CN110964818A

CN110964818A - Detection kit and detection method for human BRAF gene V600E mutation

Info

Publication number: CN110964818A
Application number: CN201911187477.4A
Authority: CN
Inventors: 罗锋; 韩勋领; 孙松松
Original assignee: Chongqing Puluotong Gene Medicine Research Institute Co Ltd
Current assignee: Chongqing Puluotong Gene Medicine Research Institute Co Ltd
Priority date: 2019-11-28
Filing date: 2019-11-28
Publication date: 2020-04-07

Abstract

The invention provides a detection kit for human BRAF gene V600E mutation, which comprises a primer and a probe for detecting BRAF gene V600E mutation, an inhibitor, an internal control primer and a probe, and an external control primer and a probe, and is characterized in that: the detection primers are SEQ ID NO.1 and SEQ ID NO.2, and the detection probe is SEQ ID NO. 3; the inhibitor is SEQ ID NO. 4; the internal control primers are SEQ ID NO.5 and SEQ ID NO.6, and the internal control fluorescent probe is SEQ ID NO. 7; the external control primers are SEQ ID NO.8 and SEQ ID NO.9, and the external control fluorescent probe is SEQ ID NO. 10. The invention utilizes the peripheral blood of the patient to efficiently and non-invasively detect the mutation of the BRAF gene in the ctDNA, has high detection sensitivity, short period, low cost and simple interpretation, and has great clinical popularization and application values.

Description

Detection kit and detection method for human BRAF gene V600E mutation

Technical Field

The invention relates to the field of molecular biology, in particular to a kit and a detection method for BRAF gene V600E mutation in peripheral blood circulation tumor DNA (ctDNA) of a tumor patient.

Background

BRAF is a guanylate binding protein RAS activated serine/threonine protein kinase, plays an important role in regulating Mitogen Activated Protein Kinase (MAPK) signaling pathways, and is one of the most important protooncogenes. MAPK signaling pathways normally regulate cell growth, division and differentiation, and can also trigger cancer due to the formation of oncogenic mutants of RAF family members. Most mutations in BRAF occur in metastatic melanoma, colon cancer, lung cancer and thyroid cancer. Wherein the generation of the BRAF (V600E) mutant remarkably enhances the activity of the BRAF, so that the cancer cell division is out of control, and about 8 percent of human tumors have BRAF mutation. The mutation leads to the continuous activation of a downstream MEK-ERK signaling pathway and is important for the growth, proliferation and invasive metastasis of tumors. In 2011, the first BRAF (V600E) targeted inhibitor, namely, Verofinib, is approved by FDA to be marketed, is used for treating patients with advanced melanoma with BRAF (V600E) mutation, effectively prolongs the progression-free survival period and the overall survival period of the patients, and achieves breakthrough treatment effect. According to the World Health Organization (WHO) data, colorectal cancer (CRC) ranks the third most common malignancy in men and the second most common malignancy in women, with approximately 5-15% of colorectal cancers undergoing BRAF site-specific mutations, with more than 90% being BRAF (V600E) mutations. BRAF (V600E) mutation may rule out the Lindie Syndrome (LS), indicated as sporadic colorectal cancer (SCRC), for differential diagnosis of colorectal cancer. In addition, BRAF (V600E) may also help clinicians to perform prognostic management and guide treatment of colorectal cancer. The current data suggest that the response rate of BRAF (V600E) mutant patients to EGFR monoclonal antibody treatment is obviously lower than that of BRAF wild patients. The mutation of BRAF (V600E) occurs in 40-70% of Papillary Thyroid Carcinomas (PTC), but is rarely found in Follicular Thyroid Carcinoma (FTC), Medullary Thyroid Carcinoma (MTC), eosinophilic adenocarcinoma, adenoma and benign thyroid hyperplasia, so BRAF (V600E) can be used as a PTC clinical differential diagnosis index. The American Thyroid Association (ATA) regulatory guidelines recommend that patients with thyroid nodules be diagnosed with molecular markers (e.g., BRAF, RAS, RET/PTC, etc.) when the cytological biopsy is inconclusive. The mutation of BRAF (V600E) is related to the invasiveness and poor prognosis of PTC, and can provide reference for PTC treatment. The BRAF (V600E) gene mutation of the PTC is examined before the operation, so that the risk of postoperative recurrence can be predicted in an auxiliary mode, and the range of surgical excision and postoperative subsequent treatment can be guided.

In the NCCN clinical practice guideline for colorectal cancer (2019), it is required that when a first-line therapy targeting drug of Cetuximab (Erbitux/Cetuximab) or Panitumumab (Vectibix/Panitumumab) against EGFR is used, mutation of BRAF gene, such as V600E mutation, should be detected, and the efficacy of using the targeting drug is poor or may be ineffective. In NCCN thyroid cancer clinical practice guideline 2018, detection of BRAF gene mutation state which can not be judged in the fine needle aspiration biopsy result is definitely provided, and pathological typing diagnosis, clinical prognosis prediction and individual treatment scheme making are facilitated. The BRAF (V600E) test is of great significance for guiding the use of targeted drugs.

Currently, there are many methods for detecting BRAF gene mutation, such as direct sequencing, pyrosequencing, High Resolution Melting Analysis (HRM), High performance liquid chromatography, and fluorescent quantitative PCR. The "gold standard" for the genotyping assay of BRAF (V600E) is a PCR-direct sequencing method which is less expensive but time consuming to operate, and it has two distinct disadvantages: firstly, the sensitivity is low, and accurate detection can be realized generally when the abundance of the mutant gene reaches more than 10-20%; secondly, because the PCR product needs to be processed subsequently, the result is not accurate due to easy pollution. The method can be used for detecting gene mutation sites based on second-generation sequencing, and the detection abundance can reach 1%, but the method is not widely adopted at present due to long period and high cost. The amplification mutagenesis PCR system (ARMS) is a method for detecting known mutations, and the basic principle is as follows: primer extension is hindered if the base at the 3' end of the primer does not perfectly match the template; designing a primer according to the known point mutation, wherein the base at the 3' end of the primer is complementary with the base of the mutant template, and only the mutant template is amplified by PCR, so that the aim of detecting the point mutation is fulfilled. The method is simple to operate, short in detection period and low in experiment cost, and therefore, the method is widely adopted. However, the sensitivity of the currently marketed Arms-PCR products for BRAF (V600E) mutation detection is about 5%, the highest detection sensitivity can reach 1%, and amplification of wild-type samples cannot be completely inhibited, and the result interpretation requires calculation of Δ Ct values, which is complex and cannot meet clinical requirements.

The samples adopted by the detection technical method mainly comprise fresh tumor tissues, paraffin embedded sections and the like, and the samples need to be sampled by operation or puncture, so that great pain is brought to patients. With the development of liquid biopsy technology, ctDNA (circulating tumor DNA) is gradually used for gene detection and clinical adjuvant therapy, prognosis monitoring, etc. ctDNA is a DNA fragment from a tumor genome that enters the blood circulation system and carries genetic information such as mutations, insertions, deletions, rearrangements, copy number abnormalities, and/or methylation. The ability to obtain ctDNA without invasive tumor surgery, but rather to analyze DNA from tumors from routine blood draws, represents a key advance in the clinical application of potential transformation. ctDNA analysis in particular is non-invasive, provides a molecular profiling method for tumours that are difficult or unsafe to biopsy, and provides a practical method that enables continuous monitoring of tumour DNA over time without the risk and potential complications of standard tumour biopsies. Furthermore, ctDNA analysis may better detect the molecular heterogeneity of multiple distinct clonal populations in a patient's tumor compared to needle biopsies of a single tumor lesion, providing the possibility of tumor detection or monitoring for patients without overt clinical disease. At present, the detection of ctDNA in the market mainly depends on high-throughput sequencing and digital PCR, but the defects of expensive instruments and equipment, complex operation and long detection period are not popularized and used in a large area. The market has not specially aimed at using ctDNA to carry out rapid and sensitive gene mutation detection.

If the oncogene can be detected in the early stage of cancer without obvious clinical manifestation, the gene mutation related to drug reactivity can be quickly, accurately and sensitively detected, the early treatment can be found early, and the survival rate of cancer patients can be greatly improved. ctDNA is very low in content and fragmented, and it is difficult for the prior art to detect trace, fragmented ctDNA from a large background of normal DNA. CN109295176A discloses a primer, a detection method and a kit for detecting V600E mutation of BRAF gene of human colorectal cancer, and mentions that the detection sensitivity can reach 0.001 percent based on a fluorescent quantitative platform. However, the principle of fluorescent quantitative PCR detection and the limitations of the detection technique exceed the lower limit of detection, and the effect cannot be achieved theoretically or practically. Furthermore, this method does not mention ctDNA, nor does it provide experimental evidence for the detection effect using blood as a sample.

Disclosure of Invention

The invention aims to solve the problem that the ctDNA in the peripheral blood of a BRAF gene V600E mutant cancer patient with no obvious clinical manifestation or early cancer is difficult to detect.

The purpose of the invention is realized by the following measures:

a detection kit for human BRAF gene V600E mutation comprises a primer and a probe for detecting BRAF gene V600E mutation, an inhibitor, an internal control primer and a probe, and an external control primer and a probe, and is characterized in that:

the sequences of primers and probes for detecting the mutation of the BRAF gene V600E are as follows:

an upstream primer: GTAAAAATAGGTGCTTTTGGTATAGCTGCCGA (SEQ ID NO.1)

A downstream primer: CTTTCTAGTAACTCAGCAGCATCTCAGG (SEQ ID NO.2)

A fluorescent probe: FAM-AATCTCGATGGAGTGGGTCCCATCAGTTTGAAC-TARMA (SEQ ID NO. 3);

the inhibitor is fragment GGAAAATGAGATCTACTGTTTTCCTTTACTTACTA (SEQ ID NO. 4);

the sequences of the internal control primers and the probes are as follows:

an upstream primer: CCAAGGCCAACCGCGAGAAGATGACCC (SEQ ID NO.5)

A downstream primer: AGAGTCCTACGGAAAACGGCAGAAGAGAG (SEQ ID NO.6)

A fluorescent probe: VIC-CGCTACCTCTTCTGGTGGCCGCCTC-TARMA (SEQ ID NO.7)

The sequences of the external control primers and the probes are as follows:

a forward primer: TATTCTTAAATAAATATGAACCCTTAA (SEQ ID NO.8)

Reverse primer: AAATATGAAACACTGTTTATAAGACAT (SEQ ID NO.9)

A fluorescent probe: FAM-ATATTTTGAAACCAGTTTCAGTGTATTTCAAAC-TARMA (SEQ ID NO. 10).

The internal control primer and the probe are designed according to a human ACTB gene conserved sequence, and the external control primer and the probe are designed according to a human BRAF gene conserved sequence.

The probe for detecting the mutation of the BRAF gene V600E, the internal control fluorescent probe and the 5 'end fluorescent group of the external control fluorescent probe are conventionally used fluorescent reporter groups suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the quenching group at the 3' end is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR, preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy1, more preferably, the probe for detecting the mutation of the BRAF gene V600E and the 5 'end fluorescent group of the external control fluorescent probe are FAM, and the probe for detecting the mutation of the BRAF gene V600E and the 3' end fluorescent quenching group of the external control fluorescent probe are TAMRA; the fluorescent group at the 5 'end of the internal control fluorescent probe is VIC, and the fluorescent quenching group at the 3' end of the internal control fluorescent probe is TAMRA.

The inhibitor is used for specifically blocking BRAF gene wild type template amplification, the 3 'end is specially modified, the preferred mode is C3 spacer, phosphorylation, sulfo, MGB, dideoxycytidine (ddC) and the like, and the more preferred scheme is that the 3' end of the inhibitor used for specifically blocking BRAF gene wild type template amplification is modified by ddC.

The kit comprises the primers and the probes, and also comprises a PCR reaction solution, a positive quality control solution and a negative quality control solution. The PCR reaction solution contains a hot-start taq enzyme, a buffer solution, magnesium ions, dNTPs and the like required for PCR reaction.

Another object of the present invention is to provide a method for using and a method for detecting the above-mentioned kit.

The purpose of the invention is realized by the following measures:

the using method of the detection kit comprises PCR amplification of real-time fluorescent quantitative PCR and mutation amplification PCR system (Arms-PCR) combination.

The preferred PCR amplification conditions of the kit are:

the conditions for pre-denaturation were: at 95 ℃ for 2 minutes;

the PCR reaction consists of two stages:

the first phase consists of 5 amplification cycles with the conditions: denaturation: at 95 ℃ for 15 seconds; annealing: 60 ℃, 20 seconds; extension: 72 ℃ for 20 seconds;

the second phase consists of 40 amplification cycles with the conditions: denaturation: at 95 ℃ for 15 seconds; annealing: setting fluorescence signal collection at 60 ℃ for 20 seconds; extension: 72 ℃ for 20 seconds.

The invention also provides an interpretation method of the kit result, which comprises the following steps: observing whether a fluorescence detection signal of the mutation of the BRAF gene V600E forms a logarithmic amplification 'S' -shaped curve or not under the conditions of the PCR reaction system and the circulation program; if a log-amplified "S" curve is formed, the sample to be tested contains the V600E mutation.

Advantageous effects

1. The invention utilizes the peripheral blood of the patient to efficiently and non-invasively detect the mutation of the BRAF gene in the ctDNA, can reduce the pain of the patient caused by sampling, and is particularly suitable for the patients who cannot be operated, are not suitable for the operation or are difficult to sample.

2. The invention has high detection sensitivity: the primer and the probe which are specially designed and the inhibitor aiming at the wild template are adopted, the PCR detection specificity is very high, the BRAF (V600E) mutation can be specifically identified, 0.1% of mutation under the condition of 1ng of template can be identified based on the fluorescent quantitative PCR detection, and the detection sensitivity is high.

3. The invention has short reaction period: the method adopts a hot start taq enzyme premixing system, is stable at normal temperature, comprises a primer, a probe, a reaction buffer solution, a hot start taq enzyme and the like, is mixed into a reaction tube in advance, is used for one-time sample adding and one-time closed tube detection, does not need product post-treatment and sequencing result verification, can finish detection within 60 minutes, obviously shortens the detection time and improves the detection efficiency.

4. The invention has low detection cost: based on a fluorescent quantitative platform, the Arms-PCR and taqman probe technology is adopted, the detection primers and the probes are low in price, the experiment consumption and the labor cost are saved in the experiment process, and the single detection cost is equivalent to that of one-time PCR reaction. Compared with sequencing and other methods, the method greatly saves the detection cost.

5. The kit is elaborately provided with a dual-quality control detection system of an internal control gene and an external control gene, can analyze whether the DNA to be detected can be normally amplified, eliminates the reason which can cause PCR failure, and ensures the reliability and traceability of the experiment, contains a specificity inhibitor, has no non-specificity amplification on the premise of reaching 0.1 percent of high sensitivity, can still ensure high specificity and objectively judge the result, does not need to manually calculate △ CT value, has simple and clear result judgment, and can meet the clinical requirement.

6. The invention provides a kit and a method for BRAF gene mutation detection based on a real-time fluorescence quantitative PCR and Arms-PCR technology platform and taking ctDNA in peripheral blood of a tumor patient as a sample, wherein the kit comprises a primer, a probe, a specific inhibitor and the like. The invention has the characteristics of no wound, high detection sensitivity, short period, low cost, simple interpretation and the like, has the characteristics of high efficiency, rapidness and accuracy in detecting gene mutation in ctDNA in peripheral blood, and has great clinical popularization and application values.

Drawings

FIG. 1: a negative control reaction signal; the external control of the negative control is indicated by FAM signal, the V600E mutation signal in the negative control is indicated by FAM, and the internal control signal in the negative control is indicated by VIC.

FIG. 2: a positive control reaction signal; the external control of the positive control is indicated by FAM signal, the V600E mutation signal in the positive control by FAM, and the internal control signal in the positive control by VIC.

FIG. 3: detecting a reaction signal by the mutant; the internal control signal in the reaction system is indicated by VIC, and the V600E mutation signal in the reaction system is indicated by FAM.

FIG. 4: effect of wild-type inhibitor on reaction system; the internal control signal in the reaction system is indicated by VIC, and the V600E mutation signal in the reaction system is indicated by FAM.

FIG. 5: a sensitivity detection signal; the mutation signal at V600E in the reaction system is indicated by FAM, and the total amount of template added to each system is 10 ng.

FIG. 6: ctDNA detection results of No. 1-10 peripheral blood samples

FIG. 7: 1-10 sample puncture tissue first generation sequencing result

Detailed Description

The following detailed description of the present invention is provided in conjunction with the accompanying drawings, but it should be understood that the scope of the present invention is not limited to the specific embodiments.

Example 1

1. Preparation of primers, probes and inhibitors contained in kit for detecting BRAF gene V600E mutation in human blood sample

According to the wild type sequence of the BRAF Gene (Gene ID:673) published by NCBI database, specific arms-PCR primers and probes are designed by taking the mutation site (rs113488022) of the BRAF Gene V600E as reference. The mutant plasmid and the wild plasmid constructed by genetic engineering are used as templates to establish a real-time fluorescent PCR detection system, so that the high-sensitivity and high-specificity detection of the BRAF gene V600E mutation is realized.

The primer and the probe for detecting the mutation of the BRAF gene V600E are characterized in that the detection primer and the probe are designed according to the mutation site of the BRAF gene V600E, and the sequences are as follows:

an upstream primer: GTAAAAATAGGTGCTTTTGGTATAGCTGCCGA

A downstream primer: CTTTCTAGTAACTCAGCAGCATCTCAGG

A fluorescent probe: FAM-AATCTCGATGGAGTGGGTCCCATCAGTTTGAAC-TARMA

The length of the mutation upstream primer is 32 bases, wherein the 1 st base at the 3' end is a mutation site, and the mutation upstream primer is specifically combined with a mutation sequence at a mutation site of the BRAF gene V600E to selectively amplify the mutation sequence. In order to increase the specificity of the primer and ensure that the primer is specifically combined with the mutant template, the scheme of the invention is subjected to a large number of optimization experiments, and specific base mutations are introduced into the 3 rd, 5 th, 11 th and 19 th bases at the 3 'end of the mutant primer besides the 1 st base design at the 3' end of the primer is consistent with the mutation site; the downstream primer is 28 bases in length and is combined with a BRAF gene conserved sequence.

The 5 'end fluorescent group of the probe for detecting the BRAF gene V600E mutation is a conventionally used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the 3' end quenching group is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR analysis, preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy1, more preferably the 5 'end fluorescent group of the probe for detecting the BRAF gene V600E mutation is FAM, and the 3' end fluorescent quenching group of the probe for detecting the BRAF gene V600E mutation is TAMRA.

In order to further distinguish the wild type sequence from the mutant type sequence, the invention adds a wild type template inhibitor which comprises a nucleic acid sequence matched with the wild type gene of BRAF and a chemical modification group. The inhibitor for specifically blocking BRAF gene wild type template amplification is characterized in that the inhibitor is designed according to a mutation site of BRAF gene V600E, the 3' end is modified by ddC, and the sequence is as follows:

GGAAAATGAGATCTACTGTTTTCCTTTACTTACTA。

the 3 'end of the inhibitor for specifically blocking BRAF gene wild type template amplification is specially modified, preferably C3 spacer, phosphorylation, thio, MGB, dideoxycytidine (ddC) and the like, and more preferably, the 3' end of the inhibitor for specifically blocking BRAF gene wild type template amplification is modified by ddC. The inhibitor can be specifically combined with a BRAF gene V600E mutation site wild type sequence, and inhibits the non-specific amplification of the wild type gene.

In order to detect the effectiveness of a reaction system, the invention adds an internal control primer and a probe for detecting mutation of BRAF gene V600E into the reaction system. The invention preferably includes a conserved sequence of the human ACTB gene. Specific arms-PCR primers and probes were designed based on the ACTB Gene (Gene ID:60) sequence published in the NCBI database. The method is characterized in that the sequences of the internal control primer and the probe are as follows:

an upstream primer: CCAAGGCCAACCGCGAGAAGATGACCC

A downstream primer: AGAGTCCTACGGAAAACGGCAGAAGAGAG

A fluorescent probe: VIC-CGCTACCTCTTCTGGTGGCCGCCTC-TARMA

The 5 'end fluorescent group of the probe for detecting the BRAF gene internal control ACTB is a conventionally used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the 3' end quenching group is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR, preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy1, and more preferably the 5 'end fluorescent group of the probe for detecting the BRAF gene internal control ACTB fluorescent probe is VIC, and the 3' end fluorescent quenching group is TAMRA.

In order to monitor the quality of a sample template to be detected, the invention introduces an external control primer and a probe for detecting mutation of BRAF gene V600E. In the invention, the external control sequence adopts a segment of sequence which is conserved in the human BRAF gene and does not contain the V600E segment. Specific arms-PCR primers and probes were designed based on the wild-type sequence of the BRAF Gene (Gene ID:673) published in the NCBI database. The method is characterized in that the sequences of the external control primers and the probes are as follows:

an upstream primer: TATTCTTAAATAAATATGAACCCTTAA

A downstream primer: AAATATGAAACACTGTTTATAAGACAT

A fluorescent probe: FAM-ATATTTTGAAACCAGTTTCAGTGTATTTCAAAC-TARMA

The 5 'end fluorescent group of the external control fluorescent probe for detecting the BRAF gene V600E mutation is a conventionally used fluorescent reporter group suitable for fluorescent quantitative PCR analysis, preferably FAM, VIC, HEX, cy5 or ROX, the 3' end quenching group is a conventionally used fluorescent quenching group suitable for fluorescent quantitative PCR, preferably TAMRA, BHQ1, BHQ2, MGB or Dabcy1, more preferably the 5 'end fluorescent group of the external control fluorescent probe for detecting the BRAF gene V600E mutation is FAM, and the 3' end fluorescent quenching group of the external control fluorescent probe for detecting the BRAF gene V600E mutation is TAMRA.

In order to increase the contrast of the detection result, the method introduces positive quality control and negative quality control.

The positive quality control in the invention is based on a BRAF Gene (Gene ID:673) wild type sequence published by NCBI database, and takes a BRAF Gene V600E mutant site (rs113488022) as a reference, a designed sequence is introduced into a V600E mutant site, and the mutant plasmid is constructed by a genetic engineering construction method. A real-time fluorescent PCR detection system is established by taking a V600E mutation site-containing mutant plasmid constructed by genetic engineering as a template, so that the positive control detection of the BRAF gene V600E mutation is realized. The positive quality control sequence is shown in SEQ ID NO.11, wherein the 329 th site is a mutation site base.

Positive plasmid (M) containing the V600E mutation was dissolved in aqueous ctDNA extracted from Wild Type (WT) human peripheral blood without the V600E mutation by an absolute quantitative method, and mixed to 1 ng/. mu.l of positive control (i.e., template with mutation rate of 1%) with M: WT of 1:99. The negative control in the present invention was sterilized deionized water.

2. Nucleic acid extraction of sample to be tested

The sample selected by the invention can be blood, tumor tissue, hydrothorax and ascites and other samples to be detected containing genome DNA, and particularly can be used for detecting circulating tumor DNA (ctDNA) extracted from peripheral blood. The invention recommends the extraction of sample DNA by using a commercially mature nucleic acid extraction kit. In the invention, a cosmetic basic biological nucleic acid extraction Kit HiPurecirculation DNA Midi Spin Kit S (D3182-03S, magenta) is adopted, and the specific use method is carried out by referring to the Kit instruction. And extracting ctDNA from the sample to be detected by adopting a commercial kit and then storing for later use.

3. Reaction system

In order to ensure the stability of the PCR reaction system, the PCR reaction system adopts a reaction system containing reagents such as hot start taq enzyme, buffer solution, magnesium ions, dNTP and the like. Experimental consumables such as hot start taq enzyme (M7406, Promega), buffer, magnesium ions and dNTP (U1515, Promega) were purchased from Promega Biotech Inc.

In order to ensure the accuracy and the rigor of detection, the invention is provided with a dual-quality control detection system of an internal control gene and an external control gene, which can analyze whether the DNA to be detected can be normally amplified and eliminate the reason which can cause PCR failure. A sample to be detected needs to be subjected to two-tube reaction, wherein the detection of the mutation of the BRAF gene V600E and the detection of the internal control gene are carried out in one reaction tube; the external control gene detection is carried out in another reaction tube.

The reaction system of the sample to be detected comprises reagents such as hot start taq enzyme, buffer solution, magnesium ions, dNTP and the like, and also comprises a primer, a probe and a wild template inhibitor for detecting mutation of BRAF gene V600E, and an internal control primer and a probe. The detection reaction system of the sample to be detected is as follows:

the externally controlled reaction system comprises reagents such as hot start taq enzyme, buffer solution, magnesium ions, dNTP and the like, and also comprises a primer and a probe for detecting an externally controlled gene. The specific external control reaction system is as follows:

4. PCR reaction

In the invention, a sample to be detected needs to carry out two PCR reactions, wherein one reaction comprises detection of a sample to be detected BRAF (V600E) and an internal control gene, and the other reaction comprises detection of an external control gene; meanwhile, each test sample should be provided with a positive control reaction and a negative control reaction.

And adjusting the concentration of the ctDNA of the sample to be detected to be 1ng/ul, and adding 1ul into the reaction system of the sample to be detected and the external control reaction system respectively to total 20 ul of the system. The prepared reaction system is subjected to fluorescent quantitative PCR reaction, and the instrument used in the scheme of the invention is ABI 7500. In the present invention, the fluorescence channel is selected as FAM and VIC, and the preferred PCR amplification conditions are:

the conditions for pre-denaturation were: at 95 ℃ for 2 minutes;

the PCR reaction consists of two stages:

the first phase consists of 5 amplification cycles with the conditions:

denaturation: at 95 ℃ for 15 seconds;

annealing: 60 ℃, 20 seconds;

extension: 72 ℃ for 20 seconds;

the second phase consists of 40 amplification cycles with the conditions:

denaturation: at 95 ℃ for 15 seconds;

annealing: setting fluorescence signal collection at 60 ℃ for 20 seconds;

extension: 72 ℃ for 20 seconds;

in the scheme of the invention, the positive control reaction and the negative control reaction are set according to the method aiming at the sample to be detected.

5. Analysis of detection results

Under the conditions of the PCR reaction system and the temperature cycling program, the reaction system and the result are evaluated according to the conditions of the internal control signal and the external control signal. In the present invention, the Ct value is determined by using a 10-fold standard deviation of the fluorescence value at 3 to 15 cycles before the amplification process as a threshold value and by using the cycle number at which the fluorescence value exceeds the threshold value as a threshold cycle number (Ct value). FAM signals are used for detecting V600E mutation and external control genes of a sample to be detected; VIC was used to detect internal control genes. The detection result is interpreted according to the following scheme:

1) in the negative control reaction, neither FAM nor VIC should peak, with no Ct value (see fig. 1); if FAM or VIC peaks in the negative control, it indicates that the reaction system is contaminated, please remove the contamination and then re-perform the reaction.

2) In the positive control reaction, both FAM and VIC should peak normally and exhibit an "S" -type curve (see fig. 2); if FAM and VIC do not normally peak in the positive control reaction, please check the reaction program setting for correctness.

3) The VIC in the sample reaction system to be tested normally starts a peak and presents an S-shaped curve, and the Ct value is more than 15 and less than 25; if the Ct value is less than 15, indicating that the template is added in excess, please dilute the template and then carry out the reaction again; if the Ct value is greater than 25, the template is not added sufficiently, and the reaction is carried out by adding enough template again.

4) FAM in the external control reaction normally starts to peak and presents an S-shaped curve, and the Ct value is more than 15 and less than 25; if the Ct value is less than 15, indicating that the template is added in the reaction system in excess, and please dilute the template and then carry out the reaction again; if the Ct value is more than 25, the PCR inhibitor exists in the reaction system, and the template is required to be extracted again for reaction.

5) Observing FAM signals in the reaction system of the sample to be detected under the conditions of 1), 2), 3) and 4). If the FAM signal in the reaction system presents a logarithmic growth 'S' curve or has a peak, the FAM signal is judged to be positive, and the sample to be detected contains V600E mutation; if the FAM signal in the reaction system does not have a peak, the FAM signal is judged to be negative, and the sample to be detected does not contain the V600E mutation or exceeds the detection lower limit of the kit (see figure 3).

6. Sensitivity analysis

The system of the invention is added with an inhibitor aiming at a wild type template, the 3 'end adopts special modification, the preferred mode is C3 spacer, phosphorylation, sulfo, MGB, dideoxycytidine and the like, and the more preferred scheme is that the 3' end of the inhibitor used for specifically blocking BRAF gene wild type template amplification adopts ddC modification. The inhibitor can be specifically combined with a wild type sequence at a mutation site of a BRAF gene V600E, and inhibits the non-specific amplification of the wild type gene (see figure 4).

Positive plasmid (M) containing the V600E mutation was dissolved in aqueous solution of wild-type (WT) ctDNA without the V600E mutation by an absolute quantification method to obtain 1ng/ul positive control samples with M: WT of 5:95, 2.5:97.5, 1:99, 0.5:99.5 and 0.1:99.9, i.e., mutation rates of 5%, 2.5%, 1%, 0.5% and 0.1%. Taking a quantitative mutant sample ctDNA, the method of example 1 is used for detection, and the result shows that the sensitivity of the invention can detect at least 1ng of mutant sample containing 0.1% of V600E under the background condition of DNA (see FIG. 5).

Example 2

The use of the kit of the present invention is described in detail below with reference to specific example 2, which is carried out under the premise of the present technology, and detailed embodiments and specific procedures are given. In this example 2, 10 thyroid cancer patient peripheral blood samples and punctured tissue samples were collected at the same time and named as sample nos. 1-10, respectively, ctDNA in peripheral blood nos. 1-10 was detected by the method of the present invention, and the detection result of ctDNA in peripheral blood nos. 1-10 and the result of BRAF gene generation sequencing in punctured tissue DNA No. 1-10 were compared to confirm the accuracy of the present invention.

1. The detection method comprises the following steps:

(1) clinical patient sample ctDNA extraction: ctDNA is extracted from peripheral blood samples of thyroid cancer patients No. 1-10, and a commercially mature extraction kit is adopted for extracting the sample ctDNA. In the invention, a cosmetic basic biological nucleic acid extraction Kit HiPure Circulating DNA Midi Spin Kit S (D3182-03S, magenta) is adopted, the specific use method is carried out by referring to the Kit instruction, and the concentration of the Kit is adjusted to 1ng/ul by using the Qubit 3 for later use.

(2) Preparation of positive control: positive plasmid (M) containing the V600E mutation was dissolved in aqueous Wild Type (WT) ctDNA without the V600E mutation by an absolute quantitative method, and mixed to 1ng/ul of a positive control (i.e., a template with a mutation rate of 1%) with M: WT of 1:99.

(3) Preparing a reaction system:

detecting a reaction system:

an external control reaction system:

(4) adding a reaction system template: and respectively adding 1 mul of each template of the three groups of the ctDNA (deoxyribonucleic acid) sample to be detected, the positive control and the negative control (deionized water) with the concentration of 1 ng/mul into the reaction system of the sample to be detected and the external control reaction system, wherein the total amount of the template is 20 mul.

Reaction conditions are as follows: the instrument used in the protocol of the invention is ABI 7500. In the present invention, the fluorescence channel is selected as FAM and VIC, and the preferred PCR amplification conditions are:

the conditions for pre-denaturation were: at 95 ℃ for 2 minutes;

the PCR reaction consists of two stages:

the first phase consists of 5 amplification cycles with the conditions:

denaturation: at 95 ℃ for 15 seconds;

annealing: 60 ℃, 20 seconds;

extension: 72 ℃ for 20 seconds;

the second phase consists of 40 amplification cycles with the conditions:

denaturation: at 95 ℃ for 15 seconds;

annealing: setting fluorescence signal collection at 60 ℃ for 20 seconds;

extension: 72 ℃ for 20 seconds;

2. analysis of results

(1) Evaluation criteria:

in the negative control reaction, FAM and VIC should not peak, and Ct value is not existed; if FAM or VIC peaks in the negative control, it indicates that the reaction system is contaminated, please remove the contamination and then re-perform the reaction.

In the positive control reaction, both FAM and VIC should peak normally and exhibit an "S" type curve; if FAM and VIC do not normally peak in the positive control reaction, please check the reaction program setting for correctness.

The VIC in the sample reaction system to be tested normally starts a peak and presents an S-shaped curve, and the Ct value is more than 15 and less than 25; if the Ct value is less than 15, indicating that the template is added in excess, please dilute the template and then carry out the reaction again; if the Ct value is greater than 25, the template is not added sufficiently, and the reaction is carried out by adding enough template again.

FAM in the external control reaction normally starts to peak and presents an S-shaped curve, and the Ct value is more than 15 and less than 25; if the Ct value is less than 15, indicating that the template is added in the reaction system in excess, and please dilute the template and then carry out the reaction again; if the Ct value is more than 25, the PCR inhibitor exists in the reaction system, and the template is required to be extracted again for reaction.

Observing FAM signals in the reaction system of the sample to be detected under the conditions of 1), 2), 3) and 4). If the FAM signal in the reaction system presents a logarithmic growth 'S' curve or has a peak, the FAM signal is judged to be positive, and the sample to be detected contains V600E mutation; if the FAM signal in the reaction system does not have a peak, the judgment is negative, and the sample to be detected does not contain the V600E mutation or exceeds the detection lower limit of the kit.

(2) Results

Referring to the attached figures 1, 2, 3 and 4, the negative control has no peak, the positive control has normal peak, the internal control and external control detection results of the sample to be detected have normal peak, and the CT value is more than 15 and less than 25. In the No. 1-10 ctDNA samples to be detected, 8 FAM signals have no obvious peak, namely No.1, No. 3-6 and No.8, the samples to be detected are judged to be negative, namely the samples to be detected do not contain V600E mutation or exceed the detection lower limit of the kit; in 2 cases with distinct "S" curves, No.2 and No.7, respectively, the test sample was judged to be positive, i.e., the test sample contained the V600E mutation (see fig. 6).

10 cases of thyroid cancer patient puncture samples are subjected to genome DNA extraction, the BRAF gene is sequenced, the sequencing result is consistent with the detection result of No. 1-10 peripheral blood ctDNA, and the patent accuracy rate of the invention reaches 100% (see figure 7).

SEQUENCE LISTING

<110> Chongqing Puluotong Gene medical research institute Co., Ltd

<120> detection kit and detection method for human BRAF gene V600E mutation

<160>

<210>1

<211>32

<212>

<213> Artificial (Artificial sequence)

<400>1

gtaaaaatag gtgcttttgg tatagctgcc ga 32

<210>2

<211>28

<212>

<213> Artificial (Artificial sequence)

<400>2

ctttctagta actcagcagc atctcagg 28

<210>3

<211>33

<212>

<213> Artificial (Artificial sequence)

<400>3

aatctcgatg gagtgggtcc catcagtttg aac 33

<210>4

<211>35

<212>

<213> Artificial (Artificial sequence)

<400>4

ggaaaatgag atctactgtt ttcctttact tacta 35

<210>5

<211>27

<212>

<213> Artificial (Artificial sequence)

<400>5

ccaaggccaa ccgcgagaag atgaccc 27

<210>6

<211>29

<212>

<213> Artificial (Artificial sequence)

<400>6

agagtcctac ggaaaacggc agaagagag 29

<210>7

<211>25

<212>

<213> Artificial (Artificial sequence)

<400>7

cgctacctct tctggtggcc gcctc 25

<210>8

<211>27

<212>

<213> Artificial (Artificial sequence)

<400>8

tattcttaaa taaatatgaa cccttaa 27

<210>9

<211>27

<212>

<213> Artificial (Artificial sequence)

<400>9

aaatatgaaa cactgtttat aagacat 27

<210>10

<211>33

<212>

<213> Artificial (Artificial sequence)

<400>10

atattttgaa accagtttca gtgtatttca aac 33

<210>11

<211>605

<212>

<213> Artificial (Artificial sequence)

<400>11

taggttctcc tataaactta ggaaagcatc tcacctcatc ctaacacatt tcaagcccca 60

aaaatcttaa aagcaggtta tataggctaa atagaactaa tcattgtttt agacatactt 120

attgactcta agaggaaaga tgaagtacta tgttttaaag aatattatat tacagaatta 180

tagaaattag atctcttacc taaactcttc ataatgcttg ctctgatagg aaaatgagat 240

ctactgtttt cctttactta ctacacctca gatatatttc ttcatgaaga cctcacagta 300

aaaataggtg attttggtct agctacagag aaatctcgat ggagtgggtc ccatcagttt 360

gaacagttgt ctggatccat tttgtggatg gtaagaattg aggctatttt tccactgatt 420

aaatttttgg ccctgagatg ctgctgagtt actagaaagt cattgaaggt ctcaactata 480

gtattttcat agttcccagt attcacaaaa atcagtgttc ttatttttta tgtaaataga 540

ttttttaact tttttcttta cccttaaaac gaatattttg aaaccagttt cagtgtattt 600

caaac 605

Claims

1. A detection kit for human BRAF gene V600E mutation comprises a primer and a probe for detecting BRAF gene V600E mutation, an inhibitor, an internal control primer and a probe, and an external control primer and a probe, and is characterized in that: the detection primers are SEQ ID NO.1 and SEQ ID NO.2, and the detection probe is SEQ ID NO. 3; the inhibitor is SEQ ID NO. 4; the internal control primers are SEQ ID NO.5 and SEQ ID NO.6, and the internal control fluorescent probe is SEQ ID NO. 7; the external control primers are SEQ ID NO.8 and SEQ ID NO.9, and the external control fluorescent probe is SEQ ID NO. 10.

2. The detection kit for detecting the mutation of the human BRAF gene V600E in claim 1, comprising a PCR reaction solution, a positive quality control and a negative quality control.

3. The kit for detecting mutation of human BRAF gene V600E as claimed in claim 1 or 2, wherein the PCR reaction solution contains hot start taq enzyme, buffer solution, magnesium ion, dNTP.

4. The kit for detecting mutation of human BRAF gene V600E as claimed in claim 1, 2 or 3, wherein the positive quality control sequence is SEQ ID NO.11, and the negative quality control is water.

5. The detection method of the detection kit adopting the human BRAF gene V600E mutation in any one of claims 1-4 comprises PCR amplification of real-time fluorescent quantitative PCR and mutation amplification PCR system (Arms-PCR) in a combined manner.

6. The detection method of the detection kit for the mutation of the human BRAF gene V600E in claim 5 is adopted, and the PCR amplification conditions are as follows:

the conditions for pre-denaturation were: at 95 ℃ for 2 minutes;

the first stage of PCR amplification consists of 5 amplification cycles with the conditions: denaturation: at 95 ℃ for 15 seconds; annealing: 60 ℃, 20 seconds; extension: 72 ℃ for 20 seconds;

the second stage of PCR amplification consists of 40 amplification cycles, with the conditions: denaturation: at 95 ℃ for 15 seconds; annealing: setting fluorescence signal collection at 60 ℃ for 20 seconds; extension: 72 ℃ for 20 seconds.

7. The detection method adopting the detection kit for the human BRAF gene V600E mutation, which comprises a reading step, wherein the reading step is to observe whether the fluorescent detection signal of the BRAF gene V600E mutation forms a logarithmic amplification 'S' -shaped curve or not under the conditions of a PCR reaction system and a cycle program; if a log-amplified "S" curve is formed, the sample to be tested contains the V600E mutation.