CN110950965A

CN110950965A - Chimeric antigen receptor of anti-human CD123 and application thereof

Info

Publication number: CN110950965A
Application number: CN201811125906.0A
Authority: CN
Inventors: 张巍; 单娟娟; 徐艳敏; 黄霞; 赵文旭; 陈军; 赵永春; 张茜真
Original assignee: Chongqing Precision Biotech Co ltd
Current assignee: Chongqing Precision Biotech Co ltd
Priority date: 2018-09-26
Filing date: 2018-09-26
Publication date: 2020-04-03
Anticipated expiration: 2038-09-26
Also published as: CN110950965B

Abstract

The invention belongs to the field of genetic engineering, and particularly relates to an anti-human CD123 chimeric antigen receptor and application thereof. The polypeptide for recognizing the CD123 antigen comprises amino acid sequences shown as SEQ ID NO:4-7, and can be used as an antigen recognition region in a (CAR) structure to induce CAR-T cell activation. After the chimeric antigen receptor of the anti-CD 123 antigen is expressed in immune cells, not only can the tumor target cells expressing the CD123 antigen be effectively eliminated, but also the tumor target cells of negative antigen (not expressing CD123) have no toxic effect; and the CD 123-targeted CAR can maintain the positive rate in the cell culture process of a patient, can proliferate for a long time after being stimulated by a target antigen, and can be used for the targeted therapy of tumors.

Description

Chimeric antigen receptor of anti-human CD123 and application thereof

Technical Field

The invention belongs to the field of genetic engineering, and particularly relates to an anti-human CD123 chimeric antigen receptor and application thereof.

Background

Acute Myelogenous Leukemia (AML) is a malignant disease of hematopoietic stem/progenitor cells of a myeloid line, is characterized by abnormal hyperplasia of primary and juvenile myelogenous cells in bone marrow and peripheral blood as a main characteristic, and is urgent in most cases, dangerous in the future, and life can be threatened if treatment is not performed in time; conventional induction chemotherapy, while capable of relieving AML, ultimately does not prevent relapse of AML and the high mortality of relapsed patients. However, conventional treatment of AML has not changed for 50 years and new changes are urgently sought. Although the chimeric antigen receptor T cell technology has an excellent therapeutic effect on Acute Lymphoblastic Leukemia (ALL) expressing CD19, it is necessary to search whether CD19 molecule is suitable for AML as a target.

The CD123, also called interleukin 3 receptor α chain (IL-3R α), is highly expressed in leukemia stem cells or leukemia naive cells, is not expressed or is low expressed in normal hematopoietic stem cells, and is a leukemia-related antigen and a specific antigen of acute myeloid leukemia, the emergence of CD123 target is a breakthrough in AML treatment, because CD123 is highly expressed in AML, the CD123 targeted immunotherapy theoretically has a safer and more effective treatment effect, foreign countries also have already performed clinical tests of targeting drugs using CD123 as targets, but the efficacy is very limited and safety problems still occur, therefore, a new CD123 targeted therapy with better specificity and more effective needs to be found, although tests of some targets are in progress at present, the number of CARs used for treating AML is relatively small, further transformation tests are still needed in the stability and safety of CAR performance, and how to select more stable and suitable scFv (single-chain antibody) is an unsolved problem in research, so that the CD123 is a more effective and the CAR-preparing the CD 123-target is a very important target for research and development of the CAR preparation.

Chimeric Antigen Receptors (CARs), abbreviated as CARs, are artificial receptors that mimic TCR function and consist of an antigen recognition domain, a hinge region, and a transmembrane region, in turn linked to an intracellular signaling domain, usually the CD3 zeta chain or FcR gamma, or linked to one or more costimulatory molecules, such as 4-1BB (CD137), CD28, ICOS (CD 278). When an antigen (receptor) on the surface of a tumor cell is bound to an antibody (ligand) of a chimeric antigen receptor, a signal is transmitted into the cell through a hinge region and a transmembrane region, an intracellular signal region converts the signal into an activation signal, an effector cell is activated, and the effector cell proliferates to produce a cytokine, thereby killing the tumor cell. CAR-T treatment of different tumor diseases targets different antigens, different antigen-antigen binding sites differ, and completely different scFv recognition is required. Moreover, because of different antigens and different scFv affinities, the normal function of scFv in the CAR structure is closely related to the hinge region, and which scFv is most suitable for selecting which hinge structure is not researched at present and needs to be searched through a large number of experiments.

The single chain antibody is used as an important component in the CAR structure, the selection of the single chain antibody plays an important role in the curative effect of CAR-T, and the traditional murine antibody causes Human anti-mouse antibody reaction (HAMA) due to the heterogeneity of the murine antibody, so that CAR-T is rapidly cleared in the circulatory system and loses the curative effect. Therefore, therapeutic murine mabs require humanization modifications to increase the degree of humanization of the antibody, attenuating HAMA. However, modification of antibodies usually results in loss of original antigen-binding activity of antibodies, so that repeated modification of key residues affecting antigen-antibody binding is required, and then a large number of antigen-antibody binding specificity and affinity detection are performed to screen and obtain active antibody sequences.

Therefore, engineering scfvs suitable for CAR-T therapy and screening CAR structures suitable for engineered humanized scfvs is essential to address the treatment of AML with CAR-T targeting CD 123.

Disclosure of Invention

In view of the above, an object of the present invention is to provide an anti-CD 123 chimeric antigen receptor and an application thereof, wherein the chimeric antigen receptor comprising CD123-scFv of the present invention can be more stably expressed in T lymphocytes, can better eliminate tumor target cells expressing CD123 antigen, and has no toxic effect on tumor cells negative for antigen (not expressing CD 123).

In order to achieve the purpose, the technical scheme of the invention is as follows:

the chimeric antigen receptor of anti-human CD123 antigen is characterized by comprising an antigen recognition region formed by a single-chain antibody with an amino acid sequence shown as SEQ ID NO.4 or SEQ ID NO.5 or SEQ ID NO.6 or SEQ ID NO. 7.

The chimeric antigen receptor needs to overcome two technical barriers, namely, searching for a more stable and effective humanized monoclonal antibody (scFv) for recognizing the CD123 antigen, and obtaining an optimal CAR combination mode.

The single chain antibody (scFv) for recognizing the human CD123 antigen is a humanized single chain antibody obtained by means of CDR grafting and site-directed mutagenesis of multiple or unit FR regions. Site-directed mutagenesis of multiple or single FR regions is aimed at restoring antibody stability and antigen recognition activity, and the humanized antibody structure remains stable only when properly configured, with random results. In theory, "single chain antibodies" may be used to make chimeric antigen receptors, but not every single chain antibody may actually be used to make chimeric antigen receptors. This requires creative efforts of the inventors to find products with unexpected effects among the numerous engineered single chain antibodies.

The inventors designed 7 different humanized scfvs and 3 different CAR structures for random combinations, evaluated by scFv affinity, stability, CAR expression stability, CAR-T cell effectiveness and safety 5, and finally only the groups protected by the present invention, with unexpected technical effects.

The combined mode of the partial protective CAR can play a role in stably expressing T lymphocytes from patients after being tested, has better capacity of eliminating tumor cells, and is used for adoptive cell therapy aiming at malignant hematological diseases.

The single-chain antibody comprising the amino acid sequence shown in SEQ ID NO.4 or SEQ ID NO.5 or SEQ ID NO.6 or SEQ ID NO.7 has unexpected technical effects. Compared with the expression before reconstruction, the expression is more stable, the specificity is high, and the capacity of eliminating tumor cells is better.

Preferably, the chimeric antigen receptor further comprises a hinge region, a transmembrane region, and an intracellular signal domain;

preferably, the amino acid sequence of the hinge region is shown as SEQ ID NO 8 or 9 or 10 or 11.

Preferably, the transmembrane region is an amino acid sequence derived from CD8TM or CD28TM, the amino acid sequence of the CD8TM is shown as SEQ ID NO. 12, and the amino acid sequence of the CD28TM is shown as SEQ ID NO. 13.

Preferably, the intracellular signal domain is CD28 and/or CD137 and CD 3; the amino acid sequence of the CD28 is shown as SEQ ID NO. 14, the amino acid sequence of the CD137 is shown as SEQ ID NO. 15, and the amino acid sequence of the CD3 is shown as SEQ ID NO. 16.

The intracellular signaling domain is formed by connecting a costimulatory domain and a primary signaling domain, wherein the costimulatory domain is CD28 and/or CD137, and the primary signaling domain is CD 3.

Furthermore, the amino acid sequence of the chimeric antigen receptor is shown as SEQ ID NO.17 or SEQ ID NO.18 or SEQ ID NO.19 or SEQ ID NO.20 or SEQ ID NO.21 or SEQ ID NO. 22.

Furthermore, the gene sequence of the chimeric antigen receptor is shown as SEQ ID NO.23 or SEQ ID NO.24 or SEQ ID NO.25 or SEQ ID NO.26 or SEQ ID NO.27 or SEQ ID NO. 28.

It is a further object of the present invention to provide a recombinant vector comprising a nucleotide sequence encoding the chimeric antigen receptor described above.

Preferably, the recombinant vector is a lentiviral vector or a recombinant plasmid.

The preparation method of the lentivirus vector of the chimeric antigen receptor for expressing the anti-human CD123 antigen comprises the following steps:

1) synthesizing a gene sequence of a chimeric antigen receptor of the anti-human CD123 antigen;

2) construction of lentivirus vectors expressing antibodies: designing a primer, and carrying out PCR amplification by taking the gene sequence of the antibody as a template to obtain a DNA fragment;

the enzyme digestion reaction was carried out as described in the specification. And (3) separating the enzyme digestion product through agarose gel electrophoresis, then recovering the DNA fragment by using an agarose gel DNA fragment recovery kit, and then connecting the target fragment with the vector fragment through T4 ligase to obtain the lentiviral vector for expressing the antibody.

Further, after step 2), the lentiviral vector is packaged and purified.

The lentivirus vector obtained by the method has high positive expression rate, is stable in the cell culture process of patients and does not cause the reduction of CAR positive rate with the passage of time. T cells infected with the lentiviral vector, such T cells having a function of killing target cells.

The invention also aims to provide a cell infected by the recombinant vector.

Preferably, the cell may be selected from: stem cells, T cells, NK cells, monocytes or macrophages.

The invention also aims to provide application of the cell in preparing a medicament for treating malignant hematological diseases.

Further, the cells or tissues of the hematological malignancy are capable of expressing CD 123.

Further, the hematologic malignancies are acute myeloid leukemia, acute lymphocytic leukemia and B-cell chronic lymphocytic proliferative disease expressing CD 123.

The invention has the beneficial effects that:

1) the anti-CD 123 humanized single-chain antibody provided by the invention has high humanization degree, can effectively reduce the immunogenicity of a Chimeric Antigen Receptor (CAR) when used for preparing the CAR, and enhances the durability and safety of CAR-T in vivo.

2) The chimeric antigen receptor prepared from the anti-CD 123 humanized single-chain antibody provided by the invention can recognize an anti-human CD123 antigen, can be more stably expressed in T lymphocytes, has better capacity of removing tumor cells, can maintain the positive rate of the chimeric antigen receptor targeting CD123 in the cell culture process of a patient, can enhance the proliferation and tumor killing capacity of CAR-T, has no toxic or side effect on antigen-negative cells, and can be used for targeted therapy of tumors.

3) The chimeric antigen receptor prepared from the anti-CD 123 humanized single-chain antibody provided by the invention can be stably expressed in T lymphocytes, particularly patient-derived T lymphocytes, and can be used for preparing a medicament for treating tumors in a blood system and treating adoptive cells of the tumors.

Drawings

FIG. 1 is a graph of the different CD123-CAR expression.

FIG. 2 shows the different killing efficiencies of CD 123-CAR.

FIG. 3 is a humanized anti-CD 123scFv affinity assay.

Figure 4 is a schematic of the structure of a Chimeric Antigen Receptor (CAR) targeting the human CD123 antigen.

Figure 5 is a Chimeric Antigen Receptor (CAR) expression assay targeting human CD123 antigen.

Figure 6 is the killing of CD123 positive and negative tumor cells in vitro by T cells expressing a CD 123-targeted chimeric antigen receptor.

FIG. 7 is an in vitro specific assay of T cells expressing a chimeric antigen receptor targeting CD 123.

Figure 8 is a graph of the treatment of T cells expressing a chimeric CD123 antigen receptor targeted in a mouse tumor model.

Detailed Description

Hereinafter, preferred embodiments of the present invention will be described in detail (with reference to the accompanying drawings). The experimental methods of the preferred embodiments, which do not indicate specific conditions, are generally performed according to conventional conditions, and the examples are given for better illustration of the present invention, but the present invention is not limited to the examples. Therefore, those skilled in the art should make insubstantial modifications and adaptations to the embodiments of the present invention in light of the above teachings and remain within the scope of the invention.

Example 1: design of humanized monoclonal antibodies against human CD123 antigen

(1) The 6-segment FR region amino acid sequences of the light and heavy chains of the monoclonal antibody of the mouse anti-human CD123 antigen are subjected to sequence analysis and comparison by an IMGT/BLAST database, and a human antibody sequence with the highest homology is selected as a modification template. The murine antibody scFv sequences are shown in Table 1 below.

Table 1: murine antibody scFv sequences

(2) Through molecular docking simulation, the framework sequence is subjected to humanized modification and transformation to obtain 3 humanized scFv, and the amino acid sequences are shown as SEQ ID NO.1, SEQ ID NO.2 and SEQ ID NO. 3. The CAR construction is carried out, the humanized scFv constructed CAR can be normally expressed on the surface of a T cell but cannot normally work after experience proves, and the murine scFv combination CAR which is not modified can normally work, and can recognize and kill tumor cells expressing CD 123; the results are shown in FIGS. 1 and 2.

(3) Redesigning the humanization transformation strategy: carrying out PCR site-directed mutagenesis on the humanized reformed sequence, and carrying out site-directed mutagenesis to obtain 4 new reformed scFv, wherein the amino acid sequences of the scFv obtained by mutagenesis are shown as SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 and SEQ ID NO. 7.

Example 2 affinity assay for humanized monoclonal antibody targeting CD123

The preferable monoclonal antibody scFv is marked with a His tag and then cloned into a plasmid vector and is used for transfecting HEK293 cells, the scFv-His and a negative control are purified and diluted by 6 gradients through PBS, CD123 expression positive THP-1 cells are respectively incubated, the positive rate of THP-1CD123 detection under the concentration gradient is detected in a flow mode, the statistics of flow positive rate and MFI (mean fluorescence intensity) is carried out, and the affinity of different scFv to CD123 is analyzed. Three independent replicates were performed and the results are shown in FIG. 3, where the greater the Kd (nM) the lower the affinity.

Example 3 Lentiviral preparation of chimeric antigen receptors expressing targeting human CD123 antigen

(1) Gene sequence for preparing chimeric antigen receptor targeting human CD123 antigen

A chimeric antigen receptor sequence comprising in sequence a leader peptide (also called signal peptide), a single-chain antibody ScFv against human CD123 antigen, a hFc hinge region, a transmembrane region and an intracellular signal segment was synthesized, and the structure is shown in FIG. 4. The nucleotide sequence of the leader peptide is atgggatggagctgtatcatcctcttcctggtagcaacagctacaggcgtgcacagt; the nucleotide sequence of the humanized single-chain antibody of the anti-human CD123 antigen is shown as SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO20, SEQ ID NO21, SEQ ID NO22, SEQ ID NO23 and SEQ ID NO 24; the nucleotide sequence of the hFc hinge region is an amino acid sequence corresponding to SEQ ID NO.8 or SEQ ID NO9 or SEQ ID NO10 or SEQ ID NO 11; the transmembrane region is an amino acid sequence derived from CD8TM or CD28 TM; the intracellular signal segment is CD28 or CD137 and CD3 derived nucleotide sequence.

(2) Construction of Lentiviral vectors expressing chimeric antigen receptors

Chimeric antigen receptor expression vectors were named CAR12301, CAR12302, CAR12303, CAR12304, CAR12305, CAR12306, CAR12307, CAR12308, CAR12309, CAR12310, CAR12311, CAR12300 lentiviral vectors, depending on the loading of ScFv and the differences in transmembrane structure and intracellular signaling, respectively. Wherein CAR12300 is a murine control.

The enzyme digestion reaction was carried out as described in the specification. The enzyme digestion product is separated by agarose gel electrophoresis, DNA fragment recovery is carried out by an agarose gel DNA fragment recovery kit, then the target fragment and the vector fragment are connected by T4 ligase (purchased from Promega company), and the lentiviral vector expressing the chimeric antigen receptor is obtained, wherein the structure of 3CAR structures and 4 humanized antibody combinations are combined to total 12 combinations as shown in figure 4. The plasmid extraction kit (Invitrogen corporation) extracts the plasmid, and the specific method is shown in the specification.

Example 6 preparation of chimeric antigen receptor-modified T cells for CD123 antigen

(1) Packaging of lentiviruses

The lentivirus packaging in this example was performed using the calcium phosphate method, and the specific procedures are described in the molecular cloning protocols (third edition, sambrook et al).

(2) Lentivirus purification

Collecting virus supernatant, centrifuging, filtering, and transferring to a new centrifuge tube; according to the virus supernatant, the virus was purified using PEG6000 at a final concentration of 8.5% and NaCl at a final concentration of 0.3M, and the purified virus was resuspended in 200. mu.L of 10% FBS-containing DMEM medium and dispensed into 1.5mL EP tubes and stored at-80 ℃ for further use.

(3) Lentiviral titer determination

293T cells were infected with the virus, and the genome was extracted 72 hours after infection using a QIAamp DNA Blood Mini Kit (purchased from Qiagen, Cat. RTM. 511004) genome extraction Kit. According to the kit instruction. qRT-PCR assay viral titers data were analyzed using analytical software and viral titers were calculated according to a standard curve and the results are expressed in TU/mL. Titers are shown in Table 2 below, all greater than 1 x 10⁸TU/ml。

TABLE 2 Lentiviral titers

Viral name	Viral titre
		CAR12301	1.00E+08
CAR12302	2.63E+08
		CAR12303	1.64E+08
CAR12304	4.58E+08
		CAR12305	3.86E+08
CAR12306	2.40E+08
		CAR12309	1.40E+08
CAR12310	2.14E+08
		CAR12311	2.00E+08

(4) Lentiviral infection of T cells

1) Isolation of human peripheral blood mononuclear cells

Collecting about 60ml of peripheral blood by using a blood collection tube added with an anticoagulant, adding hydroxyethyl starch for dilution, naturally settling for about 30min at room temperature (18-25 ℃), and separating lymphocytes by using a gradient centrifugation method; after centrifugation, the second white lymphocyte layer was washed 2 times with physiological saline, and cultured in RPMI 1640 containing 10% FBS to obtain human peripheral blood mononuclear cells.

2) Lentiviral vector infection of T lymphocytes

Culturing newly prepared mononuclear cell PBMC with complete culture medium, activating with anti-CD 3 monoclonal antibody, and infecting with slow virus; separately adding lentiviral vector and uninfected peripheral blood lymphocytes (PBMC) as blank control; after 24h, the medium was replaced with RPMI 1640 complete medium containing 500IU/mL recombinant human IL-2, and the culture was continued for 10-20 days. Chimeric antigen receptor T cells obtained from lentiviral vectors infected with CAR12301, CAR12302, CAR12303, CAR12304, CAR12305, CAR12306, CAR12307, CAR12308, CAR12309, CAR12310, CAR12311, CAR12300 are named under the viral name: CAR12301, CAR12302, CAR12303, CAR12304, CAR12305, CAR12306, CAR12307, CAR12308, CAR12309, CAR12310, CAR12311, CAR 12300.

3) Chimeric Antigen Receptor (CAR) expression detection targeting human CD123 antigen

The CAR positive rate was tested on virus-infected T cells cultured up to day 5 and day 11 during the culture. Collecting cells to adjust cell density to 1X 10⁶And (4) each cell is separately packaged, and the Protein-L positive rate is detected by using flow cytometry, wherein the detection result shows that the positive rate of CAR with different structures is expressed in T lymphocytes. Results are shown in table 3 and figure 5, the CAR positive rate after infection of T cells by different viruses, among which CAR12303, CAR12311 and CAR12302 infection efficiency is low, CAR12301 expression rate decreases with the duration of culture time, and CAR positive rate and stability of other structures are good.

TABLE 3 Positive expression rate of CAR on T lymphocytes

CAR	C-171011(5d/11d)	B-171017(5d/11d)	C-171017	B-171115(4d/9d)
					CAR12301	59.1/30.8	64.1/50.7	61.8	66.1/29.69
CAR12302	11.7/8.3	22.4/15	19.4	18.59/11.52
					CAR12303	3.0/1.6
CAR12304	78.5/87.6	82.1/87	72.7	86.56/95.07
					CAR12305	51.9/64.9	65.9/67.2	43.2	64.72/81.95
CAR12306	28.1/34.6	35.5/41.5	26.8	23.79/53.73
					CAR12307			24.4
CAR12308			21.0
					CAR12309	65.6/74.5	67.9/76.6	50.5
CAR12310	27.3/36.9	39.9/43.7	27.5
					CAR12311	9.2/10.6
CAR12300		35.8/21.9	30.7	16.35/8.79

Example 7 validation of anti-tumor Effect of T lymphocytes expressing chimeric antigen receptor targeting CD123

CD123 positive THP-1 cells (Raji-luc for short) for stably expressing firefly luciferase and negative cells Raji are taken as target cells, and effector cells are spread according to a 1: 1-effect target ratio. Use of Steady-

The killing effect is detected by a standard method provided by a Luciferase assay System (Promega Cat. # E2520) kit, and the killing rate is calculated by the following formula:

the killing results are shown in fig. 6, and the results show that CAR12301, CAR12302, CAR12305, CAR12304, CAR12310 and CAR12309 all have good in vitro killing effect and specificity. Wherein the amino acid sequence of the CAR structure of CAR12301 is shown as SEQ ID NO.17, and the nucleotide sequence is shown as SEQ ID NO. 23; the amino acid sequence of the CAR structure of CAR12302 is shown as SEQ ID NO.18, and the nucleotide sequence is shown as SEQ ID NO. 24; the amino acid sequence of the CAR structure of CAR12304 is shown as SEQ ID NO.19, and the nucleotide sequence is shown as SEQ ID NO. 25; the amino acid sequence of the CAR structure of CAR12305 is shown as SEQ ID NO.20, and the nucleotide sequence is shown as SEQ ID NO. 26; the amino acid sequence of the CAR structure of CAR12309 is shown as SEQ ID NO.21, and the nucleotide sequence is shown as SEQ ID NO. 27; the amino acid sequence of the CAR structure of CAR12310 is shown as SEQ ID NO.22, and the nucleotide sequence is shown as SEQ ID NO. 28.

Example 8 detection of affinity antigen receptor T cell specificity targeting human CD123

CD123 negative cells Raji which stably express firefly luciferase are taken as target cells, and effector cells are paved according to a 1:1 effect target ratio. Use of Steady-

the experiment was repeated 4 times independently, and the results are shown in fig. 7, except for CAR12304, the remaining targeted CD123CAR-T had better specificity.

Example 9 demonstration of the antitumor Effect of T lymphocytes expressing chimeric antigen receptor targeting CD123 in animal models

A mouse transplantation tumor model of a human CD123 positive tumor cell line is established for verifying the anti-tumor effect of the T lymphocyte expressing the chimeric antigen receptor targeting CD123 in an animal model.

Cg-PrkdcscidiI2rgtm1Sug/Jiccrl, NOG mouse for short, which is bred by Mamoru Ito of the Japanese institute of Experimental animals (CIEA) is the most common strain for CAR-T related tumor formation experiments internationally. In vivo validation the tumor-targeted cells used were the previous in vitro validation used CD 123-positive cell line THP-1 stably expressing firefly luciferase. After the mice had developed tumors, CAR-T cells, saline controls, and virus-uninfected PBMC cells were injected tail-vein separately. The tumor growth was shown by imaging every 7 days after CAR T cell injection by IVS in vivo imaging system from PerkinElmer, with the smaller the fluorescence value, the more surviving mice had better treatment. Mice survival was observed daily and recorded during this period. The results are shown in FIG. 8: CAR12301, CAR12304, and CAR12310 all had better in vivo killing results, with the preferred in vivo killing results for CAR12301 and CAR12310 being optimal.

In the experiment, a single-chain antibody of a mouse monoclonal antibody (different epitope peptides) is obtained, humanized transformation and site-specific mutagenesis are carried out on the single-chain antibody, the humanized antibody subjected to site-specific mutagenesis is used for preparing a chimeric antigen receptor, and a functional verification test is carried out on the chimeric antigen receptor. The experiments in this section lead to the conclusion that: although various humanized modification schemes are reported, the result of humanized modification has unknown property, especially for stability and affinity optimization, after site-directed mutagenesis is carried out, the effectiveness of the humanized single-chain antibody obtained by modification can be confirmed only by a large amount of verification; in theory, "single chain antibodies" may be used to make chimeric antigen receptors, but not every single chain antibody may actually be used to make chimeric antigen receptors. This requires creative efforts of the inventors to find products with unexpected effects among the numerous engineered single chain antibodies.

Finally, the above embodiments are only for illustrating the technical solutions of the present invention and not for limiting, although the present invention has been described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions may be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all of them should be covered in the claims of the present invention.

<110> Chongqing precision Biotechnology Co., Ltd

<120> chimeric antigen receptor for anti-human CD123 and use thereof

<160>28

<170>PatentIn version 3.3

<210>1

<211>238

<212>PRT

<213>Artificial

<220>

<223>scFv-humanized 1

<400>1

Asp Ile Gln Met Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro Gly

1 5 10 15

Asp Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Ala Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Val Gln Leu

115 120 125

Gln Glu Pro Gly Ala Glu Leu Val Lys Pro Gly Ala Ser Leu Arg Leu

130 135 140

Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn Trp

145150 155 160

Val Arg Gln Arg Pro Asp Gln Gly Leu Glu Trp Met Gly Arg Ile Asp

165 170 175

Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg Ala

180 185 190

Ile Ile Thr Val Asp Lys Ser Ser Ser Thr Ala Tyr Met Glu Leu Ser Ser

195 200 205

Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Asn Trp

210 215 220

Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235

<210>2

<211>239

<212>PRT

<213>Artificial

<220>

<223>scFv-humanized 2

<400>2

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 4045

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Val Gln Leu

115 120 125

Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Gly Gly Ser Leu Arg Leu

130 135 140

Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn Trp

145 150 155 160

Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile Gly Arg Ile Asp

165 170 175

Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg Ala

180 185 190

Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu Ser

195 200205

Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Asn

210 215 220

Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235

<210>3

<211>239

<212>PRT

<213>Artificial

<220>

<223>scFv-humanized 3

<400>3

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Val Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Gln Lys Pro Gly Lys Ala Pro Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Val Gln Leu

115 120 125

Gln Glu Ser Gly Pro Gly Leu Val Lys Pro Gly Gly Ser Leu Arg Leu

130 135 140

Ser Cys Ala Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn Trp

145 150 155 160

Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile Asp

165 170 175

Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Gly Arg Val

180 185 190

Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu Ser

195 200 205

Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly Asn

210 215 220

Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235

<210>4

<211>240

<212>PRT

<213>Artificial

<220>

<223>scFv-humanized 4

<400>4

Asp Ile Gln Met Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro Gly

1 5 10 15

Asp Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Asp Gln Gly Leu Glu Trp Ile Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Lys

180 185 190

Ala Ile Leu Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

<210>5

<211>240

<212>PRT

<213>Artificial

<220>

<223>scFv-humanized 5

<400>5

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg

180 185 190

Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

<210>6

<211>240

<212>PRT

<213>Artificial

<220>

<223>scFv-humanized 6

<400>6

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Ser Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Gly Arg

180 185 190

Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

<210>7

<211>240

<212>PRT

<213>Artificial

<220>

<223>scFv-humanized 7

<400>7

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Val Lys Lys ProGly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg

180 185 190

Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

<210>8

<211>47

<212>PRT

<213>

<220>

<223> CD8h hinge

<400>8

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

1 5 10 15

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

20 25 30

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp

35 40 45

<210>9

<211>36

<212>PRT

<213>

<220>

<223>7h hinge

<400>9

Ala Pro Pro Arg Ala Ser Ala Leu Pro Ala Pro Pro Thr Gly Ser Ala

1 5 10 15

Leu Pro Asp Pro Gln Thr Ala Ser Ala Leu Pro Asp Pro Pro Ala Ala

20 25 30

Ser Ala Leu Pro

35

<210>10

<211>45

<212>PRT

<213>

<220>

<223>8h (dc) hinge

<400>10

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

1 5 10 15

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Arg Pro Ala Ala

20 25 30

Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Asp

35 40 45

<210>11

<211>229

<212>PRT

<213>

<220>

<223> IgG4h hinge

<400>11

Glu Ser Lys Tyr Gly Pro Pro Cys Pro Pro Cys Pro Ala Pro Glu Phe

1 5 10 15

Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr

20 25 30

Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val

35 40 45

Ser Gln Glu Asp Pro Glu Val Gln Phe Asn Trp Tyr Val Asp Gly Val

50 55 60

Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Phe Asn Ser

65 70 75 80

Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu

85 90 95

Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Gly Leu Pro Ser

100 105 110

Ser IleGlu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro

115 120 125

Gln Val Tyr Thr Leu Pro Pro Ser Gln Glu Glu Met Thr Lys Asn Gln

130 135 140

Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala

145 150 155 160

Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr

165 170 175

Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Arg Leu

180 185 190

Thr Val Asp Lys Ser Arg Trp Gln Glu Gly Asn Val Phe Ser Cys Ser

195 200 205

Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser

210 215 220

Leu Ser Leu Gly Lys

225

<210>12

<211>24

<212>PRT

<213>

<220>

<223> CD8 transmembrane region

<400>12

Ile Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu

510 15

Leu Ser Leu Val Ile Thr Leu Tyr Cys

20

<211>13

<212>PRT

<213>27

<220>

<223> CD28 transmembrane region

<400>13

Phe Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser

5 10 15

Leu Leu Val Thr Val Ala Phe Ile Ile Phe Trp Val

20 25

<210>14

<211>41

<212>PRT

<213>

<220>

<223> CD28 costimulatory signals

<400>14

Arg Ser Lys Arg Ser Arg Leu Leu His Ser Asp Tyr Met Asn Met

5 10 15

Thr Pro Arg Arg Pro Gly Pro Thr Arg Lys His Tyr Gln Pro Tyr

20 25 30

Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg Ser

35 40

<210>15

<211>44

<212>PRT

<213>

<220>

<223> CD137 co-stimulation signals

<400>15

Val Lys Arg Gly Arg Lys Lys Leu Leu Tyr Ile Phe Lys Gln Pro

5 10 15

Phe Met Arg Pro Val Gln Thr Thr Gln Glu Glu Asp Gly Cys Ser

20 25 30

Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys Glu Leu Arg

35 40

<210>16

<211>111

<212>PRT

<213>

<220>

<223> CD3 costimulatory signals

<400>16

Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

5 10 15

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu

20 25 30

Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly

35 40 45

Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu

50 5560

Leu Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met

65 70 75

Lys Gly Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln

80 85 90

Gly Leu Ser Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met

95 100 105

Gln Ala Leu Pro Pro Arg

110

<210>17

<211>465

<212>PRT

<213>Artificial

<220>

<223>CAR12301

<400>17

Asp Ile Gln Met Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro Gly

1 5 10 15

Asp Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Asp Gln Gly Leu Glu Trp Ile Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Lys

180 185 190

Ala Ile Leu Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val SerSer

225 230 235 240

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

245 250 255

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

260 265 270

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe

275 280 285

Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu

290 295 300

Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu

305 310 315 320

Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr

325 330 335

Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr

340 345 350

Arg Ser Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln

355 360 365

Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu

370 375 380

Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly

385 390 395 400

Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln

405 410 415

Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu

420 425 430

Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr

435 440 445

Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro

450 455 460

Arg

465

<210>18

<211>466

<212>PRT

<213>Artificial

<220>

<223>CAR12302

<400>18

Asp Ile Gln Met Thr Gln Ser Pro Ser Tyr Leu Ala Ala Ser Pro Gly

1 5 10 15

Asp Thr Ile Thr Ile Asn Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Ile Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Met Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Leu Val Arg Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Asp Gln Gly Leu Glu Trp Ile Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Lys

180 185 190

Ala Ile Leu Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Thr Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

245 250 255

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

260 265 270

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile

275 280 285

Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser

290 295 300

Leu Val Ile Thr Leu Tyr Cys Val Lys Arg Gly Arg Lys Lys Leu Leu

305 310 315 320

Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu

325 330 335

Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys

340 345 350

Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln

355 360 365

Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu

370 375 380

Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly

385 390 395 400

Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu

405 410 415

Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly

420 425 430

Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser

435 440 445

Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro

450 455 460

Pro Arg

465

<210>19

<211>465

<212>PRT

<213>Artificial

<220>

<223>CAR12304

<400>19

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg

180185 190

Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

245 250 255

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

260 265 270

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe

275 280 285

Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu

290 295 300

Val Thr Val Ala Phe Ile Ile Phe Trp Val Arg Ser Lys Arg Ser Arg Leu

305 310 315 320

Leu His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr

325 330 335

Arg Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr

340345 350

Arg Ser Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln

355 360 365

Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu

370 375 380

Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly

385 390 395 400

Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln

405 410 415

Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu

420 425 430

Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr

435 440 445

Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro

450 455 460

Arg

465

<210>20

<211>466

<212>PRT

<213>Artificial

<220>

<223>CAR12305

<400>20

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Ile Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg

180 185 190

Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

245 250 255

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

260 265 270

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile

275 280 285

Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser

290 295 300

Leu Val Ile Thr Leu Tyr Cys Val Lys Arg Gly Arg Lys Lys Leu Leu

305 310 315 320

Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu

325 330 335

Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys

340 345 350

Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln

355 360 365

Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu

370 375 380

Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly

385 390 395 400

Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu

405 410 415

Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly

420 425 430

Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser

435 440 445

Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro

450 455 460

Pro Arg

465

<210>21

<211>464

<212>PRT

<213>Artificial

<220>

<223>CAR12309

<400>21

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg

180 185 190

Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

245 250 255

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

260 265 270

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Phe

275 280 285

Trp Val Leu Val Val Val Gly Gly Val Leu Ala Cys Tyr Ser Leu Leu

290 295 300

Val Thr Val Ala Phe Ile Ile Trp Val Arg Ser Lys Arg Ser Arg Leu Leu

305 310 315 320

His Ser Asp Tyr Met Asn Met Thr Pro Arg Arg Pro Gly Pro Thr Arg

325 330 335

Lys His Tyr Gln Pro Tyr Ala Pro Pro Arg Asp Phe Ala Ala Tyr Arg

340 345 350

Ser Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln Gln Gly

355 360 365

Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu Glu Tyr

370 375 380

Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly Gly Lys

385 390 395 400

Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu Gln Lys

405 410 415

Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly Glu Arg

420 425 430

Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser Thr Ala

435 440 445

Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro Pro Arg

450 455 460

<210>22

<211>466

<212>PRT

<213>Artificial

<220>

<223>CAR12310

<400>22

Asp Ile Gln Met Thr Gln Ser Pro Ser Ser Leu Ser Ala Ser Pro Gly

1 5 10 15

Asp Arg Val Thr Ile Thr Cys Arg Ala Ser Lys Ser Ile Ser Lys Asp

20 25 30

Leu Ala Trp Tyr Gln Glu Lys Pro Gly Lys Thr Asn Lys Leu Leu Ile

35 40 45

Tyr Ser Gly Ser Thr Leu Gln Ser Gly Val Pro Ser Arg Phe Ser Gly

50 55 60

Ser Gly Ser Gly Thr Asp Phe Thr Leu Thr Ile Ser Ser Leu Gln Pro

65 70 75 80

Glu Asp Phe Ala Thr Tyr Tyr Cys Gln Gln His Asn Lys Tyr Pro Tyr

85 90 95

Thr Phe Gly Gly Gly Thr Lys Leu Glu Ile Lys Gly Ser Thr Ser Gly

100 105 110

Ser Gly Lys Pro Gly Ser Gly Glu Gly Ser Thr Lys Gly Gln Val Gln

115 120 125

Leu Val Gln Pro Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys

130 135 140

Val Ser Cys Lys Ala Ser Gly Tyr Thr Phe Thr Ser Tyr Trp Met Asn

145 150 155 160

Trp Val Arg Gln Ala Pro Gly Gln Gly Leu Glu Trp Met Gly Arg Ile

165 170 175

Asp Pro Tyr Asp Ser Glu Thr His Tyr Asn Gln Lys Phe Lys Asp Arg

180 185 190

Val Thr Ile Thr Ala Asp Lys Ser Thr Ser Thr Ala Tyr Met Glu Leu

195 200 205

Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Ala Arg Gly

210 215 220

Asn Trp Asp Asp Tyr Trp Gly Gln Gly Thr Thr Leu Thr Val Ser Ser

225 230 235 240

Lys Pro Thr Thr Thr Pro Ala Pro Arg Pro Pro Thr Pro Ala Pro Thr

245 250 255

Ile Ala Ser Gln Pro Leu Ser Leu Arg Pro Glu Ala Cys Arg Pro Ala

260 265 270

Ala Gly Gly Ala Val His Thr Arg Gly Leu Asp Phe Ala Cys Asp Ile

275 280 285

Tyr Ile Trp Ala Pro Leu Ala Gly Thr Cys Gly Val Leu Leu Leu Ser

290 295 300

Leu Val Ile Thr Leu Tyr Cys Val Lys Arg Gly Arg Lys Lys Leu Leu

305 310 315 320

Tyr Ile Phe Lys Gln Pro Phe Met Arg Pro Val Gln Thr Thr Gln Glu

325 330 335

Glu Asp Gly Cys Ser Cys Arg Phe Pro Glu Glu Glu Glu Gly Gly Cys

340 345 350

Glu Leu Arg Val Lys Phe Ser Arg Ser Ala Asp Ala Pro Ala Tyr Gln

355 360 365

Gln Gly Gln Asn Gln Leu Tyr Asn Glu Leu Asn Leu Gly Arg Arg Glu

370 375 380

Glu Tyr Asp Val Leu Asp Lys Arg Arg Gly Arg Asp Pro Glu Met Gly

385 390 395 400

Gly Lys Pro Arg Arg Lys Asn Pro Gln Glu Gly Leu Tyr Asn Glu Leu

405 410 415

Gln Lys Asp Lys Met Ala Glu Ala Tyr Ser Glu Ile Gly Met Lys Gly

420 425 430

Glu Arg Arg Arg Gly Lys Gly His Asp Gly Leu Tyr Gln Gly Leu Ser

435 440 445

Thr Ala Thr Lys Asp Thr Tyr Asp Ala Leu His Met Gln Ala Leu Pro

450 455 460

Pro Arg

465

<210>23

<211>1473

<212>DNA

<213>Artificial

<220>

<223>CAR12301

<400>23

gctagcatgg cactgccagt gaccgccctg ctgctgcctc tggccctgct gctgcacgca 60

gcaaggccag acatccagat gacacagagc ccatcctacc tggcagccag cccaggcgac 120

accatcacaa tcaactgccg cgcctctaag agcatctcca aggatctggc ctggtaccag 180

gagaagcctg gcaagaccaa taagctgctg atctattctg gcagcacact gcagagcggc 240

atcccatccc ggttctccgg atctggaagc ggaaccgact ttaccctgac aatcagctcc 300

ctgcagccag aggatttcgc catgtactat tgccagcagc acaacaagta cccctatacc 360

tttggcggcg gcacaaagct ggagatcaag ggatccacct ctggaagcgg caagcctgga 420

tctggagagg gaagcacaaa gggacaggtg cagctggtgc agcctggagc agagctggtg 480

aggccaggag cctccgtgaa ggtgtcttgt aaggccagcg gctacacctt cacatcctat 540

tggatgaact gggtgcggca ggcaccagac cagggactgg agtggatcgg cagaatcgac 600

ccttacgatt ctgagaccca ctataatcag aagtttaagg acaaggccat cctgacagcc 660

gataagtcca cctctacagc ctacatggag ctgtctagcc tgacctccga ggatacagcc 720

gtgtactatt gtgccagagg caattgggac gattattggg gccagggcac cacactgacc 780

gtgtcctctc tcgagaagcc caccacgacg ccagcgccgc gaccaccaac accggcgccc 840

accatcgcgt cgcagcccct gtccctgcgc ccagaggcgt gccggccagc ggcggggggc 900

gcagtgcaca cgagggggct ggacttcgcc tgcgactttt gggtgctggt ggtggttggt 960

ggagtcctgg cttgctatag cttgctagta acagtggcct ttattatttt ctgggtgagg 1020

agtaagagga gcaggctcct gcacagtgac tacatgaaca tgactccccg ccgccccggg 1080

cccacccgca agcattacca gccctatgcc ccaccacgcg acttcgcagc ctatcgctcc 1140

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 1200

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260

gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320

ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380

aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440

gacgcccttc acatgcaggc cctgccccct cgc 1473

<210>24

<211>1473

<212>DNA

<213>Artificial

<220>

<223>CAR12302

<400>24

gctagcatgg cactgccagt gaccgccctg ctgctgcctc tggccctgct gctgcacgca 60

gcaaggccag acatccagat gacacagagc ccatcctacc tggcagccag cccaggcgac 120

accatcacaa tcaactgccg cgcctctaag agcatctcca aggatctggc ctggtaccag 180

gagaagcctg gcaagaccaa taagctgctg atctattctg gcagcacact gcagagcggc 240

atcccatccc ggttctccgg atctggaagc ggaaccgact ttaccctgac aatcagctcc 300

ctgcagccag aggatttcgc catgtactat tgccagcagc acaacaagta cccctatacc 360

tttggcggcg gcacaaagct ggagatcaag ggatccacct ctggaagcgg caagcctgga 420

tctggagagg gaagcacaaa gggacaggtg cagctggtgc agcctggagc agagctggtg 480

aggccaggag cctccgtgaa ggtgtcttgt aaggccagcg gctacacctt cacatcctat 540

tggatgaact gggtgcggca ggcaccagac cagggactgg agtggatcgg cagaatcgac 600

ccttacgatt ctgagaccca ctataatcag aagtttaagg acaaggccat cctgacagcc 660

gataagtcca cctctacagc ctacatggag ctgtctagcc tgacctccga ggatacagcc 720

gtgtactatt gtgccagagg caattgggac gattattggg gccagggcac cacactgacc 780

gtgtcctctc tcgagaagcc caccacgacg ccagcgccgc gaccaccaac accggcgccc 840

accatcgcgt cgcagcccct gtccctgcgc ccagaggcgt gccggccagc ggcggggggc 900

gcagtgcaca cgagggggct ggacttcgcc tgcgacatct acatctgggc gcccttggcc 960

gggacttgtg gggtccttct cctgtcactg gttatcaccc tttactgcgt taaacggggc 1020

agaaagaaac tcctgtatat attcaaacaa ccatttatga gaccagtaca aactactcaa 1080

gaggaagatg gctgtagctg ccgatttcca gaagaagaag aaggaggatg tgaactgaga 1140

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 1200

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260

gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320

ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380

aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440

gacgcccttc acatgcaggc cctgccccct cgc 1473

<210>25

<211>1473

<212>DNA

<213>Artificial

<220>

<223>CAR12304

<400>25

gctagcatgg cactgccagt gaccgccctg ctgctgcctc tggccctgct gctgcacgca 60

gcaaggccag acatccagat gacacagagc ccaagctccc tgtctgccag cccaggcgac 120

agggtgacca tcacatgcag agcctccaag tctatcagca aggatctggc ctggtaccag 180

gagaagcctg gcaagaccaa caagctgctg atctattccg gctctacact gcagtctgga 240

gtgccaagcc gcttcagcgg atccggatct ggaaccgact ttaccctgac aatctctagc 300

ctgcagccag aggatttcgc cacatactat tgccagcagc acaataagta cccctatacc 360

tttggcggcg gcacaaagct ggagatcaag ggaagcacct ccggatctgg caagcctgga 420

tccggagagg gctctacaaa gggacaggtg cagctggtgc agcctggagc agaggtgaag 480

aagccaggag ccagcgtgaa ggtgtcctgt aaggcctctg gctacacctt cacaagctat 540

tggatgaact gggtgcggca ggcaccagga cagggactgg agtggatcgg cagaatcgac 600

ccttacgatt ccgagaccca ctataatcag aagtttaaggaccgggtgac catcacagcc 660

gataagagca cctccacagc ctacatggag ctgtcctctc tgaggtccga ggataccgcc 720

gtgtactatt gtgccagagg caactgggac gattattggg gccagggcac cacactgacc 780

gtgagctccc tcgagaagcc caccacgacg ccagcgccgc gaccaccaac accggcgccc 840

accatcgcgt cgcagcccct gtccctgcgc ccagaggcgt gccggccagc ggcggggggc 900

gcagtgcaca cgagggggct ggacttcgcc tgcgactttt gggtgctggt ggtggttggt 960

ggagtcctgg cttgctatag cttgctagta acagtggcct ttattatttt ctgggtgagg 1020

agtaagagga gcaggctcct gcacagtgac tacatgaaca tgactccccg ccgccccggg 1080

cccacccgca agcattacca gccctatgcc ccaccacgcg acttcgcagc ctatcgctcc 1140

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 1200

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260

gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320

ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380

aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440

gacgcccttc acatgcaggc cctgccccct cgc 1473

<210>26

<211>1473

<212>DNA

<213>Artificial

<220>

<223>CAR12305

<400>26

gctagcatgg cactgccagt gaccgccctg ctgctgcctc tggccctgct gctgcacgca 60

gcaaggccag acatccagat gacacagagc ccaagctccc tgtctgccag cccaggcgac 120

agggtgacca tcacatgcag agcctccaag tctatcagca aggatctggc ctggtaccag 180

gagaagcctg gcaagaccaa caagctgctg atctattccg gctctacact gcagtctgga 240

gtgccaagcc gcttcagcgg atccggatct ggaaccgact ttaccctgac aatctctagc 300

ctgcagccag aggatttcgc cacatactat tgccagcagc acaataagta cccctatacc 360

tttggcggcg gcacaaagct ggagatcaag ggaagcacct ccggatctgg caagcctgga 420

tccggagagg gctctacaaa gggacaggtg cagctggtgc agcctggagc agaggtgaag 480

aagccaggag ccagcgtgaa ggtgtcctgt aaggcctctg gctacacctt cacaagctat 540

tggatgaact gggtgcggca ggcaccagga cagggactgg agtggatcgg cagaatcgac 600

ccttacgatt ccgagaccca ctataatcag aagtttaagg accgggtgac catcacagcc 660

gataagagca cctccacagc ctacatggag ctgtcctctc tgaggtccga ggataccgcc 720

gtgtactatt gtgccagagg caactgggac gattattggg gccagggcac cacactgacc 780

gtgagctccc tcgagaagcc caccacgacg ccagcgccgc gaccaccaac accggcgccc 840

accatcgcgt cgcagcccct gtccctgcgc ccagaggcgt gccggccagc ggcggggggc 900

gcagtgcaca cgagggggct ggacttcgcc tgcgacatct acatctgggc gcccttggcc 960

gggacttgtg gggtccttct cctgtcactg gttatcaccc tttactgcgt taaacggggc 1020

agaaagaaac tcctgtatat attcaaacaa ccatttatga gaccagtaca aactactcaa 1080

gaggaagatg gctgtagctg ccgatttcca gaagaagaag aaggaggatg tgaactgaga 1140

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 1200

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260

gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320

ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380

aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440

gacgcccttc acatgcaggc cctgccccct cgc 1473

<210>27

<211>1473

<212>DNA

<213>Artificial

<220>

<223>CAR12309

<400>27

gctagcatgg cactgccagt gaccgccctg ctgctgcctc tggccctgct gctgcacgca 60

gcaaggccag acatccagat gacacagagc ccaagctccc tgtctgccag cccaggcgac 120

agggtgacca tcacatgcag agcctccaag tctatcagca aggatctggc ctggtaccag 180

gagaagcctg gcaagaccaa caagctgctg atctattccg gctctacact gcagtctgga 240

gtgccaagcc gcttcagcgg atccggatct ggaaccgact ttaccctgac aatctctagc 300

ctgcagccag aggatttcgc cacatactat tgccagcagc acaataagta cccctatacc 360

tttggcggcg gcacaaagct ggagatcaag ggaagcacct ccggatctgg caagcctgga 420

tccggagagg gctctacaaa gggacaggtg cagctggtgc agcctggagc agaggtgaag 480

aagccaggag ccagcgtgaa ggtgtcctgt aaggcctctg gctacacctt cacaagctat 540

tggatgaact gggtgcggca ggcaccagga cagggactgg agtggatggg cagaatcgac 600

ccttacgatt ccgagaccca ctataatcag aagtttaagg accgggtgac catcacagcc 660

gataagagca cctccacagc ctacatggag ctgtcctctc tgaggtccga ggataccgcc 720

gtgtactatt gtgccagagg caactgggac gattattggg gccagggcac cacactgacc 780

gtgagctccc tcgagaagcc caccacgacg ccagcgccgc gaccaccaac accggcgccc 840

accatcgcgt cgcagcccct gtccctgcgc ccagaggcgt gccggccagc ggcggggggc 900

gcagtgcaca cgagggggct ggacttcgcc tgcgactttt gggtgctggt ggtggttggt 960

ggagtcctgg cttgctatag cttgctagta acagtggcct ttattatttt ctgggtgagg 1020

agtaagagga gcaggctcct gcacagtgac tacatgaaca tgactccccg ccgccccggg 1080

cccacccgca agcattacca gccctatgcc ccaccacgcg acttcgcagc ctatcgctcc 1140

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 1200

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260

gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320

ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380

aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440

gacgcccttc acatgcaggc cctgccccct cgc 1473

<210>28

<211>1473

<212>DNA

<213>Artificial

<220>

<223>CAR12310

<400>28

gctagcatgg cactgccagt gaccgccctg ctgctgcctc tggccctgct gctgcacgca 60

gcaaggccag acatccagat gacacagagc ccaagctccc tgtctgccag cccaggcgac 120

agggtgacca tcacatgcag agcctccaag tctatcagca aggatctggc ctggtaccag 180

gagaagcctg gcaagaccaa caagctgctg atctattccg gctctacact gcagtctgga 240

gtgccaagcc gcttcagcgg atccggatct ggaaccgact ttaccctgac aatctctagc 300

ctgcagccag aggatttcgc cacatactat tgccagcagc acaataagta cccctatacc 360

tttggcggcg gcacaaagct ggagatcaag ggaagcacct ccggatctgg caagcctgga 420

tccggagagg gctctacaaa gggacaggtg cagctggtgc agcctggagc agaggtgaag 480

aagccaggag ccagcgtgaa ggtgtcctgt aaggcctctg gctacacctt cacaagctat 540

tggatgaact gggtgcggca ggcaccagga cagggactgg agtggatggg cagaatcgac 600

ccttacgatt ccgagaccca ctataatcag aagtttaagg accgggtgac catcacagcc 660

gataagagca cctccacagc ctacatggag ctgtcctctc tgaggtccga ggataccgcc 720

gtgtactatt gtgccagagg caactgggac gattattggg gccagggcac cacactgacc 780

gtgagctccc tcgagaagcc caccacgacg ccagcgccgc gaccaccaac accggcgccc 840

accatcgcgt cgcagcccct gtccctgcgc ccagaggcgt gccggccagc ggcggggggc 900

gcagtgcaca cgagggggct ggacttcgcc tgcgacatct acatctgggc gcccttggcc 960

gggacttgtg gggtccttct cctgtcactg gttatcaccc tttactgcgt taaacggggc 1020

agaaagaaac tcctgtatat attcaaacaa ccatttatga gaccagtaca aactactcaa 1080

gaggaagatg gctgtagctg ccgatttcca gaagaagaag aaggaggatg tgaactgaga 1140

gtgaagttca gcaggagcgc agacgccccc gcgtaccagc agggccagaa ccagctctat 1200

aacgagctca atctaggacg aagagaggag tacgatgttt tggacaagag acgtggccgg 1260

gaccctgaga tggggggaaa gccgagaagg aagaaccctc aggaaggcct gtacaatgaa 1320

ctgcagaaag ataagatggc ggaggcctac agtgagattg ggatgaaagg cgagcgccgg 1380

aggggcaagg ggcacgatgg cctttaccag ggtctcagta cagccaccaa ggacacctac 1440

gacgcccttc acatgcaggc cctgccccct cgc 1473

Claims

1. The chimeric antigen receptor of anti-human CD123 antigen is characterized by comprising an antigen recognition region formed by a single-chain antibody with an amino acid sequence shown as SEQ ID NO.4, SEQ ID NO.5, SEQ ID NO.6 or SEQ ID NO. 7.

2. The chimeric antigen receptor according to claim 1, further comprising a hinge region, a transmembrane region, and an intracellular signaling domain; the transmembrane region is an amino acid sequence derived from CD8TM or CD28TM, the amino acid sequence of the CD8TM is shown as SEQ ID NO. 12, and the amino acid sequence of the CD28TM is shown as SEQ ID NO. 13.

3. The chimeric antigen receptor according to claim 2, wherein the amino acid sequence of the hinge region is represented by SEQ ID NO 8 or 9 or 10 or 11.

4. The chimeric antigen receptor according to claim 2, wherein the intracellular signaling domain is CD28 and/or CD137 and CD 3; the amino acid sequence of the CD28 is shown as SEQ ID NO. 14, the amino acid sequence of the CD137 is shown as SEQ ID NO. 15, and the amino acid sequence of the CD3 is shown as SEQ ID NO. 16.

5. The chimeric antigen receptor according to any one of claims 1 to 4, wherein the amino acid sequence of the chimeric antigen receptor is as shown in SEQ ID No.17 or 18 or 19 or 20 or 21 or 22.

6. A recombinant vector comprising a nucleotide sequence encoding the chimeric antigen receptor of any one of claims 1-5.

7. The vector of claim 6, wherein the vector is selected from the group consisting of a lentiviral expression vector, a retroviral expression vector, an adenoviral expression vector, an adeno-associated viral expression vector, a DNA vector, an RNA vector and a plasmid.

8. A cell infected with the recombinant vector of claim 6 or 7.

9. Use of the cell of claim 8 for the preparation of a medicament for the treatment of hematological malignancies.

10. The use according to claim 9, wherein the cells or tissues of hematological malignancies are capable of expressing CD 123.

11. The use according to claim 10, wherein the hematological malignancy is acute myelogenous leukemia, acute lymphocytic leukemia and B-cell chronic lymphocytic proliferative disease expressing CD 123.