CN110951758B - Recombinant vector pLD-TS for expressing taxadiene in chloroplast - Google Patents

Recombinant vector pLD-TS for expressing taxadiene in chloroplast Download PDF

Info

Publication number
CN110951758B
CN110951758B CN201911345952.6A CN201911345952A CN110951758B CN 110951758 B CN110951758 B CN 110951758B CN 201911345952 A CN201911345952 A CN 201911345952A CN 110951758 B CN110951758 B CN 110951758B
Authority
CN
China
Prior art keywords
taxadiene
tobacco
pld
chloroplast
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201911345952.6A
Other languages
Chinese (zh)
Other versions
CN110951758A (en
Inventor
张剑锋
郑庆霞
谢小东
徐国云
金静静
王中
武明珠
罗朝鹏
曹培健
杨军
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Zhengzhou Tobacco Research Institute of CNTC
Original Assignee
Zhengzhou Tobacco Research Institute of CNTC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Zhengzhou Tobacco Research Institute of CNTC filed Critical Zhengzhou Tobacco Research Institute of CNTC
Priority to CN201911345952.6A priority Critical patent/CN110951758B/en
Publication of CN110951758A publication Critical patent/CN110951758A/en
Application granted granted Critical
Publication of CN110951758B publication Critical patent/CN110951758B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/002—Preparation of hydrocarbons or halogenated hydrocarbons cyclic

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Nutrition Science (AREA)
  • Cell Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention belongs to the technical field of plant bioengineering, and particularly relates to a recombinant vector pLD-TS for expressing taxadiene in chloroplast. The preparation method of the carrier comprises the following steps: obtaining a taxadiene synthetase gene TS, constructing a vector, verifying transformation and the like. The vector is in tobacco chloroplast, and is on tobacco chloroplast genometrnIAndtrnAfor left and right homologous sequences, usingPrrnPromoter regulatory screening markeraadAGenes, simultaneous utilizationpsbAPromoter of gene and 5' UTR regulated and controlled taxadiene synthetase geneTSExpression of (2). The inventor reconstructs the synthesis path of the taxadiene by using tobacco as a heterologous host and by means of genetic engineering. Preliminary experiment results show that the application efficiently expresses and heterogeneously synthesizes taxadiene in tobacco chloroplasts, the content of the taxadiene in tobacco transformant leaves can reach 127.69 microgram/g at most, and the application prospect is better.

Description

Recombinant vector pLD-TS for expressing taxadiene in chloroplast
Technical Field
The invention belongs to the technical field of plant bioengineering, and particularly relates to a recombinant vector for expressing taxadiene in chloroplast.
Background
Paclitaxel (Paclitaxel, trademark Taxol) was obtained in the 70 th century by Wani et al in the 20 th centuryTaxus brevifoliaTetracyclic diterpenoid compounds with unique anticancer effect are extracted from Nutt bark. Since the acquisition of U.S. FDA approval in 1992, paclitaxel has become the first anticancer drug in hospital clinics due to its unique antitumor mechanism and significant tumor-inhibiting effect. At present, the traditional Chinese medicine composition is mainly used for clinically treating advanced breast cancer, advanced ovarian cancer, esophagus cancer, nasopharyngeal carcinoma, bladder cancer, lymph cancer, prostatic cancer, malignant melanoma, head and neck tumors, upper gastrointestinal tract cancer, small cell lung cancer and non-small cell lung cancer, and has certain curative effect on lung cancer, colorectal cancer and cerebroma.
To date, paclitaxel for clinical and scientific research has been obtained mainly by two methods: an extract of bark of plant belonging to genus Taxus of family Taxaceae is provided. However, yew grows slowly and the content of paclitaxel in the bark is very low (only about one ten-thousandth of the dry weight). Due to the large demand of paclitaxel, the production mode causes devastating damage to the endangered precious forest tree resource of the taxus chinensis. In addition, paclitaxel can be obtained by total synthesis, plant cell or tissue culture, fermentation of plant symbiotic fungi, and the like. The chemical total synthesis requires 25 to 27 steps of reaction due to the complicated process, and the yield of several steps of reaction is particularly low, thus making the method to prepare taxol expensive. The method for obtaining paclitaxel by plant cell or tissue culture is difficult to realize industrialization due to the factors of too low yield, complex and difficult-to-control culture process, difficult-to-maintain high yield and the like. The preparation process of the paclitaxel and the analogues thereof at present mainly comprises a chemical semi-synthesis method: paclitaxel is synthesized from paclitaxel intermediate compounds 10-deacetylbaccatin III and baccatin III, both of which are extracted from reproducible needles or cell cultures of Taxus chinensis.
The successful application of synthetic biology technology in the biosynthesis of natural compounds opens up a new way for the preparation of paclitaxel. Through synthetic biology, a biosynthesis pathway of a target product can be reconstructed in a heterologous host with clear genetic background and simple genetic operation, and the newly-established synthesis pathway and an original metabolic pathway of the host form a brand-new metabolic network so as to synthesize a specific target product. Research aiming at plant active metabolites is always a hotspot in the field of synthetic biology, wherein the advantages of plant chassis and the necessity of plant synthetic biology are more and more emphasized. In recent years, more researchers have begun to try to synthesize valuable complex metabolite intermediates or end products in the tobacco body through a recombinant metabolic pathway. Based on this, if paclitaxel or related precursors of paclitaxel can be prepared from tobacco, the production cost of paclitaxel is expected to be greatly reduced.
Disclosure of Invention
The invention aims to provide a recombinant vector pLD-TS capable of expressing taxadiene in chloroplast, and a method for producing taxadiene by utilizing chloroplast can be established based on the recombinant vector, so that a certain technical basis is laid for preparing taxol.
The technical solution adopted in the present application is detailed as follows.
A recombinant vector pLD-TS for expressing taxadiene in chloroplast is prepared by the following steps:
(1) Construction of chloroplast expression vector pLD-MCS
With reference to the prior art (Verma D et al. A protocol for expression of chloroplast genes in chloroplasts, nat protocol, 2008), a chloroplast expression vector pLD-MCS was designed and constructed;
the chloroplast expression vector pLD-MCS is on the tobacco chloroplast genometrnIAndtrnAfor left and right homologous sequences, usingPrrnPromoter regulatory screening markeraadAGene (spectinomycin resistance), utilizationpsbAA promoter of the gene and 5'UTR regulate the expression of a target gene (i.e., TS gene of the present application), transcription is terminated by a terminator of TpsbA, and a Multiple Cloning Site (MCS) is designed between the promoter PpsbA +5' UTR and the terminator TpsbA;
(2) Obtaining Taxadiene Synthetase (TS) gene
The total length of the base sequence of the taxadiene synthase gene (TS) is 2586bp, the genebank number AY364469 can be obtained by adopting a whole gene synthesis mode, or a specific biological genome (yew,Taxus canadensis) Obtaining a template by adopting a PCR amplification mode;
(3) pLD-TS recombinant expression vector construction
Carrying out double enzyme digestion on the tobacco chloroplast expression vector pLD-MCS in the step (1) by utilizing NdeI and XbaI, and then recovering to linearize the pLD-MCS vector;
constructing the TS gene fragment obtained In the step (2) on a linearized vector after double enzyme digestion by using an In-Fusion cloning method through a homologous recombination method;
after further transformation verification, the recombinant vector with correct recombinant ligation was named pLD-TS.
The preparation method of the taxadiene by using the recombinant vector pLD-TS comprises the following steps:
(1) Transformation of chloroplasts
Transforming the recombinant vector pLD-TS into a tobacco plant, wherein the tobacco variety is Honghuadajinyuan;
(2) Homogeneous screening
Carrying out homogenization screening on the transformant in the step (1) to obtain a homogenization plant of the chloroplast taxadiene synthetase gene;
the homogenization screening is specifically carried out by utilizing a tissue culture mode and an RMOP culture medium containing 500mg/L spectinomycin;
(3) Production of expression taxadiene
And (3) cultivating the homogenized plant screened in the step (2) to produce and express the taxadiene.
The new tobacco variety breeding method for preparing the taxadiene by using the recombinant vector pLD-TS is characterized in that the new tobacco variety which is efficiently expressed and produced with the taxadiene in chloroplast is obtained by screening the new tobacco variety by using a tissue culture technology after the recombinant vector pLD-TS is transformed into tobacco by using a gene recombination technology.
Taxadiene is a diterpene compound, is generated by enzymatic reactions such as polymerization, cyclization and the like of 4 molecules of prenyl pyrophosphate (IPP), and is also one of key precursors in a taxol biosynthesis pathway. Because the taxadiene synthetase has chloroplast membrane positioning signal peptide, the inventor uses tobacco as a heterologous host and reconstructs a taxadiene synthetic approach by means of genetic engineering, thereby initially establishing a cheap and efficient taxol intermediate production system. Preliminary experiment results show that the application obtains the homogeneous transformation strain through screening, and the taxadiene synthetase gene is efficiently expressed in tobacco chloroplast, so that the taxadiene is heterogeneously synthesized in tobacco, the content of the taxadiene in tobacco transformation strain leaves can reach 127.69 mug/g at most, and the application prospect is good.
Drawings
FIG. 1 shows a structure of chloroplast expression vector of taxadiene synthase gene;
FIG. 2 shows tobacco homogenization screening of the gene of the taxadiene synthase;
FIG. 3 is a Southern Blot identification of tobacco homogeneous strains transformed with taxadiene synthase gene;
FIG. 4 is a GC-MS analysis of transgenic tobacco leaves;
FIG. 5 is an identification of heterologously expressed taxadienes in tobacco;
FIG. 6 is a graph showing the relative content of heterologously expressed taxadiene in tobacco.
Detailed Description
The present application is further explained with reference to the following examples, so that those skilled in the art can further understand the technical solutions of the present application.
Example 1
The construction of the recombinant vector pLD-TS for expressing taxadiene in chloroplast is briefly described below in this example.
(1) Construction of chloroplast expression vector pLD-MCS
With reference to the prior art (Verma D et al. A protocol for expression of expression genes in chloroplasts, nat protocol, 2008), a chloroplast expression vector pLD-MCS was designed. The chloroplast expression vector pLD-MCS structure is shown in figure 1, the vector is on tobacco chloroplast genometrnIAndtrnAfor left and right homologous sequences, usingPrrnPromoter regulatory screening markeraadAGene (spectinomycin resistance), utilizationpsbAThe promoter of the gene and the 5'UTR regulate the expression of the target gene (i.e., TS gene of the present application), transcription is terminated by a terminator of TpsbA, and a Multiple Cloning Site (MCS) is designed between the promoter PpsbA +5' UTR and the terminator TpsbA.
The designed chloroplast expression vector pLD-MCS is synthesized in a whole-gene synthesis mode and is used for constructing a subsequent recombinant transformation vector.
(2) Obtaining Taxadiene Synthetase (TS) gene
The total length of the base sequence of the taxadiene synthase gene (TS) is 2586bp, the genebank number AY364469, the gene sequence adopted in the embodiment is subjected to whole-gene synthesis, and the sequence is cloned to a pUC57 vector after the synthesis is finished.
In the process of constructing the recombinant vector, plasmid synthesized by whole genes is used as a template, primers are designed for TS gene cloning, the specific primer sequences are shown as SEQ ID NO.1 and SEQ ID NO.2, and the specific design is as follows:
TS-F：5’-aataaaccaagattttaATGGCTCAGCTCTCATTTA-3’，
TS-R：5’-ctaggccaggatcgctctagaTCATACTTGAATTGGATCA-3’；
the partial sequences of the small letter in the primer sequences (i.e., "aataaaccaagatttta" at the 5 'end of the TS-F primer and "ctaggccaggatcgctctaga" at the 5' end of the TS-R primer) are flanking sequences of the insertion site of the target gene in the tobacco chloroplast expression vector skeleton pLD-MCS.
Using CloneAmp TM And (3) amplifying the HiFi PCR Premix, recovering an amplification product, cloning the amplification product to a T vector, converting escherichia coli, performing PCR positive verification by using a TS gene cloning primer, selecting positive clones for sequencing, and determining that the sequence of the cloning product is correct for vector construction.
(3) pLD-TS recombinant expression vector construction
Carrying out double enzyme digestion on the tobacco chloroplast expression vector pLD-MCS in the step (1) by utilizing NdeI and XbaI, and then recovering to linearize the pLD-MCS;
then using Clontech TM Constructing the TS gene fragment obtained In the step (2) on a linearized vector by a homologous recombination method through an In-Fusion HD Cloning Kit;
after Escherichia coli is transformed, PCR positive verification is carried out by using a TS gene cloning primer, positive clones are selected for sequencing, and a recombinant vector with correct recombination and connection is named as pLD-TS. After further propagation, a large amount of pLD-TS plasmid DNA was extracted for chloroplast transformation.
Example 2
Based on the recombinant vector pLD-TS constructed in example 1, the inventors further performed chloroplast transformation and homogenization screening, and this example is briefly described below with respect to the relevant experimental procedures.
(1) Chloroplast transformation
In the chloroplast transformation process, the operation was performed using a PDS 1000/He gene gun (Bio-Rad, USA), in which: the gold powder particles were 0.6 μm in diameter and 9cm bombardment distance, and were made to rupture at 1100psi, with the gold powder microprojectiles being coated with 0.2. Mu.g of plasmid DNA (i.e., the recombinant vector pLD-TS prepared in example 1) per mg of gold powder.
The specific operation process is as follows:
selecting 3-4 healthy leaves with the diameter of about 3cm for cultivating tobacco Honghuadajinyuan aseptic seedlings as explants, cutting the leaves with the back facing upwards, and placing the cut leaves on an RMOP culture medium;
bombarding tobacco leaves by using a gene gun, and then, carrying out dark culture on the bombarded leaves on an RMOP culture medium for 2 days at 26 ℃ with the back faces upwards;
after the end of the dark culture, the leaves were cut into 5mm X5 mm pieces, placed face down on RMOP medium (containing 500mg/L spectinomycin), and cultured under 16h light and 8h dark photoperiod conditions at 26 ℃.
(2) Homogeneous screening
Culturing for 6-8 weeks, after culturing the tobacco explant transformed in the step (1) until adventitious buds are generated, cutting leaves into pieces of 5mm multiplied by 5mm, placing the pieces on RMOP culture medium (containing 500mg/L spectinomycin) with the back face facing downwards for homogenization screening;
after three successive rounds, new adventitious shoots were obtained and transferred to MSO medium (containing 500mg/L spectinomycin) for rooting culture (partial experimental results are shown in FIG. 2).
(3) Positive identification and homogeneous identification
Selecting positive plants by using selective marker genes aadA and TS genes as target genes and adopting a PCR amplification mode, wherein in the PCR amplification process, specific primer sequences are as follows:
3P：5’-AAAACCCGTCCTCAGTTCGGATTGC-3’，
3M：5’-CCGCGTTGTTTCATCAAGCCTTACG-3’；
5P'：5’-CAGCCCGTCATACTTGAAGCT-3’，
2M'：5’-TTAGACATCCAACCCGTAATCG-3’；
it should be noted that 3P is located on the tobacco chloroplast genome, and 3M is located on the aadA gene, so the pair of primer combinations is used to detect whether the screening marker is site-specifically integrated on the chloroplast genome; while 5P 'is located on the aadA gene and 2M' is located on the trnA gene, the primer set pair was used to verify the complete integration of the expression element into the chloroplast genome.
The PCR verification is positive single strains, and the homogenization identification is carried out by using Southern Blot. The Southern blot identification method comprises the following steps:
taking 4 mu g of chloroplast DNA, carrying out enzyme digestion by using ApaI, carrying out 0.8% agarose gel electrophoresis on the enzyme digestion product, transferring the enzyme digestion product to a nitrocellulose membrane after the electrophoresis is finished, and carrying out ultraviolet crosslinking; southern hybridization analysis was then performed (see kit instructions of Roche).
In the Southern hybridization process, the probe is a 874bp segment between trnI-trnA segments, and specific probe cloning primers are as follows:
CtFK1F：5’-AACTTTCGATTCACTCGTGGG-3’，
CtFK1R：5’-CCGACTCCAACTACCGTCCA-3’。
the Southern Blot results are shown in FIG. 3. As can be seen from the analysis, a fragment signal of about 4.0kb was present in the wild-type material, whereas a fragment signal of about 8.2kb was present in the homogeneous strain. In order to facilitate detection and analysis, strains TS-2, TS-3 and TS-6 are selected for subsequent analysis.
Furthermore, the inventor carries out detection and analysis on the content of the heterologously synthesized taxadiene in strains TS-2, TS-3 and TS-6. The specific process is briefly described as follows.
(1) Sample pretreatment
Picking fresh tobacco leaves (about 8 weeks), quickly putting the fresh tobacco leaves into liquid nitrogen for quick freezing, grinding the fresh tobacco leaves into fine powder under the protection of the liquid nitrogen, weighing 0.5g of tobacco leaf samples, adding 5mL of n-hexane extracting solution (containing 20 mu g/mL of internal standard nonadecane), carrying out ultrasonic treatment for 20min, centrifuging, and taking supernate, namely supernate 1; extracting the precipitate with 5mL of n-hexane, performing ultrasonic treatment for 20min, centrifuging, and taking supernatant, which is named as supernatant 2; extracting the precipitate with 5mL of n-hexane, performing ultrasonic treatment for 20min, centrifuging, and taking supernatant, which is named as supernatant 3; and combining the supernatant fluid 1-3, drying by nitrogen, re-dissolving by using 1mL of n-hexane, and carrying out GC-MS analysis.
(2) GC-MS detection
The detection is carried out by utilizing a Thermo TSQ 8000 gas chromatography-mass spectrometer, and the specific parameters are as follows:
ion source temperature: 250 ℃, transmission line temperature: 280 ℃; the sample inlet temperature is 280 ℃;
scanning mode: acquisition-General; the mass range is as follows: 50-600;
temperature rising procedure: the temperature is kept at 100 ℃ for 1min, then the temperature is increased to 300 ℃ at 8 ℃/min and kept for 2min, finally the temperature is increased to 320 ℃ at 8 ℃ and kept for 2min, and the sample is injected without shunting.
GC-MS detection results show that the transformed seedlings have obvious difference peaks (shown in figure 4) at the retention time of 16.22min, the cracking fragments of the peaks have the same characteristic ions (m/z 107, 122, 187, 229, 257 and 272) as the taxadiene reported in the literature (shown in figure 5), and the results show that the taxadiene is successfully synthesized heterologously in the tobacco.
Further, the content of taxadiene is determined by a relative quantitative mode, and the target peak is relatively quantitatively analyzed by the concentration/peak area of the internal standard substance. Through the comparison of relative quantitative analysis and calculation, the content of the taxadiene in the tobacco transformant leaves reaches 127.69 mug/g at most (figure 6).
In conclusion, the invention can obviously carry out heterologous synthesis of the taxadiene in the tobacco, obtains higher yield, solves the first speed-limiting step in the biosynthesis pathway of the taxol, provides enough precursor substances for the biosynthesis of the taxol and metabolic intermediate products and lays a solid foundation for the subsequent synthesis of the taxol by utilizing genetic engineering.
SEQUENCE LISTING
<110> Zhengzhou tobacco institute of China tobacco general company
<120> a recombinant vector pLD-TS for expressing taxadiene in chloroplast
<130> none
<160> 2
<170> PatentIn version 3.5
<210> 1
<211> 36
<212> DNA
<213> Artificial design
<400> 1
aataaaccaa gattttaatg gctcagctct cattta 36
<210> 2
<211> 40
<212> DNA
<213> Artificial design
<400> 2
ctaggccagg atcgctctag atcatacttg aattggatca 40

Claims (5)

1. The recombinant vector pLD-TS for expressing the taxadiene in chloroplast is characterized by being prepared by the following steps:
(1) Construction of chloroplast expression vector pLD-MCS
The chloroplast expression vector pLD-MCS is on the tobacco chloroplast genometrnIAndtrnAfor left and right homologous sequences, usingPrrnPromoter regulatory screening markeraadAGenes, utilization ofpsbAA promoter and 5'UTR of the gene regulate the expression of the gene of interest, transcription is terminated by a terminator of TpsbA, and a multiple cloning site is designed between the promoter PpsbA +5' UTR and the terminator TpsbA;
(2) Obtaining the Taxadiene synthetase gene TS gene
The total length of the base sequence of the taxadiene synthetase gene TS is 2586bp, and the genebank number AY364469 is coded;
(3) pLD-TS recombinant expression vector construction
Carrying out double enzyme digestion on the tobacco chloroplast expression vector pLD-MCS in the step (1) by utilizing NdeI and XbaI, and then recovering to linearize the pLD-MCS vector;
constructing the TS gene fragment obtained In the step (2) on a linearized vector after double enzyme digestion by using an In-Fusion cloning method through a homologous recombination method;
after further transformation verification, the recombinant vector with correct recombinant ligation was named pLD-TS.
2. A method for preparing taxadiene using the recombinant vector pLD-TS of claim 1, comprising the steps of:
(1) Transformation of chloroplasts
Transforming the recombinant vector pLD-TS into a tobacco plant;
(2) Homogeneous screening
Carrying out homogenization screening on the transformant in the step (1) to obtain a homogenization plant of the chloroplast taxadiene synthetase gene;
(3) Production of expression taxadiene
And (3) cultivating the homogenized plant screened in the step (2) to produce and express the taxadiene.
3. The method for producing taxadiene using recombinant vector pLD-TS according to claim 2, wherein in step (1), said tobacco is nicotiana tabacum, a variety of nicotiana major.
4. The method for preparing taxadiene from the recombinant vector pLD-TS according to claim 2, wherein in step (2), said homogeneous screening is performed by means of tissue culture in RMOP medium containing 500mg/L spectinomycin.
5. A method for culturing a tobacco variety by using the recombinant vector pLD-TS of claim 1, wherein the tobacco variety expressing and producing taxadiene in chloroplast is obtained by screening the tobacco variety by a tissue culture technique after the recombinant vector pLD-TS is transformed into tobacco by a gene recombination technique.
CN201911345952.6A 2019-12-24 2019-12-24 Recombinant vector pLD-TS for expressing taxadiene in chloroplast Active CN110951758B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201911345952.6A CN110951758B (en) 2019-12-24 2019-12-24 Recombinant vector pLD-TS for expressing taxadiene in chloroplast

