature and humidity CO2And (3) continuously culturing for 4 hours in the incubator, then removing supernatant, adding 150 mu L DMSO solution into each well, slightly shaking and shaking on a horizontal shaking table for 15 min, placing the cells into an enzyme-labeled analyzer to measure the OD value of the cells at 490 nm, calculating the average value of light absorption values, and drawing a HepG2 cell growth curve by taking the culture time as the abscissa and the OD value as the ordinate.
1.2.6 HepG2 cell proliferation inhibition assay
Digesting and culturing adherent cells in 0.25% pancreatin solution in a clean bench for 2 min, terminating digestion with DMEM complete culture medium, blowing uniformly with a pipette gun, counting with a blood counting chamber, and making into 2 × 104Uniformly inoculating the prepared cell suspension to a 96-well plate, inoculating 100 mu L of the cell suspension to each well, paving blank groups in the outermost circle of wells, namely inoculating 200 mu L of PBS to each well, and sequentially arranging a negative control group (complete culture medium), a positive control group (5-Fu solution) and a drug group (marked as C in 1.2.1 respectively)1-C6). Each set was set with 6 replicates. Then put into a furnace at 37 ℃ and containing 5 percent of CO2Constant temperature and humidity CO2Respectively culturing in incubator for 1, 2, and 3 d, discarding old culture solution in the culture plate, adding MTT solution of 20 μ L5 mg/m L and DMEM complete culture medium of 80 μ L, and adding CO2After further incubation for 4h, 150. mu. L of DMSO was added to each well, the wells were placed on a horizontal shaker and shaken gently for 15 min, and the OD of the cells at 490 nm was measured in a microplate reader.
Cell growth inhibition (%) = (control OD value-dosing OD value)/control OD value × 100%.
After the inhibition rates of samples with different concentration gradients are calculated by Excel software, the half-inhibition concentration IC of the test sample on the proliferation of HepG2 cells is calculated by utilizing Graphpad prism7 software50The value is obtained.
1.2.7 cell morphology observations
After the cells in the culture bottle overgrow with adherent cells, discarding the old culture solution in a super clean bench, adding 2 m L PBS for washing, repeating twice, adding 1.5m L0.25.25% pancreatin for digestion for 2 min, discarding the pancreatin solution, adding 2 m L complete culture medium to stop pancreatin digestion, fully blowing with a pipette to prepare uniform cell suspension, counting with a blood counting chamber, and finally preparing 2 × 104Cell suspension of L/m the prepared cell suspension was uniformly inoculated into a 96-well plate, each well was inoculated with 100. mu. L of the above cell suspension, and the outermost circle of wells was filled with a blank set of 200. mu. L of PBS per well at 37 ℃ with 5% CO2Constant temperature and humidity CO2Culturing in an incubator for a certain time, adding medicine, and continuously culturing for a certain time. And at corresponding time, respectively observing the suspension, adherence and shape after dosing of the cells under an inverted microscope.
1.2.8 statistical method
Statistical analysis was performed using SPSS 23.0, single factor analysis of variance was used, and comparisons of pairs were tested using L SD-t, with P <0.05 being statistically significant.
2. Results and analysis
2.1 HepG2 cell growth Curve
As shown in FIG. 1, HepG2 cells grew more slowly from 1 d to 4 d, and increased exponentially from 4 d to 6d, and the number of cells increased rapidly in the exponential growth phase. The number of the cells from 6d to 9 d is stable, the cells enter a stable period, and the maintaining time is at least 3 d, so that the optimal dosing time can be determined through the growth curve. When the cells are in a stationary phase, the number of the cells is more stable, and experimental data is more stable and reliable. As can be seen from the figure, in this experiment, HepG2 cells were treated with drugs at 6d, and cultured for 1-3 d after the drugs were added, all being in the stationary phase of the cells.
2.2 Effect of the same sample on the inhibition Rate of HepG2 cell proliferation at different times
As shown in fig. 2, the inhibition rate of the sample on HepG2 cell proliferation gradually increased with the increase of the treatment time, and had a certain time-dependent effect, after the drug treatment 1 d, the sample concentration was lower, the cell growth promoting effect was exhibited, when the sample concentration was higher (12.5, 62.5 mg/m L), the cell proliferation inhibiting effect was exhibited, when the concentration was 12.5 mg/m L, the inhibition rate was 45.0%, significantly lower than the inhibition rate of 2 d, the difference was significant (P <0.01), when the concentration was 62.5 mg/m L, the inhibition rate was 63.7%, significantly lower than the inhibition effect of 2 d, the difference was significant (P <0.05), after the drug treatment 2 d, the samples with different concentrations all exhibited inhibition on HepG2 cells, after the drug treatment 3 d, the samples with different concentrations all had the cell proliferation inhibiting effect on HepG2, when the concentration was lower, the inhibition rate was not different from that of 2 d, when the concentration was 12.5 mg/m, the difference was significantly higher than that of the drug treatment 3 d, when the total inhibition rate was found to be significantly higher than that when the treatment 2 d, the total inhibition rate was found to be less than that when the treatment 2 d, the total inhibition rate was found to be equal to 2.5.5.5 mg/m, when the total inhibition rate was found, when the total of 2 d, and the total of the treatment was found to be less than the total inhibition rate was found to be equal.
2.3 Effect of different samples on the inhibition Rate of HepG2 cell proliferation by 2 d
As shown in FIG. 3, after the 3 samples are acted for 2 d, the cell proliferation of HepG2 is inhibited, the inhibition rate is gradually increased along with the increase of the sample concentration, and a certain dose-dependent effect is presented, when the concentration of the sample concentration is 62.5 mg/m L, the inhibition effect of the 3 samples on the cell proliferation is optimal, the difference is extremely significant (p is less than 0.01) compared with a negative control group and is higher than that of a 5-Fu drug group, when the concentration is 62.5 mg/m L, the inhibition rate of the 525 samples on the cell proliferation of HepG2 is the highest and reaches 97.2%, when the concentration of the sample is 12.5 mg/m L, the 3 samples all have the inhibition effect on the HepG2 cells, and the difference is extremely significant compared with the negative control group.
Half Inhibitory Concentration (IC) of 2.43 samples after treatment of HepG2 cells for 2 d50Value)
IC50The lower the value, the more significant the inhibition of HepG2 cell proliferation by the representative sample. As shown in FIG. 4, the results of the half inhibitory concentrations of the 3 samples showed that 531 was the most effective in inhibiting HepG2 cell proliferation, and IC was the highest50The value is 6.8 mg/m L, followed by 526 and 525, IC50The values were 8.0 mg/m L and 16.0mg/m L, respectively.
2.5 cell morphology Observation
As shown in the figure, after cells in the freezing tube are thawed and centrifuged, DMEM complete culture medium is added, the cells are uniformly blown and beaten to prepare cell suspension, the cells are suspended in the culture solution, the cells are round and quite transparent, the particles are few, and the cell boundary is clear. HepG2 cells were cultured for a certain period of time and then grown adherent to the skin, and they were observed to appear as fusiform or irregular triangles on the surface of the support in an inverted microscope, with few intracellular particles, transparency and very tight cell-to-cell junctions. After the HepG2 cells are treated by adding drugs, the cells become round again and have reduced volume, the connection between the cells is weakened, the adherence is poor, and round transparent particles appear in cytoplasm.
Other documents mostly add medicines to HepG2 cells in the logarithmic growth phase, but the cells grow rapidly in the logarithmic growth phase, the cell number changes greatly, if the research on the optimal action time of the medicines is carried out, the reliability of data is lower, and in order to avoid the problem, the experiment is carried out by drawing the initial concentration to be 2 × 104The experimental result shows that the HepG2 cell growth curve at the time of each m L aims at finding out the stable phase of the HepG2 cell growth, the HepG2 cell reaches the growth stable phase at the 6 th d, so the HepG2 cell is determined to be subjected to drug adding treatment when being cultured to the 6 th d, the HepG2 cell cultured to the 6 th d is respectively treated by drugs with different concentrations (62.5, 12.5, 2.5, 0.5, 0.1 and 0.02 mg/m L) to obtain 1, 2 and 3 d, the experimental result shows that after the 1 st d is treated by the drug, the sample has poor inhibition effect on the HepG2 cell proliferation, shows inhibition effect on the cell proliferation only at high concentration (12.5 and 62.5 mg/m L) and shows effect on promoting the HepG2 cell growth at low concentration, and the 2 nd d and 3 kinds of medicinal fungi are treated by the drug addingThe compound has inhibition effect on HepG2 cell proliferation, and has better inhibition effect and smaller inhibition rate difference with that of 3 d. Considering the risk of prolonging the cell culture time and the cost consumption, 2 d is considered as the optimal action time of the medicine, which is consistent with other literature reports. In conclusion, after the 3 samples are acted for 2 d, the inhibition effect is shown on HepG2 cells, and the inhibition effect of the samples on cell proliferation is further confirmed by observing the morphology observation after the medicine is added.
The MTT method is often used to screen for drugs that inhibit cell proliferation in vitro, and is based on the experimental principle that active cell mitochondria produce succinate dehydrogenase, which undergoes redox reaction with MTT and can form blue-violet crystal formazan precipitated in cells, and DMSO dissolves the crystal. After the crystals are fully dissolved by a horizontal shaking table, an enzyme-labeled analyzer can be used for measuring the light absorption value of cells at 490 nm, the inhibition condition of the drugs on the cells is known, dead cells cannot form formazan due to inactivation, the capacity of forming formazan by apoptotic cells is reduced, the light absorption value is also reduced, and the inhibition condition of the drugs on the cells can be detected by an MTT method.
It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.
Sequence listing
<120> one strain of southern hetero basidiomycetes and application thereof
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>563
<212>DNA
<213>Heterobasidion australe
<400>1
cgaatatcgt gcaaggttgt cagctggcct ctcggggcat gtgctcgcct tgttcatata 60
tccatctcac acctgtgcac actcgcgtgg gtcggtcggg ggttttctct ttcgagatct 120
ctccccttcc gagccgcgtc ttcacacaaa cactttgtat gtcttcagaa tggtatcaat 180
gctataaaaa cgcatctaat acaactttca acaatggatc tctcggttct cgcatcgatg 240
aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa tcatcgaatc 300
tttgaacgca ccttgcgccc tttggtattc cgaagggcac gcctgtttga gtgtcgtgaa 360
attctcaacc ctgtgctttt cttgtgaaag cgcgtgggct tggacttgga ggctttgctg 420
gtccttgcgg atcggctcct ctcaaatgca ttagcgagac ccttgtggtg ccgcccccgg 480
tgtgataatt gtctacgccg tggtggtgcg ccgcgattgt gggggacctg cttccaaccg 540
tcgaaagaca actttatcga aac 563
Claims (2)
1. A strain of hetero-basidiomycetes (A) and (B)Heterobasidion australe) Is preserved in China general microbiological culture collection center; the preservation number is CGMCC No. 19148; the preservation time is 12 months and 23 days in 2019.
2. Use of the southern xenobasidiomycete of claim 1 in the preparation of a medicament for inhibiting human liver cancer HepG2 cells.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010039597.6A CN110982713B (en) | 2020-01-15 | 2020-01-15 | Leptospermum scoparium and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202010039597.6A CN110982713B (en) | 2020-01-15 | 2020-01-15 | Leptospermum scoparium and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN110982713A CN110982713A (en) | 2020-04-10 |
CN110982713B true CN110982713B (en) | 2020-07-17 |
Family
ID=70081160
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202010039597.6A Active CN110982713B (en) | 2020-01-15 | 2020-01-15 | Leptospermum scoparium and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN110982713B (en) |
Family Cites Families (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
PL238795B1 (en) * | 2017-01-20 | 2021-10-04 | Politechnika Bialostocka | Extract from polyporoid fungi, composition containing that extract and its applications |
-
2020
- 2020-01-15 CN CN202010039597.6A patent/CN110982713B/en active Active
Also Published As
Publication number | Publication date |
---|---|
CN110982713A (en) | 2020-04-10 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104560820B (en) | VREF KQ2.6 and application | |
CN105886405B (en) | Dendrobium candidum endogenetic fungus and its application | |
CN110982868B (en) | Co-culture method for improving triterpene content of ganoderma lucidum and application thereof | |
CN108486002B (en) | Momordica grosvenori endophyte strain capable of producing exopolysaccharides, method for producing exopolysaccharides and application of exopolysaccharides | |
CN110982713B (en) | Leptospermum scoparium and application thereof | |
CN113897300A (en) | Bifidobacterium animalis capable of improving skin barrier function damage and skin sensitivity | |
CN104789488A (en) | Lactobacillus rhamnosus having cholesterol lowering effect, and uses thereof | |
CN110982714B (en) | Scleroderma microrum and application thereof | |
CN111004729B (en) | Microfomes perennialis and application thereof | |
CN110447457A (en) | A kind of pycnoporus samguineus new strains and its artificial cultivation method and purposes | |
CN115634241A (en) | Preparation method of Shandong ganoderma lucidum extract and application of Shandong ganoderma lucidum extract in preparation of hypoglycemic drugs | |
CN104962507A (en) | Myxobacteria strain and antitumor activity metabolite thereof | |
CN105238700B (en) | One plant height produces the wild soybean endogenetic fungus of oleanolic acid | |
CN107828729A (en) | A kind of human lung cancer A549 derived cell strains and its preparation method and application | |
KR100398677B1 (en) | Cultivation Method of mushroom mycelium using citrus juice and mushroom mycelium thereof | |
CN102206583A (en) | Chip for cell co-culture and co-culture method | |
CN112760235A (en) | Application of Acanthus ilicifolius endophytic fungus Diaporthe goulteri and metabolite thereof | |
CN110172408A (en) | The endogenetic fungus of one plant of Chinese podophyllum root and its application | |
CN1212387C (en) | Fine rod bundle spore SX-1 separated and cultured from cordyceps and its saparation, culture process and use | |
CN114762700B (en) | Application of penicillium fox dung culture | |
CN114507607B (en) | Freshwater fungus, secondary metabolite thereof and application | |
CN115813910B (en) | Application of nifemycin C in preparing anti-nasopharyngeal carcinoma medicine | |
CN114591269B (en) | Eremophilane type sesquiterpene and application thereof in preparation of drugs with anti-inflammatory activity | |
CN113444646B (en) | Mould for producing beta-caryophyllene and application thereof | |
CN113999775B (en) | Chinese delicious mushroom of chaihu and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |