CN110951765A - Multi-copy integration method for synthetic gene cluster of natural product of actinomycetes - Google Patents

Abstract

The invention discloses a system, which comprises: a first plasmid containing a multiple cloning site MCS, a streptomyces promoter kasOp, an integrating gene, a resistance gene, a universal assembly joint, SpeI and a SwaI restriction enzyme cutting site; a second plasmid containing a foreign gene cluster, an integrating gene, a resistance gene, and a universal assembly joint; CRISPR/Cas9 reaction system; gibson assembles the reaction system. The system is plug-and-play type, and can efficiently integrate multiple copies of natural product synthetic gene clusters on actinomycete genome.

Description

Multi-copy integration method for synthetic gene cluster of natural product of actinomycetes

Technical Field

The invention belongs to the field of metabolic engineering, relates to an integration system for integrating a multi-copy gene cluster on an actinomycete genome and application thereof, and particularly relates to a multi-copy integration method for an actinomycete natural product synthetic gene cluster and an integration system for implementing the method.

Background

The natural products (also called secondary metabolites) produced by microorganisms and having biological activity are valuable resources for human beings to resist cancers, aging, infectious diseases and the like. Taking antibiotics as an example, it is statistical that about 50% of the antibiotics of natural origin have been reported to be produced by Streptomyces of the family Actinomycetaceae. The antibiotic biosynthesis gene cluster comprises genes of structure, resistance, efflux, regulation, post-modification and the like, and the size of the gene cluster is generally different from 10 kb to 100 kb. With the rapid development of metabolic engineering, a variety of strategies that are advantageous for increasing antibiotic production are being developed and applied, including optimizing regulatory networks, reducing competitive pathways, increasing tolerance, and amplifying synthetic gene cluster copy number. These strategies avoid the large time and labor costs associated with traditional mutagenesis screens and can effectively optimize the biosynthesis of secondary metabolites.

Streptomyces hygroscopicus (Streptomyces hygroscopicus) is an actinomycete that can produce 5-keto-milbemycins (5-oxomilbemycins) under appropriate conditions. Milbeximes, a derivative of 5-keto milbemycins, have been widely used for plant pest and animal parasite control in the united states, japan, taiwan, and the like. Therefore, the construction of the engineering bacteria of the high-yield 5-ketomilbemycin can obviously accelerate the domestic industrialization process of the derivative milbemycin oxime.

Although actinomycetes are now widely used for producing various important natural drugs, in view of the complex metabolic mechanism and the large number of uncertain factors in the production process, there is still a need in the art to further develop technologies for optimizing the biosynthetic pathway, optimizing regulatory networks, etc. in order to further improve the yield of natural drugs.

In order to integrate multiple copies of a natural product synthetic gene cluster into the genome of an actinomycete, such as Streptomyces, we have previously developed a gene that is characterized by the natural presence of many attB sites corresponding to different integration systems in the actinomycete genomeGene cluster multi-copy amplification method based on concept of 'one integrase-multiple attB sites' (MSGE)MultiplexedSite-specificGenomeEngineering) (Li et al, metabolic engineering,2017), the mechanism of which is shown in figure 1. In vitro gene cluster editing method CGE (in the following description)CRISPR/Cas9 andGibson assembly-assisted DNAEAnd with the assistance of diting), the defects that a plurality of attB sites on the traditional actinomycete genome need to be manually introduced and are time-consuming and labor-consuming are overcome, and multi-copy insertion can be realized in one step by directly adding a plurality of sets of integration systems in a vector containing a target gene cluster. However, later researches find that the MSGE method also has some defects, for example, if more than 4 copies are simultaneously inserted in one step, the success rate is relatively difficult; the method needs to insert exogenous attB sites into chromosomes in advance, and is time-consuming; this approach is difficult to use for strains with difficult genetic manipulation, as at this point the exogenous attB site would no longer be able to be introduced using the efficient CRISPR/Cas9 technique, and so on. Therefore, in order to overcome the defects of the MSGE method, it is necessary to further develop a new generation gene cluster multi-copy amplification method.

Disclosure of Invention

In order to overcome the defects of an MSGE method and overcome the defects of difficulty and low success rate when multi-copy simultaneous insertion of an actinomycete genome is realized in one step, a multi-copy integration method for two-round iterative insertion of a target gene cluster into the actinomycete genome is designed.

Accordingly, it is a first object of the present invention to provide a plug-and-play integration system or integration kit for integrating multiple copies of a gene cluster.

It is a second object of the present invention to provide a method for integrating a multicopy gene cluster in an actinomycete genome.

In order to achieve the purpose, the invention adopts the following technical scheme:

an integration system for integrating a multicopy gene cluster on an actinomycete genome, comprising a first plasmid comprising thereon: a multiple cloning site MCS for integrating a foreign gene cluster (or target gene cluster) such as a natural product synthetic gene cluster; a streptomyces promoter kasOp located upstream of the multiple cloning site MCS; two or more kinds of integration genes as integration sites selected from DNA fragments of phage-derived integrase Φ C31, Φ BT1, R4, SV1 or TG1 gene binding attP site, i.e., ΦC31Att/Int (abbreviated as C), Φ BT1Att/Int (abbreviated as B), R4Att/Int (abbreviated as R), SV1Att/Int (abbreviated as S), TG1Att/Int (abbreviated as T); a first resistance gene adjacent to the integration gene selected from the group consisting of the aprana resistance gene acc (3) IV, the kana resistance gene aphII, the thiostrepton resistance gene tsr; universal assembly linkers, i.e., upstream linkers and downstream linkers, located upstream and downstream of the integration gene and the first resistance gene, respectively; restriction sites for SpeI and SwaI, symmetrically located at both ends of the upstream and downstream adapters, respectively, leaving one restriction site for SpeI or SwaI after digestion with the other.

Preferably, the above integration system further comprises a second plasmid comprising thereon: foreign gene clusters (or target gene clusters) such as natural product synthetic gene clusters; one or more than two kinds of integration genes as integration sites, wherein the integration genes are selected from the DNA fragments of phi C31, phi BT1, R4, SV1 or TG1 genes combined with attP sites, and when more than two kinds of integration genes are contained, the integration genes are different from the integration genes on the first plasmid; a second resistance gene adjacent to the integrated gene, said resistance gene being selected from the group consisting of the aprana resistance gene acc (3) IV, the kanamycin resistance gene aphII, the thiostrepton resistance gene tsr, and being different from the first resistance gene; the universal assembly linkers, i.e., upstream and downstream linkers, are located upstream and downstream of the integrating gene and the second resistance gene, respectively.

For example, when two integrants on a first plasmid are paired for Φ C31/Φ BT1 or R4/SV1, the two compatible integrants on a second plasmid can be R4/SV1 or Φ C31/Φ BT 1; or only one integrating gene on the second plasmid, such as Φ C31.

The meaning of "pairing" and "matching" of two or more kinds of integrated genes is the same, and both refer to a combination mode between two or more different integrated genes.

Preferably, the first plasmid comprises two integrative genes selected from the group consisting of the Φ C31/Φ BT1 or R4/SV1 pair.

Preferably, the second plasmid may contain only one integration gene such as Φ C31.

In one embodiment, the integration system further comprises a CRISPR/Cas9 reaction system for gene editing of the second plasmid, and a Gibson assembly reaction system.

The foreign gene cluster may be a 5-ketomilbemycin synthesis gene cluster.

As a specific application of the "multiple integrase-multiple attB sites" system, it is preferred that the above integration system is in the form of a kit.