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201911345952.6A CN110951758B (en) 2019-12-24 2019-12-24 Recombinant vector pLD-TS for expressing taxadiene in chloroplast

Publications (2)

Publication Number Publication Date
CN110951758A CN110951758A (en) 2020-04-03
CN110951758B true CN110951758B (en) 2022-12-27

Family

ID=69984075

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201911345952.6A Active CN110951758B (en) 2019-12-24 2019-12-24 Recombinant vector pLD-TS for expressing taxadiene in chloroplast

Country Status (1)

Country Link
CN (1) CN110951758B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006111924A2 (en) * 2005-04-19 2006-10-26 University Of Kentucky Research Foundation Transformed plants accumulating terpenes
CN101302555A (en) * 2008-06-12 2008-11-12 上海交通大学 Molecule identification method for taxol-producing endophytic fungi in yew

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2006111924A2 (en) * 2005-04-19 2006-10-26 University Of Kentucky Research Foundation Transformed plants accumulating terpenes
CN101302555A (en) * 2008-06-12 2008-11-12 上海交通大学 Molecule identification method for taxol-producing endophytic fungi in yew

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
A protocol for expression of foreign genes in chloroplasts;Dheeraj Verma et al.;《NATURE PROTOCOLS》;20080403;第3卷(第4期);第739-758页 *
Chloroplastic metabolic engineering coupled with isoprenoid pool enhancement for committed taxanes biosynthesis in Nicotiana benthamiana;Jianhua Li et al.;《NATURE COMMUNICATIONS》;20191024;第10卷;第1-12页 *
紫杉二烯合酶基因在灵芝中的表达;辛燕花等;《中国农业科学》;20141231;第47卷(第3期);第546-552页 *

Also Published As

Publication number Publication date
CN110951758A (en) 2020-04-03

Similar Documents

Publication Publication Date Title
Cui et al. Co-overexpression of geraniol-10-hydroxylase and strictosidine synthase improves anti-cancer drug camptothecin accumulation in Ophiorrhiza pumila
Shi et al. Targeted metabolic engineering of committed steps improves anti-cancer drug camptothecin production in Ophiorrhiza pumila hairy roots
CN108048415B (en) Two myricetin flavonol synthetase MrFLSs proteins and application of coding genes thereof
JP7122715B2 (en) Hydroxylase gene and uses thereof
Jin et al. Two classes of cytochrome P450 reductase genes and their divergent functions in Camptotheca acuminata Decne
Han et al. Bioproduction of baccatin III, an advanced precursor of paclitaxol, with transgenic Flammulina velutipes expressing the 10‐deacetylbaccatin III‐10‐O‐acetyl transferase gene
CN116987603A (en) Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof
CN110951758B (en) Recombinant vector pLD-TS for expressing taxadiene in chloroplast
Zeng et al. Engineering the production of medicinal tropane alkaloids through enhancement of tropinone and littorine biosynthesis in root cultures of Atropa belladonna
CN102212550A (en) Method for increasing content of camptothecin through co-transformation of double genes of transcription factor ORCA3 (Octadecanoie-responsive Cantharanthus AP2-doman protein 3) and key enzyme G10H (Geraniol 10-hydroxylase)
CN116891871A (en) Method for synthesizing cucurbitadienol by using cucurbitadienol synthase and application thereof
Alfermann Production of natural products by plant cell and organ cultures
CN103194488A (en) Preparation method of novel medicine source raw material of camptothecin
CN113005130B (en) Tanshinone IIA synthase gene and application thereof
CN111073821B (en) Construction method of monascus ruber strain capable of producing lovastatin with high yield and producing no citrinin
Yang et al. Establishment of recombinant Catharanthus roseus stem cells stably overexpressing ORCA4 for terpenoid indole alkaloids biosynthesis
Zhao Overexpression of geraniol-10-hydroxylase improves valtrate accumulation in Valeriana jatamansi
Dickinson et al. Transient heterologous gene expression methods for poison ivy leaf and cotyledon tissues
CN115960191B (en) MYC transcription factor for regulating and controlling synthesis of volatile terpenoid of red sage root, and coding gene and application thereof
CN115927280B (en) Horse chestnut 2, 3-oxidation squalene cyclase and encoding gene and application thereof
CN105586340B (en) HER2/neu tissue specific promoter variant and application thereof
CN102212549A (en) Method for increasing camptothecin content through double key enzyme gene co-transformation
CN109722443B (en) Ginger flower sesquiterpene synthase gene HcTPS14 and application thereof
CN116855527A (en) Construction method of recombinant salvia miltiorrhiza hairy root for producing taxadiene
Zhang et al. Molecular Mechanisms and Gene Regulation for Biosynthesis of Medicinal Plant Active Ingredients

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant