CN110951844A

CN110951844A - Identification method of in-situ degrading bacteria of acetonitrile in wastewater

Info

Publication number: CN110951844A
Application number: CN201911319604.1A
Authority: CN
Inventors: 孙寓姣; 尹萌; 郑丹阳
Original assignee: Beijing Normal University
Current assignee: Beijing Normal University
Priority date: 2019-12-19
Filing date: 2019-12-19
Publication date: 2020-04-03
Anticipated expiration: 2039-12-19
Also published as: CN110951844B

Abstract

The invention relates to an identification method of in-situ degrading bacteria of acetonitrile in wastewater, belonging to the technical field of microorganism identification. The method comprises the following steps: step 1: collecting activated sludge of a wastewater treatment plant for later use; step 2: adding the activated sludge collected in the step 1¹⁵Performing acclimation culture on the N-labeled acetonitrile; and step 3: adding at intervals¹⁵Carrying out sequencing batch culture on N-labeled acetonitrile; and 4, step 4: performing activated sludge DNA extraction by centrifugal separation; and 5: carrying out ultra-high speed centrifugation on the extracted DNA obtained in the step 4; step 6: determination by quantitative PCR¹⁵The abundance of 16S rRNA microorganisms in each layer of DNA of N-labeled acetonitrile; and 7: to determine the community structure of the microorganism; and 8: and identifying the active acetonitrile degrading bacteria in the SIP treatment by comparing the enrichment rate. The method identifies various unreported microorganisms related to acetonitrile degradation, and enriches the diversity of acetonitrile degrading bacteria communities.

Description

Identification method of in-situ degrading bacteria of acetonitrile in wastewater

Technical Field

The invention relates to the technical field of microorganism identification, and particularly provides an identification method of in-situ degrading bacteria of acetonitrile in wastewater.

Background

With the rapid development of the industry in China, the content of nitrile compounds in industrial wastewater is increasing day by day, and the highest allowable discharge concentration of total cyanide in the industrial wastewater is specified in the Integrated wastewater discharge Standard (GB 8978 + 1996) in China: the primary standard and the secondary standard are both 0.5mg/L, and the tertiary standard is 1.0 mg/L. Therefore, the research on the treatment method of the nitrile-containing wastewater to effectively control the concentration of nitrile compounds in the wastewater and reduce the influence of the nitrile compounds on the environment and human bodies has very important practical value.

At present, chemical methods and biological methods are the main methods for treating nitrile-containing wastewater in sewage treatment plants. The results of the chemical method for treating the acrylonitrile wastewater by using the glycin and the like show that the complete removal of acrylonitrile can be realized by using the chemical oxidation method after 150 minutes of reaction under the conditions of pH of 2.5, 0.2mol/L hydrogen peroxide and 2.2V voltage. Although the chemical method can remove nitrile compounds in wastewater, the reaction conditions of the method are severe, and the intermediate product or additional product includes some potentially toxic secondary pollutants, and the operation cost is high, so that the defects of the chemical method limit the application of the chemical method in the actual production process.

The nitrile compounds can be mineralized by microorganisms under the aerobic condition, and the biological method is simple to operate and has no secondary pollution, so that the method can be used for treating nitrile compound polluted wastewater.

The Stable isotope labeling (SIP) technology was first investigated by Murrell's experimental team and found that SIP technology is implemented on the premise that the active mechanism within functional microorganisms is capable of assimilating heavy carbon or nitrogen sources into cellular components, such as DNA, RNA, proteins or Fatty Acid Methyl Esters (FAME). The isotope matrix is then enriched, separation of different cellular components from other microorganisms is achieved by different buoyant densities, and the biomarkers are then analyzed to identify active microorganisms. SIP has been used for CO₂And identifying functional microorganisms of target substrates of single carbon sources such as methane and methanol. Griffiths et al investigated the utilization of¹³C-labelled CO₂And the feasibility of tracking the community structure change of rhizosphere microorganisms by plant photosynthetic products is solved, and the relationship between the diversity of soil microorganisms and the in-situ carbon flow is analyzed. Ichikawa et al analyzed the effects of Methylococcaceae and Hyphomicrobiaceae in a methane denitrogenation activated sludge ecosystem. Neufeld et al found methyltype microorganisms in seawater that are associated with methanol metabolism, among othersA DNA fragment encoding a methanol dehydrogenase cluster may be involved in methanol metabolism. No research has been carried out to identify nitrile degrading bacteria by using an SIP method, and the reasons mainly include that: low assimilation rate of nitriles, cross-feeding phenomenon and strong adsorption of nitriles in environmental media.

Disclosure of Invention

In order to solve the problems in the prior art, the invention provides an identification method of in-situ degrading bacteria of acetonitrile in wastewater; the method screens out the functional microorganism with the acetonitrile degradation capability and enriches the acetonitrile degradation strain data.

In order to solve the technical problems, the invention provides the following technical scheme:

the invention provides an identification method of in-situ degrading bacteria of acetonitrile in wastewater, which comprises the following steps:

step 1: collecting activated sludge of a wastewater treatment plant for later use;

step 2: adding the activated sludge collected in the step 1¹⁵Performing acclimation culture on the N-labeled acetonitrile;

and step 3: adding at intervals¹⁵Carrying out sequencing batch culture on N-labeled acetonitrile;

and 4, step 4: performing activated sludge DNA extraction by centrifugal separation, and then purifying by adopting a DNA product purification kit; detecting the fragment length of the purified DNA by using 1% agarose gel electrophoresis, and measuring the concentration and the purity by using a spectrophotometer;

and 5: performing ultra-high speed centrifugation on the extracted DNA obtained in the step (4) to determine a heavy layer and a light layer;

step 6: determination by quantitative PCR¹⁵The abundance of 16S rRNA microorganisms in each layer of DNA of N-labeled acetonitrile;

and 7: in order to determine the community structure of the microorganism, a fragment of a hypervariable V4 region of a sample DNA 16S gene is amplified and then sequenced on an IlluminaMiseq platform;

and 8: the active acetonitrile degrading bacteria in the SIP treatment are identified by comparing the enrichment ratio, and the calculation method is shown as the following formula:

wherein, EF_SIPRepresents the enrichment rate in SIP systems; [ Abundannce]_HeavyAnd [ Abundannce]_LightRepresents the relative abundance of microorganisms in the heavy and light layer DNAs, respectively;

EF_SIPthe value was more than 2.0, and it was confirmed that the microorganism was a functional acetonitrile-degrading bacterium.

Further, in the step 1, an activated sludge sample is taken from the aeration reaction stage of the reactor, and the running state of the reactor is stable during sampling; after sampling, the sample is transported to a laboratory in time and stored at 4 ℃ for later use; wherein, the content of nitrile compounds in the activated sludge sample is less than 0.02 mg/L.

Further, in said step 2, added¹⁵The final concentration of N-labeled acetonitrile is 50-60 mg/L.

Further, in the step 3, the additive is added on the 3 rd, 6 th, 12 th, 18 th and 24 th days of experiment respectively¹⁵N-labelled acetonitrile, allowing addition¹⁵The final concentration of N-labeled acetonitrile is 50-60 mg/L.

Further, in the step 5, the density of the heavy layer buoyancy is 1.7258-1.7567 g/mL; the buoyancy density of the light layer is 1.6855-1.7193 g/mL.

Further, in the step 6, in the quantitative PCR determination process, the primer is 338F/806R, and the primer sequence is ACTCCTACGGGAGGCAGCAG/GGACTACHVGGGTWTCTAAT;

20 μ L of qPCR system included 2 μ L of each primer, 1 μ L of DNA template, 10 μ L of iTaq^TMUniversal

Green Supermix, made up to 20. mu.L with ultrapure water.

The qPCR reaction followed the following steps: pre-denaturation at 94 ℃ for 3min followed by 30 cycles at 94 ℃ for 30 s; 30s at 56 ℃; SYBR Green fluorescence signal collection was performed at 72 ℃ for 45s and after 20s at 72 ℃.

Further, in the step 7, the amplification primer of the fragment of the hypervariable V4 region of the 16S gene of the sample DNA is 341F/785R, and the primer sequence is CCTACGGGNGGCWGCAG/TACNVGGGTATCTAATCC;

a50. mu.L PCR system comprised 25. mu.L of premix, 1. mu.L of 100nM of each primer, and 10-100ng of DNA template.

The amplification reaction follows the following steps: pre-denaturation at 95 ℃ for 3min, followed by 35 cycles at 94 ℃ for 30 s; 1min at 55 ℃; PCR products were obtained at 72 ℃ for 1min and at 72 ℃ for 10 min.

Further, after sequencing on the Illumina misseq platform, reads containing pairing error primers, incorrect barcodes and fuzzy bases were filtered using QIIME, the remaining sequences were analyzed using Mothur, and information of operational classification units (OTU) was obtained.

Compared with the prior art, the invention has the following beneficial effects:

since the microorganisms involved in the degradation process of acetonitrile are only a very small part of the total microorganisms, the degradation process is improved by¹⁵The N mark is very key for further identifying the acetonitrile degrading bacteria. The invention is realized by utilizing¹⁵Culturing microorganisms in the activated sludge by using N-labeled acetonitrile, and dividing the activated sludge into an SIP system¹⁵N heavy layers and light layers; the microorganisms were then analyzed for EF_SIPValues, greater than 2.0 and no enrichment in light layer DNA, were determined to be acetonitrile degrading bacteria in the system.

In the SIP system, the OTU _561, OTU _627, OTU _363, OTU _347, OTU _245, OTU _87, OTU _180, OTU _1428 and OTU _1313 are determined to be acetonitrile degrading bacteria.

Drawings

FIG. 1 is a graph showing the relationship between DNA concentration (ng/. mu.L) and buoyant density (g/mL) in example 1 and comparative example 1 of the present invention;

FIG. 2 is a graph showing the acetonitrile degradation curves of example 1 of the present invention and comparative examples 1-2;

FIG. 3 is a chart of the abundance levels of various groups of microbiology of the present invention. The numbers "3" and "30" represent day 3 and day 30 samples, respectively, and T0 represents the raw activated sludge. Due to the fact that¹⁴N _ SIP and¹⁵the microbial community structure of N _ SIP is similar and is therefore denoted by "SIP";

FIG. 4 shows a phylogenetic tree of acetonitrile-degrading bacteria of the present invention, wherein the circle marks represent acetonitrile-degrading bacteria in a short-term treatment stage, and the diamond marks represent acetonitrile-degrading bacteria in a long-term treatment stage.

Detailed Description

In order to make the technical problems, technical solutions and advantages to be solved by the present invention clearer, the following detailed description is made with reference to specific embodiments and accompanying drawings.

Example 1

An identification method of in-situ degradation bacteria of acetonitrile in wastewater comprises the following steps:

an activated sludge sample is taken from the aeration reaction stage of the reactor, and the running state of the reactor is stable during sampling; after sampling, the sample is transported to a laboratory in time and stored at 4 ℃ for later use; wherein, the content of nitrile compounds in the activated sludge sample is less than 0.02 mg/L.

approximately 50mL of raw activated sludge was incubated in a 250mL beaker and then added to a final concentration of approximately 55mg/L¹⁵And N is marked by acetonitrile. And step 3: adding at intervals¹⁵Carrying out sequencing batch culture on N-labeled acetonitrile;

approximately 10mL samples were taken for analysis on

days

3, 6, 12, 18 and 24 of the experiment, respectively; then is added again¹⁵N-labelled acetonitrile, allowing addition¹⁵The final concentration of N-labeled acetonitrile was 55 mg/L. All samples from the SIP experiments were directly saved for subsequent analysis.

the method for extracting the DNA of the activated sludge comprises the following steps: (1) adding 0.4g of glass beads and 0.3g of activated sludge sample into a 2mL centrifuge tube; (2) vortex mixing the above solution and glass bead system; (3) vibrating on a mechanical cell disruptor at 2500g according to the instruction for 20s, and immediately inserting into ice for 5 min; (4) placing the treated sludge in a tank 2Adding 0.5mL of CTAB buffer solution into a mL centrifuge tube, covering a cover, freezing in liquid nitrogen for 3 minutes, transferring into boiling water for dissolving for 3 minutes, and repeatedly operating for 3 times; (5) adding 100 mu L (0.3g/mL) of lysozyme and 3 mu L (10mg/mL) of RNase into a centrifuge tube, and carrying out warm bath at 37 ℃ for 1 h; (6) adding 0.5mL (20%) of Sodium Dodecyl Sulfate (SDS) solution, 100. mu.L (10mg/mL) of protease, and incubating at 37 ℃ for 2 h; (7) centrifuging at 12000g for 10min, and transferring the supernatant into a new centrifuge tube; (8) adding phenol/chloroform (1: 1) mixture of equal volume, slightly turning upside down for several times, mixing, centrifuging at 12000g and 4 deg.C for 10min, and transferring the supernatant into a new centrifuge tube. This process was repeated 1 time; (9) adding 0.6-0.7 volume of isopropanol, and mixing by turning upside down. Placing the sample in a refrigerator at 4 ℃ and precipitating for 1h or overnight; (10) centrifuging the sample at 14000g for 20min at 4 ℃, and pouring out the supernatant; (11) adding 1mL of 70% ethanol into the precipitate, washing, and slightly shaking; (12) centrifuging the sample at 12000g for 10min at 4 deg.C, pouring out the supernatant, and repeating the process once; (13) with 100. mu.L ddH₂O suspending the sample. The obtained DNA sample was purified using a DNA product Purification Kit (Tiangen), the length of the fragment was detected by 1% agarose gel electrophoresis of the purified DNA, and the concentration and purity (concentration) were measured using a Nanodrop spectrophotometer>50 ng/. mu.L, OD 260/280 between 1.7-2.0).

for the DNA in the SIP experiment, after the concentration is determined by using NanoDrop, ultra-high-speed centrifugation is carried out, wherein during the centrifugation: about 10. mu.g of the DNA sample was added to the centrifuge tube and mixed with a Tris-EDTA (pH 8.0) -CsCl solution to give a buoyant density of about 1.77 g/mL. And measuring the refractive index of the DNA by using a digital refractometer to obtain the buoyancy density. After equilibration, the heat sealed centrifuge tube was placed in a centrifuge and centrifuged at 45000g (20 ℃) for 48 hours. After centrifugation, the buoyant density of each layer of DNA was determined and the DNA was purified. The relationship between the buoyancy density of each layer and the DNA concentration is shown in FIG. 1.

determination by quantitative PCR¹⁵The abundance of 16S rRNA microorganisms in each layer of DNA marked by N acetonitrile is 338F/806R, the sequence of the primer is ACTCCTACGGGAGGCAGCAG/GGACTACHVGGGTWTCTAAT, the 20 mu L qPCR system comprises 2 mu L of respective primers, 1 mu L of DNA template and 10 mu L of iTaq^TMUniversal

Green Supermix, made up to 20. mu.L with ultrapure water. The standard curve was determined using a standard sample with a known ten-fold serial dilution copy number. The qPCR reaction followed the following steps: pre-denaturation at 94 ℃ for 3min followed by 30 cycles (94 ℃ for 30 s; 56 ℃ for 30 s; 72 ℃ for 45 s). SYBR green fluorescence signal collection was performed 20s after 72 ℃.

to determine the colony structure of the microorganism, a fragment of the hypervariable V4 region of the 16S gene of the sample DNA was amplified with the primer sequence 341F/785R (CCTACGGGNGGCWGCAG/TACNVGGGTATCTAATCC). A50. mu.L PCR system comprised 25. mu.L of premix, 1. mu.L of each primer (100nM), and 10-100ng of DNA template. The reaction follows the following steps: pre-denaturation at 95 ℃ for 3min followed by 35 cycles (94 ℃ for 30 s; 55 ℃ for 1 min; 72 ℃ for 1min) to obtain PCR products after 10min at 72 ℃. After the PCR product is processed, sequencing is carried out on an IlluminaMiseq platform. Reads containing paired wrong primers, incorrect barcodes and fuzzy bases were filtered using qiime (quantitative instruments intramicrobiological biology), the remaining sequences were analyzed using Mothur, and informative on the Operational Taxon (OTU).

wherein, EF_SIPRepresents the enrichment rate in the SIP system, [ Abundannce]_HeavyAnd [ Abundannce]_LightRepresents the relative abundance of microorganisms in the heavy and light layer DNAs, respectively;

All statistical calculations were done by SPSS 17.0. One-way anova and T-test were used to analyze the difference in acetonitrile residue and 16S gene copy number and statistical significance of the variance in different treatments (p < 0.05). The relationship between the efficiency of acetonitrile degradation and the microorganisms that play a role in acetonitrile degradation was analyzed using canco 4.5 and the data are expressed as mean ± standard deviation.

Comparative example 1

All the way to¹⁴N acetonitrile substitution¹⁵N is labeled with acetonitrile, the other conditions being the same as in example 1, to¹⁴N _ SIP represents.

Comparative example 2

With sterilized sludge samples and¹⁴replacement of activated sludge with N acetonitrile¹⁵N is acetonitrile, and the other conditions are the same as in example 1, and is represented by Stetile Control.

Comparative example 3

The raw activated sludge is used as a blank control and is expressed by CK _ SIP.

1. Analysis of acetonitrile degradation Curve

About 10mL of the above samples were taken on

experimental days

3, 6, 12, 18 and 24 for analysis of the acetonitrile degradation curve.

Analyzing the acetonitrile concentration of each sampling time point in two experiments by adopting a gas chromatography, preserving the sample by using a brown reagent bottle with a polytetrafluoroethylene liner screw cap, and simultaneously taking the same batch of experimental water as a whole process blank, wherein the specific chromatographic analysis conditions are as follows: the chromatographic column is a quartz capillary chromatographic column (the inner diameter is 30m multiplied by 0.32mm, the thickness is 1.0 μm), a water phase needle type filter (polyether sulfone or mixed cellulose ester, 13mm, 0.45 μm) is used for filtering a sample until a sample bottle is tested, the sample injection volume is 1 μ L, the sample injection port temperature is 220 ℃, the column box temperature is 50 ℃, the flame detector temperature is 330 ℃, the hydrogen flow is 50mL/min, and the air flow is 500 mL/min.

As shown in fig. 2, no acetonitrile was detected in the CK _ SIP experimental group and therefore not listed in fig. 2. The reduction range of the acetonitrile concentration in the StetileControl experimental group is very small (from 52mg/L to 48mg/L), and the concentration of the residual acetonitrile in the sterilization experimental group is obviously higher than that of other experimental groups, which indicates that the acetonitrile biodegradation process exists in the rest reaction systems.

During the short-term (first 3 days) treatment,¹⁴the degradation rate of acetonitrile in the N _ SIP system is 55.4 percent and 1 percent⁵The degradation rate in the N _ SIP system is 55.0%. During the short-term treatment, acetonitrile was degraded in all experimental groups with little difference in degradation rate. Unlabeled acetonitrile with¹⁵The degradation conditions of the acetonitrile in the two experimental groups of N-marked acetonitrile have no obvious difference (p)>0.05)。

In the long-term sequencing batch treatment stage, acetonitrile is continuously added into the reaction system to acclimatize and culture the functional degradation bacteria, the degradation rate of the acetonitrile is continuously increased until the 18 th day¹⁴N _ SIP and¹⁵the degradation rates of acetonitrile in N _ SIP are respectively 70.6% and 70.7%.

Continuing to acclimatize and culture until the day 30,¹⁴N_SIP，¹⁵the degradation rates of acetonitrile in N _ SIP are respectively up to 83.7% and 83.6%, which also indicates that functional acetonitrile degradation bacteria are enriched in the sequencing batch reactor, so that the degradation effect of acetonitrile in a long-term treatment stage is better.

2. Total microbial community structure changes

After screening filtration, high throughput sequencing (IlluminaMiseq sequencing) yielded 1245545 sequences in total, which belonged to 1478 different OTUs. Fig. 3 shows the distribution of OTUs at the department level identified in SIP experiments at different time points. Wherein, the microbial community structure of CK _ SIP experimental group was not significantly different from the original microbial community during the experiment, and thus not shown in the figure. The family level of 20 species predominates over all the sorted sequences, accounting for over 70% of all sequences.

In the original activated sludge sample (T0), the dominant microorganisms were Hydrogenophilaceae (10.08%), commemoraceae (7.40%), Chitinophagaceae (7.28%), analolinaceae (6.69%) and Acidobacteria (5.31%), respectively.