In a preferred embodiment, the integrated system can perform two rounds of plug and play operations: performing gene editing on a second plasmid by using a CRISPR/Cas9 reaction system, and removing an integrated gene such as phi C31 and a second resistant gene such as acc (3) IV on the plasmid by using a Cas9 endonuclease to obtain a first round of non-resistant plasmid containing an exogenous gene cluster, an upstream joint and a downstream joint; digesting the first plasmid by using a restriction enzyme SpeI or SwaI to remove the integrated gene such as R4/SV1 and the first resistance gene such as aphII to obtain a first round DNA fragment containing the integrated gene such as R4/SV1, the first resistance gene such as aphII, an upstream joint and a downstream joint; assembling the first round of non-resistant plasmids and the first round of DNA fragments together by adopting a Gibson reaction system to obtain a first round of modular plasmids, wherein the number of integrated genes on the first round of modular plasmids is the same as that of the first plasmids, and is 2 for example;

secondly, performing enzyme digestion on the first round of modular plasmids, and performing enzyme digestion by using another restriction enzyme SwaI or SpeI to remove the integrated gene such as R4/SV1 and the first resistance gene such as aphII to obtain a second round of non-resistance plasmids containing the exogenous gene cluster, the upstream adaptor and the downstream adaptor; digesting another first plasmid, wherein the integrated gene on the plasmid, such as phi C31/phi BT1, and the resistance gene, such as acc (3) IV, are different from the integrated gene on the first plasmid in the first round, such as R4/SV1, and the resistance gene, such as aphII, removing the integrated gene, such as phi C31/phi BT1, and the resistance gene, such as acc (3) IV, by using a restriction enzyme SpeI or SwaI to obtain a second round DNA fragment containing the integrated gene, such as phi C31/phi BT1, the resistance gene, such as acc (3) IV, an upstream adaptor and a downstream adaptor; and (3) assembling the second round non-resistant plasmid and the second round DNA fragment by adopting a Gibson reaction system to obtain a second round modular plasmid, wherein the number of the integrated genes on the second round modular plasmid is the same as that of the other first plasmid, for example, 2.

Preferably, the integration system can also repeatedly perform plug-and-play operations of a third round, a fourth round and the like, like the second round, and does not need to perform CRISPR/Cas9 reaction of the first round, but directly adopts an enzyme digestion-Gibson assembly mode to construct a third round of modular plasmids, a fourth round of modular plasmids and the like; and so on.

The invention also provides a method for integrating the multi-copy exogenous gene cluster on the actinomycete genome, which comprises the following steps: the first round of the modular plasmid constructed above was used to transform actinomycete cells to integrate a foreign gene cluster into the actinomycete genome under the mediation of phage-derived integrase. At this time, the copy number of the integrated foreign gene cluster was the same as the number of the integrated genes on the first round of modular plasmids.

Thus, the insertion of multiple copies of the foreign gene cluster can be achieved with high success rate by one-step integration.

Preferably, the above method further comprises the steps of: and continuing to transform the constructed actinomycete cells by using the constructed second round modular plasmid so as to integrate the exogenous gene cluster into the actinomycete genome again under the mediation of the phage-derived integrase. At this time, the copy number of the integrated foreign gene cluster on the actinomycete genome is the sum of the number of integrated genes on the first round of modular plasmids and the second round of modular plasmids.

Thus, the insertion of multiple copies of the foreign gene cluster can be realized with high success rate by adopting two rounds of iterative integration.

Preferably, the above method further comprises the steps of: continuing to use the constructed third round of modular plasmids, the fourth round of modular plasmids and the like to transform the constructed actinomycete cells, so as to integrate the exogenous gene cluster onto the actinomycete genome again under the mediation of the phage-derived integrase; and so on. Thus, insertion of more copies of the foreign gene cluster can be achieved with high success rate by adopting multiple rounds of iterative integration, and the copy number of the foreign gene cluster integrated on the actinomycete genome is the sum of the number of the integrated genes on the plurality of modular plasmids.

Preferably, 3, 4 or 5 copies of the foreign gene cluster can be integrated into the actinomycete genome by the above method.

The actinomycetes is Streptomyces hygroscopicus, for example. Preferably, the foreign gene cluster is a 5-ketomilbemycin synthesis gene cluster.

The integration system can realize multi-copy stable insertion of the exogenous gene cluster by loading a series of orthogonal site-specific integration sites in a plasmid vector containing the exogenous gene cluster and utilizing an integration site attB naturally existing in an actinomycete genome under the mediation of integrase from a bacteriophage by one-step or two-step integration operation, thereby greatly improving the yield of a target product. When the streptomyces hygroscopicus for producing the 5-ketomilbemycins is modified, the amplification of 5-ketomilbemycins synthetic gene clusters with at most 5 copies is realized, the genetic characters of the obtained engineering bacteria are stable, and the yield of the 5-ketomilbemycins of the engineering bacteria is also gradually improved along with the increase of copy numbers. Therefore, the method disclosed by the invention is simple to operate, the molecular breeding time is greatly shortened, the obtained engineering bacteria are stable in genetic character, and the method is particularly suitable for industrial bacteria with difficult genetic operation and has wide application prospects. The method has universality and can be widely used for breeding and modifying other industrial actinomycete molecules except the streptomyces hygroscopicus.

Drawings

FIG. 1 is a schematic diagram of the strategy of the earlier developed gene cluster multicopy integration method MSGE. Wherein the phi C31, the phi BT1, the R4 and the SV1 are site-specific integration sites, and the phi C31-attB, the phi BT1-attB, the R4-attB and the SV1-attB are corresponding integration sites on an actinomycete genome. 4 sets of orthogonal site-specific integration systems are added on a plasmid vector containing a target gene cluster, so that 4 copies of the target gene cluster are inserted in one step under the mediation of four sets of integrases, and 4 target gene clusters are contained in an integrated actinomycete genome.

FIG. 2 is a schematic diagram of the two-round iterative multi-copy integration method of the target gene cluster of the present invention, i.e., multiple integrases and multiple attB sites. Wherein acc (3) IV is an apra resistance gene and aphII is a kanamycin resistance gene. By respectively adding 2 sets of orthogonal site-specific integration systems on 2 plasmid vectors containing the target gene cluster, the insertion of 4 copies of the target gene cluster can be realized by adopting two rounds of iterative integration, and the actinomycete genome after integration contains 4 target gene clusters.

FIG. 3 is a schematic diagram of the composition and structure of a plug-and-play target gene cluster multi-copy integration system (or integration kit) constructed according to the present invention. Wherein FIG. A shows the basic kit components comprising 5 sets of integrating genes Φ C31Att/Int (abbreviated C), Φ BT1Att/Int (abbreviated B), R4Att/Int (abbreviated R), SV1Att/Int (abbreviated S), TG1Att/Int (abbreviated T), 2 resistance genes (or resistance elements) acc (3) IV (Aprena resistance gene), aphII (kana resistance gene), 2 universal assembly linkers, i.e., upstream and downstream linkers, as integrating sites; panel B shows modular plasmids containing different sets of integration systems.

FIG. 4 is a schematic diagram showing the operation of the present invention in which multiple sets of integration systems are added to a plasmid containing a target gene cluster. Illustrating the situation of two rounds of iterative integration of 4 copies of the target gene cluster, wherein the first round is an in vitro gene cluster editing method CGE, and the integration and insertion of 2 target gene clusters on an actinomycete genome are realized; the second round no longer uses Cas9 endonuclease to remove integration resistance elements, but uses restriction enzyme excision, by adding integrase to achieve the integration of 2 other target gene clusters on the actinomycete genome.

FIG. 5 is a schematic diagram of the structures of plasmids pCL01-milbe, BAC-milbe-S, BAC-milbe-C and BAC-milbe-CB containing different integration systems and 5-ketomilbemycin synthetic gene clusters constructed by the present invention. Wherein A is pCL01-milbe comprising 1 set of integration system Φ C31 and yeast maintenance elements, B is BAC-milbe-S comprising 1 set of integration system SV1, C is BAC-milbe-C comprising 1 set of integration system Φ C31, and D is BAC-milbe-CB comprising 2 sets of integration system Φ C31/Φ BT 1.

FIG. 6 is a photograph of gel electrophoresis for identifying cleavage of the plasmid shown in FIG. 5. Wherein plasmids pCL01-milbe, BAC-milbe-S, BAC-milbe-C and BAC-milbe-CB are subjected to XhoI enzyme digestion for identification; m represents a 1kb DNA marker.

FIG. 7 is a time series fermentation result graph of engineering bacteria KF200, KF201, KF202 and KF203 constructed by the invention and respectively containing 0, 1, 2 and 3 copies of exogenous 5-ketomilbemycin synthesis gene clusters. Samples were taken at 4, 6, 10, 14, 16 days of fermentation to determine the 5-keto-milbemycin production.

Detailed Description

The present invention will be described in further detail with reference to specific examples. It should be understood that the following examples are illustrative only and are not intended to limit the scope of the present invention.

Similar to the earlier developed principle of the gene cluster multicopy integration method MSGE (Li et al, metabolic engineering,2017), the present invention also utilizes the principle of homologous recombination between phage-derived integrases such as Φ C31, Φ BT1, R4, TG1, SV1, Φ Joe mediated phage attachment site (attP) and streptomyces attachment site (attB), and belongs to site-specific recombination. As is well known in the art, "site-specific recombination" is a type of homologous recombination that relies on the association of a small range of homologous sequences, requiring the eventual integration of a foreign plasmid or foreign gene into the genome of a host cell by the participation of an integrase (e.g., Φ C31) with a specific recombination site (e.g., attB/attP).

The invention directly utilizes a plurality of discrete attB sites naturally existing in the actinomycete genome, thereby needing no exogenous introduction of artificial attB sites, greatly saving the molecular breeding time and being particularly suitable for industrial actinomycete with difficult genetic manipulation.

The inventor utilizes 5 sets of orthogonal site-specific integration systems reported in earlier documents to construct a plug-and-play type multi-copy integration kit suitable for actinomycetes natural product synthetic gene clusters. Cloning an integration system containing 1, 2, 3 or 4 sets of orthogonal integration systems into a series of vectors, and adding universal assembly joints and restriction enzyme cutting sites capable of directly cutting enzymes to obtain the integration systems on two sides of the integration systems. Subsequently, a yeast coupling recombination cloning target gene cluster is adopted, a Cas9 endonuclease is adopted to remove an integration resistance element (such as a phi C31 integration system-apramycin resistance gene) in a cloning vector, and then other sets of integration systems are added into the vector, so that the vector capable of realizing multi-copy amplification of the target gene cluster in one step is obtained. If multiple rounds of amplification are desired, the above procedure can be repeated, except that the integrated resistance element can be removed by a predetermined restriction site without further cleavage with Cas 9.

In this context, for the sake of simplicity of description, integrase, integration site and the name of the gene (DNA) encoding it are sometimes used in combination, and it will be understood by those skilled in the art that they represent different substances in different description situations. For example, the integrase Φ C31 refers to a DNA fragment of the Φ C31 gene that binds to attP sites, but refers to proteins when used to describe the function or class of the integrase Φ C31.

For the DNA fragment in which the phage-derived integrase Φ C31, Φ BT1, R4, SV1 or TG1 gene as an integrated gene binds to attP site, that is, Φ C31Att/Int (abbreviated as C), Φ BT1Att/Int (abbreviated as B), R4Att/Int (abbreviated as R), SV1Att/Int (abbreviated as S), TG1Att/Int (abbreviated as T), abbreviated herein as Φ C31, Φ BT1, R4, SV1, TG1 or C, B, R, S, T, sometimes abbreviated directly. Their meaning will be readily understood by those skilled in the art based on the context and context.

In this context, the term "(integration) means" or "(integration) element" refers to a gene fragment or a plasmid containing a gene fragment in order to embody its plug-and-play property in the integration operation of a target gene cluster. Accordingly, the "(integration) system" is essentially in the form of a plasmid.

The terms "integrational elements", "integrational genes" and "site-specific recombination systems" are used herein in the same sense and may be used interchangeably. Similarly, the terms "resistance element" and "resistance gene" are used synonymously and refer to the aprana resistance gene acc (3) IV, the kanamycin resistance gene aphII, the thiostrepton resistance gene tsr, which are used interchangeably.

As used herein, the terms "natural product synthetic gene cluster", "target gene cluster", "foreign gene cluster" and "gene cluster" are used synonymously.

In order for an integration system (or integration kit) to form a plug-and-play type of tool, it is necessary to construct the plasmid for transformation into host actinomycetes as a modular plasmid. More than two types of integrated genes are contained on the modular plasmids for matching, and different integrated genes are contained on different modular plasmids. In FIG. 3B, different sets of 5 integrated genes, i.e., Φ C31, Φ BT1, R4, SV1 and TG1, are shown, and are referred to as multiple sets of integrated systems. For example, the kit is divided into two series according to the difference of the resistance marker, and each series can contain 11 groups of plasmids. Among the plasmids of the aprana resistance marker acc (3) IV, 2 plasmids contain 1 set of integration system (Φ C31 or Φ BT1 integration element), 3 plasmids simultaneously contain 2 sets of integration system (Φ C31/Φ BT1, Φ C31/TG1 or Φ BT1/TG1 integration element), 3 plasmids simultaneously contain 3 sets of integration system (Φ C31/Φ BT1/R4, Φ C31/Φ BT1/SV1 or Φ C31/BT 1/TG1 integration element), and 3 plasmids simultaneously contain 4 sets of integration system (Φ C31/BT 1/R4/SV1, Φ C31/Φ BT1/R4/TG1 or Φ C31/Φ BT1/SV1/TG1 integration element). Similarly, among the plasmids of the kanamycin resistance marker aphII, 2 plasmids contained 1 set of integration system (Φ BT1 or SV1 integration element), 3 plasmids contained 2 sets of integration system at the same time (Φ BT1/R4, Φ BT1/SV1 or SV1/R4 integration element), 3 plasmids contained 3 sets of integration system at the same time (SV1/R4/Φ BT1, SV1/R4/Φ C31 or SV1/R4/TG1 integration element), and 3 plasmids contained 4 sets of integration system at the same time (SV 1/R4/BT 1/C31, SV1/R4/Φ BT1/TG1 or SV1/R4/Φ C31/TG1 integration element).

The number of modular plasmids was the same as the number of rounds of iterative integration, and when two rounds of iterative integration were performed, there were two modular plasmids, and the two series of plasmids contained different resistance elements selected from the actinomycete resistance selection markers (aprana resistance gene acc (3) IV, kanamycin resistance gene aphII, thiostrepton resistance gene tsr).

As for the construction method of the modular plasmid, referring to fig. 4, in the first round of the in vitro gene cluster editing method CGE, referring to the modular plasmid SR on the right side of fig. 2 and 3B, for the plasmid containing 1 target gene cluster, Φ C31 integration element, acc (3) IV resistance element, upstream linker and downstream linker, the gene editing technology CRISPR/Cas9 is used to perform in vitro enzyme digestion to remove Φ C31 and acc (3) IV, resulting in a non-resistant plasmid; for a modular plasmid containing 2 sets of integration system SV1/R4 integration elements, aphII resistance gene, upstream and downstream adapters, SpeI and SwaI cleavage sites, a DNA fragment containing SV1 and R4, aphII, upstream and downstream adapters was cleaved with a restriction enzyme such as SpeI; and assembling the DNA fragment and the non-resistance plasmid together by utilizing a Gibson isothermal one-step method to obtain a new assembled plasmid containing a target gene cluster, wherein the new assembled plasmid contains 1 target gene cluster, an SV1/R4 integration element, an aphII resistance gene, an upstream joint, a downstream joint and another restriction enzyme SwaI restriction site. 2 exogenous target gene clusters are integrated and inserted into an actinomycete genome through a one-way recombination reaction between each attP site of an SV1/R4 integration element in the new assembly plasmid and an attB site on an actinomycete chromosome.