During the short treatment period (3 days before the experiment),¹⁴n _ SIP and¹⁵n _ SIP two experimentsThere was no significant difference in the microbial community structure of the groups (p)>0.05)。¹⁴N _ SIP and¹⁵the main microorganisms in the two experimental groups of N _ SIP include: paenibalcillaceae (19.62-19.83%), Hydrogenophilaceae (12.37-12.42%), Rhodocyclaceae (11.78-11.64%), and Commamondalaceae (6.16-6.25%).

During the long-term sequencing batch processing phase, the microbial community structure changes significantly. After 30 days of sequencing batch culture, the main microorganisms in the SIP system include: rhodocyclaceae (11.73-11.82%), Hyphomiciacea (5.88-5.92%) and Nocardiaceae (5.42-5.51%). The microbial community structure changes continuously as the reaction progresses, but whether the microorganisms are acetonitrile degradation functional bacteria needs to be further analyzed.

3. Microorganism α -diversity analysis

The α -diversity index of the original samples and the SIP sample DNA for the short-term (3 days before the test) and long-term treatment phases are shown in Table 1.

TABLE 4 original samples and SIP samples DNA α -diversity index Table at different stages of processing

The indexes of the original sludge samples, namely the index values of Chao 1, Shannon and Simpson, are 871, 4.84 and 0.020, and in the short-term treatment stage, the indexes of the original sludge samples, namely the index values of the original sludge samples, are 738, the index values of the original sludge samples, namely the index values of the original sludge samples, are Shannon and Simpson, are 4.55 and 0.025.

In the long-term treatment phase, the reaction proceeded to day 30, the indexes of Chao 1, Shannon and Simpson of the SIP experimental group were 568, 3.67 and 0.063, respectively, the indexes of Chao 1 and Shannon gradually decreased during the whole experiment, and the index of Simpson gradually increased.

4. Acetonitrile degradation functional microorganism prepared by SIP method

Since the microorganisms involved in the degradation process of acetonitrile are only a very small part of the total microorganisms, the degradation process is improved by¹⁴The N mark is very key for further identifying the acetonitrile degrading bacteria. From FIG. 1: (¹⁴N _ SIP and¹⁵relation between DNA concentration and buoyancy density in N _ SIP experimental group) can be known, and short-term treatment is carried outIn the course of the phase(s),¹⁴n _ SIP and¹⁵the light layer and the heavy layer of the N _ SIP sample are 1.6714-1.6983g/mL and 1.7169-1.7388g/mL respectively.

In the short-term processing stage, OTU _1083, OTU _339, OTU _1065 and OTU _907 are in the heavy layer (1.7169-1.7388g/mL)¹⁵The relative abundance in the N _ SIP experimental group (1.31-1.33%, 1.30-1.34%, 1.32-1.36% and 2.78-2.81%) is significantly higher than that in the N _ SIP experimental group¹⁴The N _ SIP experimental group (0.10-0.12%, 0.41-0.44%, 0.46-0.48% and 1.07-1.11%), the values of the above microorganisms are all greater than 2.0. In contrast, no such enrichment or similar trend was found in the light layer (1.6714-1.6983g/mL) of DNA. Therefore, OTU _1083, OTU _339, OTU _1065 and OTU _907 are the active acetonitrile degrading bacteria identified in the SIP experiment. Wherein, OTU _1083, OTU _339 and OTU _1065 belong to Pseudomonadaceae, Gammaproteobacteria and Xanthomonadale, respectively, and all the three OTUs belong to Proteobacteria. The phylogenetic information of the acetonitrile-degrading bacteria identified in the experiment is shown in FIG. 4, and it can be seen from FIG. 4 that the degree of similarity between OTU _1083 and OTU _339 and Pseudomonas MarginalisA TCC10844(NR112072) and Pseudomonas putida strain R43(KC990820.1) reaches 100%. OTU _907 belongs to Ferriginibacter (Bacteroidete gate, Sphingobacteria), and has 100% similarity to Rhodococcus rhodochrous PA-34(HF 543938.1).

In the long-term treatment stage, the treatment,^14NSIP and¹⁵the light layer and the heavy layer of the N _ SIP sample DNA are 1.6855-1.7193g/mL and 1.7258-1.7567g/mL respectively. In the SIP system, OTU _561, OTU _627, OTU _363, OTU _347, OTU _245, OTU _87, OTU _180, OTU _1428 and OTU _1313 are in a heavy layer (1.7258-1.7567g/mL)¹⁵The relative abundance (2.10-2.13%, 3.95-3.99%, 4.76-4.81%, 5.31-5.36%, 3.04-3.06%, 3.21-3.24%, 4.45-4.47%, 4.36-4.38% and 1.08-1.09%) of the N _ SIP experimental group is significantly higher than that of the N _ SIP experimental group¹⁴N _ SIP experimental group (0.01-0.03%, 0.08-0.10%, 0.19-0.23%, 0.35-0.43%, 0.65-0.69%, 0.76-0.81%, 1.01-1.03%, 0.85-0.89%, and 0.05-0.08%). All of the above microorganisms had values greater than 2.0 and were not enriched in light layer DNA, so they were identified as acetonitrile-degrading bacteria in the system. OTU _561 belongs to Bacteroides phylum, class Sphingobacteria, order Sphingobacteriales, Moraxelleceae family; OTU _627 belongs to Proteobacteria, Alphaproteobacteria, Rickettsiales _ Incertae _ Sedis; OTU _363 belongs to the phylum Chlamydiae, class Chlamydiae, order Chlamydiales, family cvE 6; OTU _347 belongs to the phylum Proteobacteria, class Gamma, order HTA4, family norank _ o __ HTA 4; OTU _245 belongs to the family SBR1093, NORANK _ p __ SBR1093 class, NORANK _ p __ SBR1093 order, NORANK _ p __ SBR10931 family; OTU _87 belongs to the phylum Proteobacteria, class DeltaProteobacteria, order Bdellovibrionales, family Bdellovibrionaceae. As can be seen from FIG. 4, the similarity between OTU _561 and OTU _245 and the Acinetobacter eigen KiistrrainT 6CT5(MG675607.1) is 100%. OTU _180 belongs to the phylum Cyanobacter, class Cyanobacter, order Obscuuribacter, family Norank _ o __ Obscuuribacter, and has a similarity of 100% to Corynebacterium aurimucosume 1-3(AB 269764); OTU _1428 belongs to the phylum Cyanobacter, class Cyanobacter, order Obscurvirales, family Norank _ o __ Obscurvirales; OTU _1313 belongs to the phylum Saccharomyces, norak _ p __ class Saccharomyces, order norak _ p __ Saccharomyces, family norak _ p __ Saccharomyces.

The diversity of functional microorganisms has also been studied in experiments with changes in external conditions. Comparing the acetonitrile degrading bacteria obtained in the short-term and long-term treatment stages, the degrading bacteria screened in the two stages are found to have obvious difference. In the short-term treatment stage, SIP identified 4 (Pseudomonas, unclassified Gamma, Xanthomalades and Chitinophagae) microorganisms involved in the acetonitrile degradation process. Among these, 4 microorganisms have been reported to participate in the degradation process of nitriles. However, acetonitrile is periodically added to the reaction system as the reaction proceeds, and the kind of acetonitrile-degrading bacteria is also changed. During the long-term sequencing batch treatment, new acetonitrile-degrading microorganisms, cvE6, norank _ o __ HTA4, Bdellovirobacteriaceae, Moraxelleceae, Rickettssinesincertae _ sedis, SBR1093, Obscuuribacter, Rhodocyclaceae and Saccharobacteria, appeared in the reaction system.

These 9 microorganisms have not been found to be associated with acetonitrile degradation, so the results of this study provide strong evidence that they are acetonitrile-degrading bacteria, thus enriching the diversity of acetonitrile-degrading bacteria communities. The acclimatization culture mode screens out some microorganisms which have slow growth speed but also participate in the acetonitrile degradation process, and the microorganisms begin to play a role in the acetonitrile degradation process after being adapted to the environment. Meanwhile, the assimilation rate of acetonitrile gradually increases with the progress of the reaction, and the marker in the SIP method is assimilated into intracellular substances. In addition, most of the microorganisms identified during short-term processing have been reported to be involved in the degradation of nitriles. After acetonitrile is added into the system regularly for acclimatization culture, functional microorganisms identified by the two methods are not reported to participate in the degradation of nitrile compounds, the reports on the microorganisms are few, but the acclimatization culture stage is closer to the actual situation of a reactor of a sewage treatment plant in production and life, the functional degrading bacteria which really play a role in the degradation process can be truly reflected, the strain data of acetonitrile biodegradation is enriched, and the method has a reference value.

While the foregoing is directed to the preferred embodiment of the present invention, it will be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention as defined in the appended claims.

Sequence listing

<110> university of Beijing teachers

<120> identification method of in-situ degradation bacteria of acetonitrile in wastewater

<130>14

<160>4

<170>SIPOSequenceListing 1.0

<210>1

<211>20

<212>DNA

<213> Artificial sequence ()

<400>1

actcctacgg gaggcagcag 20

<210>2

<211>20

<212>DNA

<213> Artificial sequence ()

<400>2

ggactachvg ggtwtctaat 20

<210>3

<211>17

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(9)..(9)

<223>n is a, c, g, or t

<400>3

cctacgggng gcwgcag 17

<210>4

<211>18

<212>DNA

<213> Artificial sequence ()

<220>

<221>misc_feature

<222>(4)..(4)

<223>n is a, c, g, or t

<400>4

tacnvgggta tctaatcc 18

Claims

1. The method for identifying in-situ degradation bacteria of acetonitrile in wastewater is characterized by comprising the following steps:

2. The method for identifying in-situ degradation bacteria of acetonitrile in wastewater according to claim 1, wherein in the step 1, the activated sludge sample is taken from the aeration reaction stage of the reactor, and the running state of the reactor is stable when the activated sludge sample is taken; after sampling, the sample is transported to a laboratory in time and stored at 4 ℃ for later use; wherein, the content of nitrile compounds in the activated sludge sample is less than 0.02 mg/L.

3. The method for identifying in-situ degradation bacteria of acetonitrile in wastewater according to claim 1, wherein in the step 2, the added bacteria¹⁵The final concentration of N-labeled acetonitrile is 50-60 mg/L.

4. The method for identifying in-situ degradation bacteria of acetonitrile in wastewater according to claim 1, wherein in the step 3, the acetonitrile is added in the experiment on days 3, 6, 12, 18 and 24 respectively¹⁵N-labelled acetonitrile, allowing addition¹⁵The final concentration of N-labeled acetonitrile is 50-60 mg/L.

5. The method for identifying in-situ degradation bacteria of acetonitrile in wastewater according to claim 1, wherein in the step 5, the density of the buoyancy of the heavy layer is 1.7258-1.7567 g/mL; the buoyancy density of the light layer is 1.6855-1.7193 g/mL.

6. The method for identifying in-situ degradation bacteria of acetonitrile in wastewater according to claim 1, wherein in the step 6, in the quantitative PCR determination process, the primer is 338F/806R, and the primer sequence is ACTCCTACGGGAGGCAGCAG/GGACTACHVGGGTWTCTAAT;

Green Supermix, made up to 20. mu.L with ultrapure water.

7. The method for identifying in-situ degrading bacteria of acetonitrile in wastewater according to claim 6, wherein the qPCR reaction follows the following steps: pre-denaturation at 94 ℃ for 3min followed by 30 cycles at 94 ℃ for 30 s; 30s at 56 ℃; SYBR Green fluorescence signal collection was performed at 72 ℃ for 45s and after 20s at 72 ℃.

8. The method for identifying in situ degradation bacteria of acetonitrile in wastewater according to claim 1, wherein in the step 7, the amplification primer of the fragment of the hypervariable V4 region of the sample DNA 16S gene is 341F/785R, and the primer sequence is CCTACGGGNGGCWGCAG/TACNVGGGTATCTAATCC;

9. The method for identifying in situ degrading bacteria of acetonitrile in wastewater according to claim 8, wherein the amplification reaction follows the following steps: pre-denaturation at 95 ℃ for 3min, followed by 35 cycles at 94 ℃ for 30 s; 1min at 55 ℃; PCR products were obtained at 72 ℃ for 1min and at 72 ℃ for 10 min.

10. The method for identifying in situ degradation bacteria of acetonitrile in wastewater according to claim 9, wherein after sequencing by illumina misseq platform, reads containing pairing error primers, incorrect barcodes and fuzzy bases are filtered using QIIME, the rest sequences are analyzed using Mothur, and information of operation classification unit (OTU) is obtained.