In the second round, and the third, fourth, etc. rounds of integration that can be extended further, CRISPR/Cas9 is no longer performed to remove the original integration-resistance system, but instead an enzymatic cleavage method. Continuing to construct a new integration plasmid on the basis of the new assembly plasmid obtained in the first round, referring to the modular plasmid CB on the left side of the figures 2 and 3B, performing enzyme digestion on the new assembly plasmid obtained in the first round by using a restriction enzyme SwaI corresponding to the other SwaI enzyme digestion site reserved on the new assembly plasmid, and removing an SV1/R4 integration element and an aphII resistance gene to obtain a non-resistance plasmid; for the modular plasmid containing 2 sets of integration systems of phi C31/phi BT1, acc (3) IV resistance genes, an upstream adaptor and a downstream adaptor, SpeI and SwaI enzyme cutting sites, carrying out enzyme cutting by using a restriction enzyme such as SpeI to obtain a DNA fragment containing phi C31/phi BT1, acc (3) IV, an upstream adaptor and a downstream adaptor; similarly, the DNA fragment and the non-resistant plasmid were assembled together by Gibson's isothermal method to obtain a second new assembled plasmid containing the target gene cluster, which contained 1 target gene cluster, Φ C31/Φ BT1 integration element, acc (3) IV resistance gene, upstream and downstream adapters, and another restriction enzyme SwaI cleavage site. Through the one-way recombination reaction between each attP site of the phi C31/phi BT1 integration system in the second new assembly plasmid and attB site on actinomycete chromosome, 2 exogenous target gene clusters are further integrated and inserted into actinomycete genome.

With the increase of the copy number of the target gene cluster needing to be integrated, the integration of subsequent rounds can be carried out; integration of a multicopy gene cluster can also be achieved by increasing the number of sets of integration systems in a modular plasmid, such as by using a combination of 3 or 4 sets of integration systems (multiple sets as listed in columns 3 and 4 in FIG. 3B).

After the gene cluster multi-copy integration tool box is constructed and verified, streptomyces hygroscopicus SIPI-KF is used as a chassis strain, one, two or three 5-keto milbemycins are added to synthesize the gene cluster, the 5-keto milbemycins of the obtained engineering strains KF201, KF202 and KF203 reach 4415 mg/L, 5592 mg/L and 6368mg/L respectively, and the highest yield is improved by 1.86 times relative to the starting strain. The established gene cluster multi-copy integration method based on a series of orthogonal site-specific recombination systems can effectively realize the insertion of at most 5 copies of a target gene cluster in one step or two steps of an original or heterologous host streptomyces hygroscopicus, and finally remarkably improves the yield of a target product 5-ketomilbemycin.

Examples

Materials and methods

The whole gene synthesis herein was performed by Shanghai Czeri Bio Inc., the primer synthesis was performed by Shanghai Jie Li Bio Inc., and the sequencing was performed by Shanghai platofrm Bio Inc.

The molecular biological experiments herein include plasmid construction, digestion, ligation, competent cell preparation, transformation, culture medium preparation, and the like, and are mainly performed with reference to molecular cloning, a guide to experiments (third edition), edited by j. sambrook, d.w. russell, huang peitang et al, scientific press, beijing, 2002). The specific experimental conditions can be determined by simple experiments if necessary.

PCR amplification experiments were performed according to the reaction conditions or instructions provided by the supplier of the plasmid or DNA template. If necessary, it can be adjusted by simple experiments.

Enzyme cutting conditions of CRISPR-Cas 9:

note: sgRNA transcription and recovery in vitro is described in Li et al, Metabolic Engineering,2017.

Gibson one-step isothermal process:

1) mu.l of an equimolar amount of the DNA fragment was added to a 15. mu.l Gibson reaction system (Gibson et al, Nature Methods,2009) and reacted at 50 ℃ for one hour;

2) electrically transforming 1 μ l of E.coli EPI300 to 30 μ l, adding 1mL LB to resuscitate for 2h, plating on corresponding LB solid plate, and culturing at 37 deg.C for 16-24 h;

3) inoculating single strain into liquid LB containing corresponding resistance, culturing until OD600 is 0.4-0.6, adding 1/1000 pCC1BAC (bacterial artificial chromosome) amplification inducer (Epicentre), and continuously culturing for 12 h;

4) centrifugally collecting the thalli by

BAC/PAC DNA Kit recovered plasmids containing large gene clusters.

Strains, plasmids and reagents:

the invention relates to a method for constructing Streptomyces hygroscopicus SIPI-KF (Li et al, Applied and Environmental Micorbiology,2018) in the early stage of a laboratory, and the sources of escherichia coli DH5 α, S17-1 and EPI300 are shown in the following table 1.

TABLE 1 sources of E.coli and Streptomyces

The DNA gel recovery purification and plasmid extraction kit used in the examples was purchased from Axygen,

BAC/PAC DNA Kit was purchased from Omega Bio-Tek. Cas9 was purchased from tsingtaury biotechnology limited, tokyo. The sgRNA transcription Kit MEGAscript Kit and the recovery Kit MEGAclear Kit were constructed from Ambion, and KOD plus new DNA polymerase was purchased from TOYOBO. Other conventional reagents are all made in domestic analytically pure or imported for subpackage.

Culture medium:

1. liquid/solid LB medium (1L): 10g of peptone, 5g of yeast extract, 10g of NaCl and 0/20g of agar powder; natural pH value, sterilizing at 121 deg.C for 20 min.

2. Liquid/solid YPD medium (1L): 20g of glucose, 20g of peptone, 10g of yeast powder, 0.8g of adenine sulfate and 0/20g of agar powder; natural pH value, sterilizing at 115 deg.C for 15 min.

3. Yeast selection Medium SORB-TOP-Trp (1L): 1.7g of yeast nitrogen base without amino acid, 182g of sorbitol, 1.9g of yeast synthetic culture medium, 2g of glucose, 5g of ammonium sulfate and 30g of agar powder; natural pH value, sterilizing at 115 deg.C for 15 min.

4. Yeast selection Medium SORB-Trp (1L): 1.7g of yeast nitrogen base without amino acid, 182g of sorbitol, 1.9g of yeast synthetic culture medium, 2g of glucose, 5g of ammonium sulfate and 30g of agar powder; natural pH value, sterilizing at 115 deg.C for 15 min.

5. Solid MB medium formulation (1L): 4g of sucrose, 1g of skim milk powder, 2g of yeast extract powder and 20g of agar powder, adjusting the pH value to 7.2, and sterilizing at 121 ℃ for 20 minutes.

6. Seed medium (1L): 20g of cane sugar, 5g of yeast extract powder, 1g of skim milk powder and K₂HPO₄1g, adjusting pH to 7.2, and sterilizing at 121 ℃ for 20 minutes.

7. Fermentation medium (1L): 120g of cane sugar, 10g of cottonseed cake powder, 10g of skim milk powder and K₂HPO₄1g， FeSO₄·7H₂O 0.1g，CaCO₃3g, adjusting pH to 7.2, and sterilizing at 121 ℃ for 20 minutes.

Product 5-ketomilbemycin assay:

sucking 500 μ l of culture solution, adding 3 times volume of ethanol, shaking, standing at room temperature for 1-2h, performing ultrasonic treatment for 20min, centrifuging at 12000rpm for 5min, collecting supernatant, and detecting by HPLC (high performance liquid chromatography) according to column model: agilent Hypersil, filler: c185 μm, size: 4.6mm × 150mm, wavelength 240nm, flow rate 1ml/min, mobile phase: water 73:27 acetonitrile.

Example 1 construction of Gene Cluster Multi-copy integration kit

To achieve multi-copy integration of gene clusters based on the concept of "multiple integrases-multiple attB sites", we needed to construct a series of plasmids containing different numbers of integration systems, i.e., a multi-copy integration kit. The specific construction process of the multicopy plasmid is as follows:

the R4, SV1 and TG1 integration systems (including integrase gene and attP site) used were chemically synthesized by Shanghai Czeri Bio Inc. These three genes were then double digested with BamHI and SphI and ligated into BamHI and SphI digested pSET152 to give plasmids pLR4, pLSV1-T and pLTG1, respectively. The strong promoter ermEp was obtained by PCR amplification using the primer ermEp-fw/rev with plasmid pIB139 as template. The DNA fragment thus generated was digested with BglII and NdeI, and ligated into BamHI-and NdeI-digested pLSV1-T to give plasmid pLSV 1. The superstrong promoter kasOp was obtained by PCR amplification using the primer kasOp-fw/rev with plasmid pAH91 kasOp-cmlR as template. The DNA fragment thus generated was digested with BamHI and EcoRV and ligated with pSET152 or pRT802 digested with BamHI and EcoRV to give pSET152-K or pRT802-K, respectively. PCR was carried out using the primers SV 1-kasOp-fw/rev and RT802-fw/rev using plasmids pLSV1 and pRT802-K as templates, respectively, to obtain two DNA fragments SV1-kasOp and RT 802. Then, the two DNA fragments were ligated by digestion with SpeI and XhoI to obtain plasmid pLSV 1-K.

Four pairs of primers, namely acc (3) IV-overlap-fp/phi C31-overlap-rev, acc (3) IV-overlap-fp/phi BT1-overlap-rev, aphII-overlap-fw/phi BT1-overlap-rv and aphII-overlap-fw/SV1-overlap-rv, are respectively used as templates for carrying out PCR amplification by using plasmids pSET152, pRT801, pRT802 and pLSV1 to obtain four DNA fragments, namely phi C31-acc (3) IV, phi BT1-acc (3) IV, phi BT1-aphII and SV 1-aphII. A DNA fragment pUCoori-acc (3) IV was obtained by PCR amplification using the plasmid pSET152-K as a template and the primers pUCoori-acc (3) IV-fw/rev. Similarly, a DNA fragment pUCori-aphII was obtained by PCR amplification using the primer pUCori-aphII-fw/rv with the plasmid pRT802-K as a template. Then, the DNA fragments Φ C31-acc (3) IV and Φ BT1-acc (3) IV were digested with SpeI and ligated to pUCori-acc (3) IV digested with SpeI, respectively, to give plasmids pLC1 and pLB 1. Similarly, the DNA fragments Φ BT1-aphII and SV1-aphII were digested with SpeI and ligated into SpeI-digested pUCori-aphII to give plasmids pLB2 and pLS2, respectively. Notably, two universal assembly overlaps (Φ C31-overlap and acc (3) IV-overlap) were introduced into plasmids pLC1, pLB1, pLB2 and pLS2, respectively.

Using plasmid pRT801 and pLTG1 as templates, primers phi BT1-fw (PmeI)/phi BT1-rv (NsiI) and TG1-fw (PmeI)/TG1-rv (NsiI) were used for PCR amplification to obtain phi BT1 and TG1 integration systems, respectively. These two DNA fragments were digested with PmeI and NsiI and ligated into PmeI/NsiI digested pLC1 or pLB1, respectively, resulting in plasmids pLCB1, pLCT1 and pLBT1, respectively. PCR was performed using plasmid pLR4 and pLSV1 as templates and primers R4-fw (PmeI)/Φ BT1-rev (NsiI) and SV1-fw (PmeI)/TG1-rev (NsiI) to obtain R4 and SV1 integration systems, respectively. These two DNA fragments were cut with PmeI and NsiI, respectively, and ligated to PmeI/NsiI-digested pLB2 or pLS2, respectively, to obtain plasmids pLBR2, pLBS2 and pLSR 2.

The integrated system of R4, SV1 and TG1 was obtained by PCR amplification using plasmid pLR4, pLSV1 and pLTG1 as templates and three pairs of primers R4-fw (NsiI)/R4-rev (NotI), SV1-fw (NsiI)/SV1-rv (NotI) and TG1-fw (NsiI)/TG1-rev (NotI), respectively. These three DNA fragments were digested with NsiI and NotI, respectively, and ligated to NsiI/NotI-digested pLCB1, respectively, to generate plasmids pLCBR1, pLCBS1 and pLCBT 1. Using plasmids pRT801, pSET152 and pLTG1 as templates, primers Φ BT1-fw (NsiI)/Φ BT1-rev (NotI), Φ C31-fw (NsiI)/Φ C31-rev (NotI) and TG1-fw (NsiI)/TG1-rev (NotI) were used for PCR amplification to obtain Φ BT1, Φ C31 and G1 integration systems. These three DNA fragments were cut with NsiI and NotI, respectively, and ligated into NsiI/NotI-cut pLSR2, respectively, to generate plasmids pLSRB2, pLSRC2 and pLSRT 2.

The plasmids pLSV1 and pLTG1 were used as templates, and PCR amplification was carried out using primers SV1-fw (NotI)/SV1-rv (MfeI) and TG1-fw (NotI)/TG1-rev (MfeI), respectively, to obtain an SV1 and TG1 integration system. These two DNA fragments were digested with NotI and MfeI and ligated into NotI/MfeI digested pLCBR1 or pLCBS1 to give plasmids pLCBRS1, pLCBRT1 and pLCBST1, respectively. The plasmids pSET152 and pLTG1 were used as templates, and primers Φ C31-fw (NotI)/Φ C31-rev (MfeI) and TG1-fw (NotI)/TG1-rev (MfeI) were used to perform PCR amplification, respectively, to obtain the Φ C31 and TG1 integration system. These two DNA fragments were digested with NotI and MfeI and ligated into NotI/MfeI digested pLSRB2 or pLSRC2 to give plasmids pLSRBC2, pLSRBT2 and pLSRCT2, respectively. All primers used are shown in Table 2 and the plasmids used are shown in Table 3.

TABLE 2 primers required for the construction of the multicopy integration System

Note: italic capitalized bases represent enzyme cleaved bases, and underlined capitalized bases represent a 20-bp sequence recognized by Cas 9.

TABLE 3 plasmids required for the construction of the multicopy integration System

Example 2 addition of different combinatorial integration systems to a vector plasmid containing a cluster of genes of interest

By using the CGE gene cluster editing method (Li et al, metabolic engineering,2017) developed earlier in this laboratory, Cas9 endonuclease was used to remove the original integrated resistance element, and the integrated systems from different combinations in the toolbox were obtained directly by SpeI digestion. The different integration system-resistance elements were then added to the vector containing the gene cluster of interest using the Gibson assembly method (figure 4). Since we have designed smart cleavage sites (like SwaI) when constructing the multicopy integration kit, the integration resistance element can be cut away with restriction enzymes without using Cas9 when adding integrase in the second round (fig. 4). Specifically, in the first round of editing, a CRISPR-Cas9 system is directly used for in vitro enzyme digestion to remove a phi C31 integration element and an acc (3) IV resistance gene, SpeI is used for enzyme digestion of pLSR2 to obtain a new SV1/R4 integration element and an aphII resistance gene, and then the new SV1/R4 integration element and the aphII resistance gene are assembled into a plasmid containing a target gene cluster by utilizing a Gibson isothermal one-step method. In the second round of editing, SwaI is directly used for enzyme digestion to remove the newly added SV1/R4 integration element and aphII resistance gene in the first round, SpeI is used for enzyme digestion of pLCB1 to obtain a new phi C31/phi BT1 integration element and acc (3) IV resistance gene, and then Gibson isothermal one-step method is used for assembling the new phi C31/phi BT1 integration element and acc (3) IV resistance gene into a plasmid containing a target gene cluster.

EXAMPLE 35 cloning and editing of the ketomilbemycin Synthesis Gene Cluster

In order to amplify the 5-ketomilbemycin synthesis gene cluster by using the newly invented gene cluster multicopy integration kit to increase the yield, we first need to clone the target gene cluster by using yeast transformation coupled recombination cloning method (TAR).

Firstly, a universal vector pCL01 (containing a phi C31 integration system, an aprana resistance gene and a yeast replication screening element) capable of cloning a large-scale natural product synthetic gene cluster is constructed, and the specific method is that a yeast screening replication element (ARSH4/CEN6-TRP1) from pCAP01 obtained by adopting primer yeast-fw/rev PCR amplification is recombined and connected into BAC-F15 to obtain pCL01, and two cloning sites (EcoRI and PmeI) are reserved in pCL01 for inserting homology arms at two ends of a target gene cluster required to be captured.

Secondly, cloning a section of gene mil A1 of a discrete 5-keto milbemycin synthetic gene cluster to pCL01 by using TAR to obtain pCL01-mil A1, and then cloning another section of gene cluster mil A2-R to pCL01-mil A1 to obtain pCL 01-mil.

Finally, BAC-mill-S, BAC-mill-C and BAC-mill-CB were obtained by using the different integration resistance element replacement methods in FIG. 4. Specifically, pCB003 is used as a template, gRNA-yeast-fw/gRNA-rev and gRNA-phi C31-fw/gRNA-rev are used as primer pairs, in-vitro transcription templates of two sgRNAs (yeast-sgRNA and phi C31-sgRNA) are obtained through amplification, and then in-vitro transcription is carried out to obtain the corresponding sgRNAs. Subsequently, the combination of Cas9, yeast-sgRNA and Φ C31-sgRNA was digested in vitro to remove the yeast elements, Φ C31 integration system and aprana resistance gene from pCL 01-milbe. PCR amplification was performed using pLS2 as a template and the primers S-aphII-fw/rev to obtain the SV1 integration element and kanamycin resistance gene, which was ligated into pCL 01-mile to obtain BAC-mile-S. Subsequently, the SV1 integration element and the kanamycin resistance gene in BAC-mill-S are removed by NsiI, the SpeI enzyme digestion is carried out to obtain a phi C31 integration element and the apramycin resistance gene and a phi C31-phi BT1 integration element and the apramycin resistance gene from pLC1 and pLCB1 respectively, and the phi C31-phi BT1 integration elements and the apramycin resistance gene are connected to the BAC-mill-S, and finally BAC-mill-C and BAC-mill-CB are obtained. The map structures of the above four plasmids, including pCL 01-mibe, BAC-mibe-S, BAC-mibe-C and BAC-mibe-CB, are shown in FIG. 5, and verified by XhoI digestion (FIG. 6). The primers used in this experiment are shown in Table 4 below, and the plasmid information used is shown in Table 5 below.

TABLE 4 primers required for cloning and editing the 5-ketomilbemycin Synthesis Gene Cluster

Note: italic capitalized bases represent enzyme cleaved bases, and underlined capitalized bases represent a 20-bp sequence recognized by Cas 9.

TABLE 5 cloning and editing of 5-ketomilbemycin Synthesis Gene Cluster

Example 4 construction and fermentation of engineering bacteria containing 1-3 copies of 5-ketomilbemycin Synthesis Gene Cluster

4.1 construction of engineering bacteria containing 5-ketomilbemycin Synthesis Gene clusters with different copy numbers

After obtaining plasmids containing different integration systems, BAC-F15(Li et al, Metabolic engineering,2017), BAC-milbe-C and BAC-milbe-CB were introduced into Streptomyces hygroscopicus SIPI-KF to obtain engineering bacteria KF200, KF201 and KF202, wherein KF200 is a control strain. Subsequently, the plasmid BAC-milbe-S was introduced into KF202 to obtain the engineered bacterium KF 203.

4.2 Strain culture and comparison of 5-Ketimibomycin production

Respectively streaking the streptomyces hygroscopicus SIPI-KF and derived engineering bacteria on an MB flat plate, standing and culturing for 6-7 days at 30 ℃, respectively selecting equal-volume bacterium blocks to be inoculated into a seed culture medium, culturing for 40-44h at 28 ℃ and 240rpm, transferring 8% of bacterium liquid into a fermentation culture medium for continuous culture, and respectively sampling for HPLC determination at 4, 6, 10, 14 and 16 days. The time series fermentation results show that the yield of the 5-ketomilbemycin is gradually improved along with the increase of the copy number, the highest yield of the KF200, the KF201, the KF202 and the KF203 are 2228, 4415, 5592 and 6368mg/L respectively, and the yield is finally improved by 186 percent relative to the starting strain KF200 (figure 7).

The above examples demonstrate the multi-copy integration method of the gene cluster of "multiple integrases-multiple attB sites" of the present invention, and it will be understood by those skilled in the art that various changes or modifications can be made on the basis of the above examples without departing from the spirit of the present invention, and the equivalent forms of the changes or modifications should also fall within the scope of the present invention.

It should also be noted that the listing or discussion of a prior-published document in this specification should not be taken as an admission that the document is prior art or common general knowledge.

Reference to the literature

Bierman M,Logan R,O’Brien K,Seno ET,Rao RN,Schoner BE.Plasmid cloningvectors for the conjugal transfer of DNA from Escherichia coli toStreptomyces spp.Gene 116,43-49 (1992).

Gibson,D.G.,Young,L.,Chuang,R.Y.,Venter,J.C.,Hutchison,C.A.,Smith,H.O., 2009.Enzymatic assembly of DNA molecules up to several hundredkilobases.Nat.Methods.6, 343-U41.

Gregory MA,Till R,Smith MCM.Integration site for streptomyces phagephi BT1and development of site-specific integrating vectors.J Bacteriol 185,5320-5323(2003).

Huang,H.,Zheng,G.S.,Jiang,W.H.,Hu,H.F.,Lu,Y.H.,2015.One-step high-efficiency CRISPR/Cas9-mediated genome editing in Streptomyces.Acta.Bioch.Bioph.Sin.47,231-243.

Kieser T,Bibb MJ,Butter MJ,Chater KF,Hopwood DA.PracticalStreptomyces genetics. The John Innes Foundation,Norwich,United Kingdom(2000).

Li,L.,Wei,K.,Zheng,G.,Liu,X.,Chen,S.,Jiang,W.,Lu,Y.,2018.CRISPR-Cpf1assisted multiplex genome editing and transcriptional repression inStreptomyces.Appl.Environ. Microbiol.84,e00827-18.

Li,L.,Zhao,Y.,Ruan,L.,Yang,S.,Ge,M.,Jiang,W.,Lu,Y.,2015.A stepwiseincrease in pristinamycin II biosynthesis by Streptomyces pristinaespiralisthrough combinatorial metabolic engineering.Metab.Eng.29,12-25.

Li,L.,Zheng,G.S.,Chen,J.,Ge,M.,Jiang,W.H.,Lu,Y.H.,2017b.Multiplexedsite-specific genome engineering for overproducing bioactive secondarymetabolites in actinomycetes.Metab.Eng.40,80-92.

Sequence listing

<110> Shanghai Life science research institute of Chinese academy of sciences

Shanghai institute of pharmaceutical industry

<120> multi-copy integration method of actinomycete natural product synthetic gene cluster

<130>SHPI1811188

<160>61

<170>SIPOSequenceListing 1.0

<210>1

<211>28

<212>DNA

<213> Artificial sequence ()

<400>1

ggcatgcttg caccgtcctc gctggagt 28

<210>2

<211>30

<212>DNA

<213> Artificial sequence ()

<400>2

cgggatcctc cccgtgtggg cgcaggtcaa 30

<210>3

<211>29

<212>DNA

<213> Artificial sequence ()

<400>3

ggcatgctcc gcgaacggct catcaggta 29

<210>4

<211>26

<212>DNA

<213> Artificial sequence ()

<400>4

cgggatcctg acgtgacgct aggaac 26

<210>5

<211>28

<212>DNA

<213> Artificial sequence ()

<400>5

cgggatccgc aaccgagcgt tctgaaca 28

<210>6

<211>31

<212>DNA

<213> Artificial sequence ()

<400>6

ggcatgcaga cgcggtgggc cgcacatgga a 31

<210>7

<211>29

<212>DNA

<213> Artificial sequence ()

<400>7

gaagatctca tgcgagtgtc cgttcgagt 29

<210>8

<211>27

<212>DNA

<213> Artificial sequence ()

<400>8

ggaattccat atgtggatcc taccaac 27

<210>9

<211>70

<212>DNA

<213> Artificial sequence ()

<400>9

gactgacact gataatacga ctcactatag gcactgttgc aaatagtcgg gttttagagc 60

tagaaatagc 70

<210>10

<211>70

<212>DNA

<213> Artificial sequence ()

<400>10

gactgacact gataatacga ctcactatag ggcttcggcg gcttcaagtt gttttagagc 60

tagaaatagc 70

<210>11

<211>29

<212>DNA

<213> Artificial sequence ()

<400>11

ggaattcaga tctcaaaaaa agcaccgac 29

<210>12

<211>42

<212>DNA

<213> Artificial sequence ()

<400>12

cgggatcctt aattaaggca tatggacact ccttacttag ac 42

<210>13

<211>28

<212>DNA

<213> Artificial sequence ()

<400>13

cggatatctg ttcacattcg aaccgtct 28

<210>14

<211>31

<212>DNA

<213> Artificial sequence ()

<400>14

gactagtaga cgcggtgggc cgcacatgga a 31

<210>15

<211>34

<212>DNA

<213> Artificial sequence ()

<400>15

ccgctcgaga tctcatgcga gtgtccgttc gagt 34

<210>16

<211>25

<212>DNA

<213> Artificial sequence ()

<400>16

gactagtagt tccttcgtca ccata 25

<210>17

<211>38

<212>DNA

<213> Artificial sequence ()

<400>17

ccgctcgagt gcaggtcgac ggatcttttc cgctgcat 38

<210>18

<211>26

<212>DNA

<213> Artificial sequence ()

<400>18

gactagtagt tccttcgtca ccatag 26

<210>19

<211>30

<212>DNA

<213> Artificial sequence ()

<400>19

gactagtaag cgacgcccaa cctgccatca 30

<210>20

<211>30

<212>DNA

<213> Artificial sequence ()

<400>20

gactagtgaa tctcgtgctt tcagcttcga 30

<210>21

<211>32

<212>DNA

<213> Artificial sequence ()

<400>21

gactagtaga tcaaaggatc ttcttgagat cc 32

<210>22

<211>75

<212>DNA

<213> Artificial sequence ()

<400>22

gactagtagc tccatcagca aaaggggatg ataagtttat caccaattta aattgggcgt 60

cgcttggtcg gtcat 75

<210>23

<211>74

<212>DNA

<213> Artificial sequence ()

<400>23

gactagtagc tccatcagca aaaggggatg ataagtttat caccaattta aatctacggg 60

gtctgacgct cagt 74

<210>24

<211>109

<212>DNA

<213> Artificial sequence ()

<400>24

gactagtatt ggtcaagggg aagcttcggg gcttcggcgg cttcaattta aatcaattgc 60

ggcggccgca tatgcatgcg tttaaactag cctaactaac gatttcaag 109

<210>25

<211>109

<212>DNA

<213> Artificial sequence ()

<400>25

gactagtatt ggtcaagggg aagcttcggg gcttcggcgg cttcaattta aatcaattgc 60

ggcggccgca tatgcatgcg tttaaacacg cggtgggccg cacatggaa 109

<210>26

<211>110

<212>DNA

<213> Artificial sequence ()

<400>26

gactagtatt ggtcaagggg aagcttcggg gcttcggcgg cttcaattta aatcaattgc 60

ggcggccgca tatgcatgcg tttaaacttc gccctgcgag agctgcatca 110

<210>27

<211>37

<212>DNA

<213> Artificial sequence ()

<400>27

agctttgttt aaactccgcg aacggctcat caggtac 37

<210>28

<211>34

<212>DNA

<213> Artificial sequence ()

<400>28

tgcatgcatt gacgtgacgc taggaacagt tgct 34

<210>29

<211>40

<212>DNA

<213> Artificial sequence ()

<400>29

agctttgttt aaactggcgc cggacggggcttcagacgtt 40

<210>30

<211>36

<212>DNA

<213> Artificial sequence ()

<400>30

tgcatgcatt agcctaacta acgatttcaa ggccaa 36

<210>31

<211>38

<212>DNA

<213> Artificial sequence ()

<400>31

agctttgttt aaacagacgc ggtgggccgc acatggaa 38

<210>32

<211>34

<212>DNA

<213> Artificial sequence ()

<400>32

tgcatgcata tctcatgcga gtgtccgttc gagt 34

<210>33

<211>41

<212>DNA

<213> Artificial sequence ()

<400>33

agctttgttt aaacttgcac cgtcctcgct ggagtcgctg a 41

<210>34

<211>34

<212>DNA

<213> Artificial sequence ()

<400>34

tgcatgcatt ccccgtgtgg gcgcaggtca agct 34

<210>35

<211>36

<212>DNA

<213> Artificial sequence ()

<400>35

tgcatgcatt tgcaccgtcc tcgctggagt cgctga 36

<210>36

<211>41

<212>DNA

<213> Artificial sequence ()

<400>36

ataagaatgc ggccgctccc cgtgtgggcg caggtcaagc t 41

<210>37

<211>33

<212>DNA

<213> Artificial sequence ()

<400>37

tgcatgcata gacgcggtgg gccgcacatg gaa 33

<210>38

<211>41

<212>DNA

<213> Artificial sequence ()

<400>38

ataagaatgc ggccgcatct catgcgagtg tccgttcgag t 41

<210>39

<211>35

<212>DNA

<213> Artificial sequence ()

<400>39

tgcatgcatt ggcgccggac ggggcttcag acgtt 35

<210>40

<211>43

<212>DNA

<213> Artificial sequence ()

<400>40

ataagaatgc ggccgctagc ctaactaacg atttcaaggc caa 43

<210>41

<211>37

<212>DNA

<213> Artificial sequence ()

<400>41

tgcatgcata agctctagcg attccagacg tcccgaa 37

<210>42

<211>40

<212>DNA

<213> Artificial sequence ()

<400>42

ataagaatgc ggccgcttgt agaaaccatc ggcgcagcta 40

<210>43

<211>32

<212>DNA

<213> Artificial sequence ()

<400>43

tgcatgcatt ccgcgaacgg ctcatcaggt ac 32

<210>44

<211>41

<212>DNA

<213> Artificial sequence ()

<400>44

ataagaatgc ggccgctgac gtgacgctag gaacagttgc t 41

<210>45

<211>44

<212>DNA

<213> Artificial sequence ()

<400>45

ataagaatgc ggccgcaagc tctagcgatt ccagacgtcc cgaa 44

<210>46

<211>33

<212>DNA

<213> Artificial sequence ()

<400>46

ccgcaattgt tgtagaaacc atcggcgcag cta 33

<210>47

<211>40

<212>DNA

<213> Artificial sequence ()

<400>47

ataagaatgc ggccgcagac gcggtgggcc gcacatggaa 40

<210>48

<211>34

<212>DNA

<213> Artificial sequence ()

<400>48

ccgcaattga tctcatgcga gtgtccgttc gagt 34

<210>49

<211>39

<212>DNA

<213> Artificial sequence ()

<400>49

ataagaatgc ggccgctccg cgaacggctc atcaggtac 39

<210>50

<211>34

<212>DNA

<213> Artificial sequence ()

<400>50

ccgcaattgt gacgtgacgc taggaacagt tgct 34

<210>51

<211>42

<212>DNA

<213> Artificial sequence ()

<400>51

ataagaatgc ggccgctggc gccggacggg gcttcagacg tt 42

<210>52

<211>36

<212>DNA

<213> Artificial sequence ()

<400>52

ccgcaattgt agcctaacta acgatttcaa ggccaa 36

<210>53

<211>43

<212>DNA

<213> Artificial sequence ()

<400>53

ataagaatgc ggccgcttgc accgtcctcg ctggagtcgc tga 43

<210>54

<211>34

<212>DNA

<213> Artificial sequence ()

<400>54

ccgcaattgt ccccgtgtgg gcgcaggtca agct 34

<210>55

<211>59

<212>DNA

<213> Artificial sequence ()

<400>55

gaattgtaat acgactcact atagggcgaa ttcgtttaaa cgtgccacct gggtccttt 59

<210>56

<211>48

<212>DNA

<213> Artificial sequence ()

<400>56

aaaaaaaaaa gctagccggg taccgagctc ccatcgccct gatagacg 48

<210>57

<211>71

<212>DNA

<213> Artificial sequence ()

<400>57

gactgacact gataatacga ctcactatag gaataagcga ccgtgccacc tgttttagag 60

ctagaaatag c 71

<210>58

<211>70

<212>DNA

<213> Artificial sequence ()

<400>58

gactgacact gataatacga ctcactatag ggcttcggcg gcttcaagtt gttttagagc 60

tagaaatagc 70

<210>59

<211>29

<212>DNA

<213> Artificial sequence ()

<400>59

ggaattcaga tctcaaaaaa agcaccgac 29

<210>60

<211>100

<212>DNA

<213> Artificial sequence ()

<400>60

aacaaatact accttttatc ttgctcttcc tgctagctcc atcagcaaaa ggggatgata 60

agtttatcac catgcattgg gcgtcgcttg gtcggtcatt 100

<210>61

<211>66

<212>DNA

<213> Artificial sequence ()

<400>61

attggtcaag gggaagcttc ggggcttcgg cggcttcaat gcatacgcgg tgggccgcac 60

atggaa 66

Claims (10)

1. An integration system for integrating a multicopy gene cluster on an actinomycete genome, comprising a first plasmid comprising thereon: a multi-cloning site MCS for integrating a foreign gene cluster; a streptomyces promoter kasOp located upstream of MCS; more than two kinds of integration genes as integration sites, wherein the integration genes are selected from DNA fragments of phage-derived integrase phi C31, phi BT1, R4, SV1 or TG1 genes combined with attP sites; a first resistance gene adjacent to said integration gene selected from the group consisting of the aprana resistance gene acc (3) IV, the kana resistance gene aphII, the thiostrepton resistance gene tsr; an upstream linker and a downstream linker respectively located upstream and downstream of the integration gene and the first resistance gene; restriction sites for SpeI and SwaI, symmetrically located at both ends of the upstream and downstream adapters, respectively, leaving one restriction site for SpeI or SwaI after digestion with the other.

2. The integration system of claim 1, further comprising a second plasmid comprising thereon: a foreign gene cluster; one or more than two kinds of integration genes as integration sites, wherein the integration genes are selected from the DNA fragments of phi C31, phi BT1, R4, SV1 or TG1 genes combined with attP sites, and when more than two kinds of integration genes are contained, the integration genes are different from the integration genes on the first plasmid; a second resistance gene adjacent to the integrated gene, said resistance gene being selected from the group consisting of the aprana resistance gene acc (3) IV, the kanamycin resistance gene aphII, the thiostrepton resistance gene tsr, and being different from the first resistance gene; an upstream linker and a downstream linker respectively located upstream and downstream of the integrated gene and the second resistance gene.

3. The integration system of claim 1, wherein the first plasmid comprises two integrant genes selected from the group consisting of Φ C31/Φ BT1 or R4/SV1 pair.

4. The integration system of claim 2, wherein the second plasmid comprises an integrating gene thereon.

5. The integration system of claim 2, further comprising a CRISPR/Cas9 reaction system for gene editing of a second plasmid, and a Gibson assembly reaction system.

6. The integration system of claim 1, wherein the exogenous gene cluster is a 5-ketomilbemycin synthesis gene cluster.

7. The integration system of claim 5, wherein the second plasmid is subjected to gene editing using a CRISPR/Cas9 reaction system, and the integrated gene and the second resistant gene on the plasmid are removed using a Cas9 enzyme, so as to obtain a first round of non-resistant plasmid comprising the foreign gene cluster and the upstream and downstream linkers; digesting the first plasmid by adopting a restriction enzyme SpeI or SwaI to remove the integrated gene and the first resistance gene to obtain a first round DNA fragment containing the integrated gene, the first resistance gene, an upstream joint and a downstream joint; assembling the first round of non-resistant plasmids and the first round of DNA fragments together by adopting a Gibson reaction system to obtain a first round of modular plasmids;

performing enzyme digestion on the first round of modular plasmids, and performing enzyme digestion on the integrated genes and the first resistance genes by adopting another restriction enzyme SwaI or SpeI to obtain a second round of non-resistance plasmids containing the exogenous gene cluster, the upstream connectors and the downstream connectors; digesting another first plasmid, wherein the integrated gene and the resistance gene on the plasmid are different from those on the first plasmid in the first round, and digesting and removing the integrated gene and the resistance gene by using a restriction enzyme SpeI or SwaI to obtain a second round DNA fragment containing the integrated gene, the resistance gene, an upstream joint and a downstream joint; and (3) assembling the second round of non-resistant plasmids and the second round of DNA fragments together by adopting a Gibson reaction system to obtain a second round of modular plasmids.

8. A method for integrating a multi-copy foreign gene cluster on an actinomycete genome, comprising the steps of: the first round of modular plasmid constructed in claim 7 is used to transform actinomycete cells to integrate a foreign gene cluster into actinomycete genome under the mediation of phage-derived integrase.

9. The method of claim 8, further comprising the steps of: continuing to transform the actinomycete cells constructed in claim 8 with the second round of modular plasmids constructed in claim 7, thereby re-integrating the foreign gene cluster into the actinomycete genome under the mediation of the phage-derived integrase.

10. The method according to claim 8, wherein the actinomycete is Streptomyces hygroscopicus and the foreign gene cluster is a 5-ketomilbemycin synthesis gene cluster.

Images