CN110938640B - Alpha-amyrin synthetase gene EjAAS1 and application thereof - Google Patents

Abstract

The invention discloses an alpha-amyrin synthetase gene EjAAS1 and application thereof, and particularly discloses application of a coding gene with a nucleotide sequence shown as SEQ ID NO.1 as loquat alpha-amyrin synthetase gene and application of a protein with an amino acid sequence shown as SEQ ID NO.2 as loquat alpha-amyrin synthetase. The invention firstly clarifies the alpha-amyrin synthetase gene EjAAS1 with the expression change in different tissues and the content of triterpenic acid being obviously and positively correlated, the gene can be expressed instantly in tobacco leaves to heterologously synthesize alpha-amyrin in the tobacco leaves, and the gene can promote the synthesis of loquat alpha-amyrin and the in vitro biosynthesis of alpha-amyrin and derivatives of ursolic glycoside triterpenic acid. The invention lays a foundation for the application of synthetic biology methods such as gene tandem expression and a biological generator in the research of loquat metabolism, and provides theoretical support for the modification and utilization of functional components.

Description

Alpha-amyrin synthetase gene EjAAS1 and application thereof

Technical Field

The invention relates to the technical field of biology, and in particular relates to an alpha-amyrin synthetase gene EjAAS1 and application thereof.

Background

The loquat is ripe in autumn and winter and ripe in spring and summer, and besides the fruit is popular with consumers as a rare fruit, the leaves of the loquat are important traditional Chinese medicines and important triterpenic acid product extraction substrates. Researchers have identified more than 30 triterpenic acid components from the loquat leaf extract by improving extraction process, mass spectrum detection, germplasm resource evaluation and the like for a long time, and found that ursolic acid and derivatives thereof, such as corosolic acid, tormentic acid and other ursolic glycoside triterpenic acids are the main triterpenic acid types accumulated by the loquat leaves. Meanwhile, in recent years, research of a plurality of research groups at home and abroad including applicant groups finds that the triterpenic acid components such as ursolic acid in the loquat leaf extract play an important role in inhibiting diseases such as cancer cells, tumors, white blood cells and fatty liver.

Ursolic acid is the most important triterpenic acid component in loquat leaves, has various biological effects of inhibiting cancer cell growth, resisting inflammation, resisting bacteria, resisting diabetes, resisting ulcer, reducing blood sugar and the like, and also has an obvious antioxidant function, so the ursolic acid is widely used as a medicine and cosmetic raw material.

Although the loquat leaves contain more triterpenic acid components such as ursolic acid and the like compared with other plants, secondary metabolites such as ursolic acid and the like still need to be separated from the leaves through a complicated extraction process in the production, and a large amount of manpower and material resources are consumed in the extraction process. Meanwhile, the production of loquat fruits is affected after a large number of leaves are collected, and the fruit production and the leaf supply are difficult to guarantee simultaneously in the production. Research on synthesis regulation of triterpenic acid and utilization of metabolic engineering technologies such as a biological generator are important ways for efficiently and industrially preparing specific components such as ursolic acid, and although some triterpenic acid synthesis related gene segments are cloned on loquat by researchers and the expression of the genes is considered to be related to the synthesis of triterpenic acid, direct catalytic products of the corresponding genes cannot be obtained in the researches. Alpha-amyrin is a direct precursor of main triterpenic acid components such as loquat leaf ursolic acid and the like, the synthesis of the alpha-amyrin is a key enzyme for synthesizing ursin triterpenic acid, but no gene report for synthesizing the catalytic enzyme exists on loquat.

Disclosure of Invention

The invention aims to overcome the defects of the prior art and provides an alpha-amyrin synthetase gene E jAAS1 and application thereof.

The first purpose of the invention is to provide the application of the coding gene with the nucleotide sequence shown as SEQ ID NO.1 as the loquat alpha-amyrin synthetase gene.

The second purpose of the invention is to provide the application of the protein with the amino acid sequence shown as SEQ ID NO.2 as loquat alpha-amyrin synthetase.

The third object of the present invention is to provide a recombinant vector.

The fourth purpose of the invention is to provide an engineering bacterium

The fifth purpose of the invention is to provide the application of any one of the coding gene, the protein, the recombinant vector or the engineering bacterium in the synthesis of the up-regulated loquat alpha-amyrin.

The sixth purpose of the invention is to provide the application of any one of the coding gene, the protein, the recombinant vector or the engineering bacterium in the in vitro synthesis of alpha-amyrin.

The seventh purpose of the invention is to provide the application of any one of the coding gene, the protein, the recombinant vector or the engineering bacterium in promoting the synthesis of the loquat ussuriensis triterpenic acid.

In order to achieve the purpose, the invention is realized by the following technical scheme:

the invention separates and clones a loquat triterpenic acid precursor alpha-amyrin synthetase gene EjAAS1 from 'Zao Zhong No. 6'. The nucleotide sequence is shown as SEQ ID NO.1 and comprises an open reading frame of 2283 bp; codes 760 amino acids, and the coded amino acid sequence is shown in SEQ ID NO. 2.

Through analyzing the triterpenic acid components of different loquat tissues, an alpha-amyrin synthetase gene mainly expressed in leaves is discovered. The expression level of the gene gradually rises along with the development of each organ, the expression change of the gene in different tissues is obviously and positively correlated with the content of the triterpenic acid, the gene expression is instantaneously expressed in the tobacco leaves, the alpha-amyrin can be heterologously synthesized in the tobacco, and the gene can promote the synthesis of the loquat alpha-amyrin and the in vitro biosynthesis of the alpha-amyrin and the derivative of the ursolic acid.

The invention therefore claims the following:

the coding gene with the nucleotide sequence shown as SEQ ID NO.1 is applied as loquat alpha-amyrin synthetase gene.

The protein with amino acid sequence shown as SEQ ID NO.2 is applied as loquat alpha-amyrin synthetase.

A recombinant vector, wherein the coding gene is connected with the recombinant vector.

An engineering bacterium carrying the recombinant vector.

The coding gene, the protein, the recombinant vector or the engineering bacterium can be applied to the synthesis of the upregulated loquat alpha-amyrin.

The coding gene, the protein, the recombinant vector or the engineering bacterium can be applied to the in vitro synthesis of alpha-amyrin.

The coding gene, the protein, the recombinant vector or the engineering bacterium can be applied to the promotion of the synthesis of the loquat ussuriensis triterpenic acid.

Preferably, the ursoside triterpenic acid is ursolic acid.

Compared with the prior art, the invention has the following beneficial effects:

the alpha-amyrin synthase gene EjAAS1 with expression change in different tissues and obvious positive correlation with the content of triterpenic acid for the first time can be expressed instantly in tobacco leaves, can be used for heterogeneously synthesizing alpha-amyrin in tobacco, and can promote the synthesis of loquat alpha-amyrin and the in vitro biosynthesis of alpha-amyrin and derivatives of ursolic glycoside triterpenic acid. The invention lays a foundation for the application of synthetic biology methods such as gene tandem expression and a biological generator in the research of loquat metabolism, and provides theoretical support for the modification and utilization of functional components.

Drawings

FIG. 1 is an electrophoretogram of EjAAS1 product after PCR amplification. Wherein M is DNA marker (the bands are respectively 5000bp, 3000bp, 2000bp, 1000bp and 800bp from top to bottom); the arrows in lanes A1 and A2 indicate the band as the full-length PCR amplification product of CDS of EjAAS1 gene.

FIG. 2 shows that EjAAS1 clusters with OSC proteins from other plants.

FIG. 3 shows the conserved domains of EjAAS1 and OSC proteins from other plants.

FIG. 4 shows the expression of EjAAS1 gene in different tissues of Eriobotrya japonica and the content of triterpenic acid in each tissue and organ; wherein, the graph A is the comparison of the content of triterpenic acid in different tissues of the loquat; panel B shows the expression pattern of EjAAS11 gene in different tissues.

FIG. 5 is a HPLC peak chart of product detection after transient expression of EjAAS1 in tobacco leaves; wherein, the first peak is a detection graph of a product after EjAAS1 is transiently expressed; the middle peak is an HPLC peak detected under the same conditions by taking 62SK empty carrier as a contrast; the third peak is the standard quality spectrogram of alpha-amyrin and ursolic acid detected under the same condition.

Detailed Description

The invention is described in further detail below with reference to the drawings and specific examples, which are provided for illustration only and are not intended to limit the scope of the invention. The test methods used in the following examples are all conventional methods unless otherwise specified; the materials, reagents and the like used are, unless otherwise specified, commercially available reagents and materials.

Example 1 cloning of cDNA sequence of EjAAS1 Gene of Eriobotrya japonica

First, experiment method

1. Sample collection

Samples of 5 developmental stage leaves of 'early bell 6' loquat were collected from: a 'early-season-6' production tree which is planted in a germplasm resource garden of Eriobotrya in the school of south China agricultural university and is in a full bearing period. Fresh samples were snap frozen in liquid nitrogen and stored in a-80 ℃ freezer.

2. Extraction of RNA

Extracting RNA of the grinded fruit sample by using an EASYspin Plus plant RNA rapid extraction kit (Edley) according to a method of an instruction, wherein the method comprises the following steps: adding 1.0mL of RLT lysate into 1.5mL of a centrifuge tube, adding 100mg of ground fruit sample powder, violently shaking for 20s, and then cracking at 55 ℃ for 20 min; centrifuging the lysate at 13000rpm for 5-10 min; taking the supernatant, transferring the supernatant into a new centrifuge tube, adding absolute ethyl alcohol with half volume of the supernatant, and slightly sucking, beating and uniformly mixing; adding the mixture into RA adsorption column, standing for 30s, and centrifuging at 13000rpm for 2 min; discarding the waste liquid, repeating the previous step, and filtering all the mixtures through an RA adsorption column; discarding the waste liquid, adding 700 μ l deproteinized liquid RW1 into the adsorption column, standing for 1min, and centrifuging at 13000rpm for 30 s; discarding the waste liquid, adding 500 μ l of rinsing liquid RW into the adsorption column, standing for 1min, and centrifuging at 13000rpm for 30 s; discarding the waste liquid, and adding a rinsing liquid RW for one time; discarding the waste liquid, and putting the adsorption column back into the hollow tube for centrifugation at 13000rpm for 2-3 min; taking out the adsorption column, putting the adsorption column into a new RNase free centrifuge tube, adding 30-50 mu l of RNase free water into the middle of an adsorption film, standing at room temperature for 1-2 min, and centrifuging at 12000rpm for 1 min; and sucking the eluted RNA back to the middle of the original adsorption membrane, standing at room temperature for 1-2 min, and centrifuging at 12000rpm for 1min to obtain the RNA.

3. Reverse transcription to synthesize cDNA

After the concentration of the obtained RNA in the different samples was determined, water was added to adjust the concentration to the same concentration, followed by PrimeScript^TMFirst strand cDNA was synthesized using RT reagent Kit with the instructions for the gDNA Eraser reverse transcription system (Takara).

4. Amplification of AAS1 homologous Gene

Calling the full length of the AAS1 homologous gene sequence annotated by the loquat genome, designing a primer, entrusting Shanghai bioengineering Co., Ltd to synthesize a full-length amplification primer pair of the sequence, wherein the nucleotide sequence of the amplification primer pair is shown as SEQ ID NO.3 and SEQ ID NO. 4.

SEQ ID NO. 3: EjAAS1 sequence cloning upstream primer EjAAS1-F

ATGTGGAAGATCAAGTTTGGAGAGG；

SEQ ID NO. 4: EjAAS1 sequence cloning downstream primer EjAAS1-R

TCAAGCGATCTTTTTGATAGGCAACG。

Using 5-stage 'early-clock No. 6' leaf mixed cDNAs as template and high fidelity enzyme

HS DNA Polymerase (Takara Shuzo Co., Ltd.) PCR-amplified the target gene. After the PCR amplification procedure was completed, 0.2. mu.l rTaq polymerase was added to the system and extension was continued at 72 ℃ for 30min to add A tail to the PCR product. After the reaction, the PCR product was electrophoresed through 1.5% agarose gel.

And then connecting the amplified product to a pGEM-T vector (Promega, USA) and transferring the amplified product into escherichia coli competence, and handing the escherichia coli positive clone to a Jinzhi biology company for Sanger sequencing after PCR detection to obtain an accurate target gene sequence.

Second, experimental results

The result shows that the designed primer pair can be amplified to specific 2283bp (the nucleotide sequence is shown as SEQ ID NO.1 and shown in a figure 1) in the corresponding fruit template, and the sequence codes 760 amino acid residues (the amino acid sequence is shown as SEQ ID NO. 2).

MEGA5 software is used for constructing EjAAS1 homologous gene evolutionary tree, and the result shows that the genes are gathered into three major branches; loquat EjAAS1, apple MdOSC1-MdOSC4, Arabidopsis AtBAS and the like are gathered together. EjAAS1 and apple and MdOSC1/3 are gathered in a twig and have a close relationship, the consistency of the coded amino acids with the apple and MdOSC1/3 reaches 98.95 percent and 98.16 percent respectively, and the sequence consistency with Arabidopsis AtBAS is 63.64 percent (figure 2). The conserved domain/motif of the amino acids encoded by these genes was then analyzed by ClustalX software and found that EjAAS1 encodes amino acids that have a conserved DCTAE domain, M (W/Y) CY (C/S) R sequence and 6 QW motifs as do the apple MdOSC1 and other TPS family genes (FIG. 3).

Example 2 comparison of triterpenic acid content in different tissues of Eriobotrya japonica and EjAAS1 expression pattern analysis

First, experiment method

RNA was collected, extracted and cDNA synthesized from each tissue sample of Eriobotrya japonica according to the method of example 1. EjACT was used as an internal reference (forward: CTTTCCCTCTATGCCAGTG and reverse: CAAGGTCAAGCCTCAAGAT) to analyze the expression of EjAAS1 in each tissue and at different developmental stages (quantitative primer set: forward: CAGCTCAAGACAGTACAAATTTAGT; reverse: CAATTGGCCGTTCATT AACAC). Using cDNA at each stage as template, iTaqTM univeral

Green Supermix (Bio-Rad) and the qPCR reaction was performed on a LightCycler 480(Roche) fluorescent quantitative PCR instrument. And amplifying and using EjACT as an internal reference gene for loquat gene expression to carry out gene expression level homogenization. 10.0 mul of the mixed solution is mixed for 60s at 95 ℃; repeating at 95 deg.C for 10s, 60 deg.C for 20s, and 72 deg.C for 15s for 39 times; the dissolution curves were analyzed according to the kit default program. All the above experiments were designed for 3 replicates.

The loquat tissue is dried and weighed, ground into fine powder and sieved by a 100-mesh sieve. Weighing 0.5g of tissue dry powder, adding 20mL of 100% methanol, standing overnight, performing ultrasonic extraction for 60min under the condition of water bath at 40 ℃, filtering,taking the subsequent filtrate, evaporating to dryness by using a rotary evaporation system, dissolving the extract by using 1.0mL of methanol, and filtering the crude body fluid by using a 0.22 micron microporous filter membrane before loading. The triterpenic acid component and content in each sample were tested by an agilent HPLC chromatographic system. The chromatographic column is C₁₈(250X 4.6nm, 3.5 μm); mobile phase: methanol: 0.1% aqueous phosphoric acid 86: 14; the sample volume is 10 mu L; the flow rate is 1 mL/min; the column temperature is 30 ℃; the detection wavelength is 208 nm. Standard substances such as ursolic acid (CAS number: 77-52-1), corosolic acid (4547-24-4), oleanolic acid (CAS number: 508-02-1), and maslinic acid (CAS number: 4373-41-5) were purchased from Sigma-Aldrich; methanol (chromatographically pure) was purchased from Shanghai' an spectra, Inc.

Second, experimental results

The result shows that each tissue of the loquat contains the triterpenic acid, but the accumulation amount in the leaves is far more than that in other tissues; as the leaves grow and mature, the contents of ursolic acid and total triterpenic acid increase continuously (fig. 4A). Consistent with the changes in the content of triterpenic acids, the expression level of EjAAS1 also continued to be up-regulated with the continued growth of leaves, fruits, seeds and other organs, and was much higher in leaves, particularly mature leaves, than in other tissues (fig. 4B). The gene expression is positively correlated with the tissue triterpenic acid content, and the result indicates that EjAAS1 may be directly involved in the synthesis of triterpenic acid.

Example 3 construction of EjAAS1 Gene transient vector and transient transformation of tobacco leaves

First, experiment method

EjAAS1 was subcloned into the 62SK transient expression vector using the primer pair cgctctagaactagtggatcc(BamH I) ATGTGGAAGATCAAGTTTGGAGAGG and gataagcttgatatcgaattc(EcoR I) TCAAGCGATCTTTTTGATAGGCA. The vector construction specifically comprises the following steps: using Gibson

Master Mix and corresponding endonucleases (BamH I and EcoR I, from New England Bio labs) were incubated at 37 ℃ for 1 hour to linearize the 62SK vector. The enzyme digestion product was purified using gel DNA minirecovery kit (magenta). Connecting the purified enzyme cutting product to a target vector by using a Clonexpress one-step directional cloning seamless cloning kit, and reacting the productThis contained 1. mu.l of purified and recovered PCR amplification product, 1. mu.l of linearized vector, 2. mu.l of 5 × CE II buffer, 1. mu.l of Exnase^TMII and 4. mu.l sterile water. After the reaction system reacts for half an hour at 37 ℃, the reaction system is cooled for 5min on ice, then 5 mul of ligation product is taken and transferred into 50 mul of escherichia coli DH5 alpha competent cells, and the 62SK-EjAAS1 recombinant plasmid containing the target fragment is obtained through PCR identification and Sanger sequencing.

The constructed expression vector is transferred into GV3101 agrobacterium and preserved at-80 deg.c with glycerine for further use. Before VIGS treatment, firstly, taking glycerol bacteria to streak and activate on a plate containing antibiotics; adding sterile water to 150mL with 30mL MES (concentration 100mM), 30mL MgCl2 (concentration 100mM), adding 150 μ L acetosyringone (concentration 100mM), mixing to obtain MCLS working solution, and storing in refrigerator at 4 deg.C; inoculating 400-500 μ L of newly activated bacterial liquid into 5-10 mL of YEP liquid culture medium containing 50 μ L Kan and 100mL Rif, shaking for 24h to alternate morning (if activated, the shaking time can be shortened properly), and collecting bacterial liquid A₆₀₀The value is 0.8 to 1.0; taking 2mL of bacterial liquid, and centrifuging at 5000rpm for 10 min; discarding the supernatant, adding 2mL of MCLS working solution into the precipitate, and suspending the thalli; centrifuging at 5000rpm for 10 min; discarding the supernatant, repeating the suspension-centrifugation for 1 time, and adding the suspension into a 10-15 mL test tube; adding working solution to dilute to bacterial solution A₆₀₀The value is about 0.3 (working solution is used as blank control); incubating the diluted bacterial liquid for about 3 hours under the conditions of light resistance and room temperature; about 35 days after sowing (5-6 pieces of true leaves are completely unfolded) Nicotiana benthamiana, the bacterial liquid is injected into the back of the leaves by a 1mL syringe with a pinhead, and the leaves injected with 62SK-Empty bacterial liquid are used as a control. After injection, the tobacco is moved to the condition of low light or complete light shielding at 25 ℃ for pre-culture for 24 hours, and then is transferred to normal illumination culture; after 7 days, the tobacco leaves were collected, snap frozen with liquid nitrogen and stored. Reference example 2 RNA was extracted and reverse-transcribed into cDNA, and gene expression was examined. The other tobacco samples were frozen overnight in a freeze-drying machine at-80 ℃ under 1MPa with the weight of only the leaf blade being balanced, the triterpene acid component in the injection leaf blade was extracted in reference example 2, and the transient expression product of the gene was tested by Agilent high performance liquid chromatography under the same chromatographic conditions. The triterpenic acid component and content in each sample were tested by an agilent HPLC chromatographic system. The chromatographic column is C18 (250X 4.6nm, 3)5 μm); mobile phase: methanol: 0.1% aqueous phosphoric acid 86: 14; the sample volume is 10 mu L; the flow rate is 1 mL/min; the column temperature is 30 ℃; the detection wavelength is 208 nm. Alpha-amyrin standard (CAS number: 638-95-9) was purchased from Sigma-Aldrich.

Second, experimental results

Alpha-amyrin was detected in extracts of tobacco leaves of Bentonia transiently expressed by EjAAS1, whereas alpha-amyrin was not detected in extracts of control leaves treated with empty vector (FIG. 5). The EjAAS1 is proved to be involved in the synthesis of alpha-amyrin, and the synthesis of loquat triterpenic acid can be promoted by up-regulating the expression level.

Sequence listing

<110> southern China university of agriculture

<120> alpha-amyrin synthetase gene EjAAS1 and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2283

<212> DNA

<213> Eriobotrya japonica (Thunb.) Lindl

<400> 1

atgtggaaga tcaagtttgg agagggtgca aatgaccctt tgttgttcag cacaaacaac 60

ttccatggaa ggcagacatg ggagttcgac ccagatgcag gtaccgagga ggagcgagca 120

gaagttgaag cagctcgtga gcatttctac gaaaatcgct tcaaggtcca gcccagcagt 180

gacctcctat ggcgttttca gatactgaga gagaaaaact tcaaacaaga aattcctcca 240

gtaagagttg gggagggtga ggacattaca tatgatcagg ccacagctgc attcaggagg 300

gctgctacct tctggaatgc cttgcaatca ccccacggac attggcctgc tgaaaatgct 360

ggcccaaact tttacttccc tcccttggtc atggctgcat acattccagg atatctcaat 420

gttattttct ccgccgagca caagaaggaa atcttgcgtt acacatacaa ccatcaaaat 480

gaagatggtg gctggggact ccacatagcg gggcctagta tgatgtttac tacatgccta 540

aactactgta tgatgcgtat tctcggagat ggccccgatg gtggtcgtga caatgcctgc 600

gcaagggcac gaaagtggat tcttgaccgt ggtggtgcgt actattctgc atcatgggga 660

aaaacttgga tggcgattct tggtgtgtat gactgggaag gcagcaaccc aatgccccca 720

gaattctgga ctgggtcgac tctgcttcct tttcatccat caaaaatgtt ctgctactgt 780

aggttgactt acctgcctat gtcttacttt tacgccacaa gatttgttgg cccgatcact 840

ccacttgttg aggaattgag acaagaaatt tactgtgaac cttacagcga aattaactgg 900

cctaaagtgc gccattggtg tgcaacagaa gataactact atccccatgg tcgtgtacaa 960

cgttttatgt gggacggttt ttacaatatc gtcgagcctc tcctaaaacg ctggcctttc 1020

aagaaggtca gagacaatgc aattcaattc acaattgacc aaattcatta tgaagatgag 1080

aacagtcgct acattacaat cggatgcgtg gaaaagccat tgatgatgct tgcttgctgg 1140

gccgaggatc ctagtggaga agctttcaag aagcatcttc ctagagttac tgattatatc 1200

tggctcggag aggatggaat caagatgcaa agttttggaa gccagtcatg ggattgtgct 1260

cttgtgattc aagctttgct tgctgggaat cttaatgctg aaatgggacc tacccttaag 1320

aaagcacacg aattcctcaa gatatctcag gtgaggatta atacatccgg tgactaccta 1380

tctcatttcc gtcatatttc aaagggcgca tggacattct ctgaccgtga tcatggatgg 1440

caagtgtcag attgtactgc agaagcactg aggtgttgct gcattttcgc aaatatgtcc 1500

ccagaagttg ttggtgagcc aatggaagct gagcgtatgt atgattctgt caatgtcatc 1560

atgtctcttc aaagtccaaa tggtggtgta tcagcctggg agccaacagg agcaccaaaa 1620

tggttggagt ggctcaaccc tgtggaattt cttgaggacc ttgtcattga gtacgagtac 1680

atcgagtgca cttcatcttc gatccaggcc ttaacattgt ttaggaagtt gtaccctggc 1740

catagaagga aggagatcaa caatttcatc acaagggctg cagactacat tgaagacata 1800

cagtaccctg acggctcatg gtatggaaac tggggaatct gcttcgtgta tggttcatgg 1860

ttcgcaatca aagggctgga ggctgccggc aggacataca acaactgcga ggcagtgcgc 1920

aaaggtgtcg actttttgct caaaacgcaa agggcagatg gtggctgggg agagcactac 1980

acctcatgca caaacaagaa atatacagct caagacagta caaatttagt ccaaactgca 2040

ctcggattaa tgggtctgat tcacggtcga caggctgaga gagatccaac tcctattcac 2100

cgggctgctg cggtgttaat gaacggccaa ttggatgacg gcgatttccc ccaacaggaa 2160

ctgatgggag tctttatgag gaatgctatg ttgcactatg cagcatacag aaatatcttc 2220

ccattgtggg ctctcggaga ataccgcaca ctggtttcgt tgcctatcaa aaagatcgct 2280

tga 2283

<210> 2

<211> 760

<212> PRT

<213> Eriobotrya japonica (Thunb.) Lindl

<400> 2

Met Trp Lys Ile Lys Phe Gly Glu Gly Ala Asn Asp Pro Leu Leu Phe

1 5 10 15

Ser Thr Asn Asn Phe His Gly Arg Gln Thr Trp Glu Phe Asp Pro Asp

20 25 30

Ala Gly Thr Glu Glu Glu Arg Ala Glu Val Glu Ala Ala Arg Glu His

35 40 45

Phe Tyr Glu Asn Arg Phe Lys Val Gln Pro Ser Ser Asp Leu Leu Trp

50 55 60

Arg Phe Gln Ile Leu Arg Glu Lys Asn Phe Lys Gln Glu Ile Pro Pro

65 70 75 80

Val Arg Val Gly Glu Gly Glu Asp Ile Thr Tyr Asp Gln Ala Thr Ala

85 90 95

Ala Phe Arg Arg Ala Ala Thr Phe Trp Asn Ala Leu Gln Ser Pro His

100 105 110

Gly His Trp Pro Ala Glu Asn Ala Gly Pro Asn Phe Tyr Phe Pro Pro

115 120 125

Leu Val Met Ala Ala Tyr Ile Pro Gly Tyr Leu Asn Val Ile Phe Ser

130 135 140

Ala Glu His Lys Lys Glu Ile Leu Arg Tyr Thr Tyr Asn His Gln Asn

145 150 155 160

Glu Asp Gly Gly Trp Gly Leu His Ile Ala Gly Pro Ser Met Met Phe

165 170 175

Thr Thr Cys Leu Asn Tyr Cys Met Met Arg Ile Leu Gly Asp Gly Pro

180 185 190

Asp Gly Gly Arg Asp Asn Ala Cys Ala Arg Ala Arg Lys Trp Ile Leu

195 200 205

Asp Arg Gly Gly Ala Tyr Tyr Ser Ala Ser Trp Gly Lys Thr Trp Met

210 215 220

Ala Ile Leu Gly Val Tyr Asp Trp Glu Gly Ser Asn Pro Met Pro Pro

225 230 235 240

Glu Phe Trp Thr Gly Ser Thr Leu Leu Pro Phe His Pro Ser Lys Met

245 250 255

Phe Cys Tyr Cys Arg Leu Thr Tyr Leu Pro Met Ser Tyr Phe Tyr Ala

260 265 270

Thr Arg Phe Val Gly Pro Ile Thr Pro Leu Val Glu Glu Leu Arg Gln

275 280 285

Glu Ile Tyr Cys Glu Pro Tyr Ser Glu Ile Asn Trp Pro Lys Val Arg

290 295 300

His Trp Cys Ala Thr Glu Asp Asn Tyr Tyr Pro His Gly Arg Val Gln

305 310 315 320

Arg Phe Met Trp Asp Gly Phe Tyr Asn Ile Val Glu Pro Leu Leu Lys

325 330 335

Arg Trp Pro Phe Lys Lys Val Arg Asp Asn Ala Ile Gln Phe Thr Ile

340 345 350

Asp Gln Ile His Tyr Glu Asp Glu Asn Ser Arg Tyr Ile Thr Ile Gly

355 360 365

Cys Val Glu Lys Pro Leu Met Met Leu Ala Cys Trp Ala Glu Asp Pro

370 375 380

Ser Gly Glu Ala Phe Lys Lys His Leu Pro Arg Val Thr Asp Tyr Ile

385 390 395 400

Trp Leu Gly Glu Asp Gly Ile Lys Met Gln Ser Phe Gly Ser Gln Ser

405 410 415

Trp Asp Cys Ala Leu Val Ile Gln Ala Leu Leu Ala Gly Asn Leu Asn

420 425 430

Ala Glu Met Gly Pro Thr Leu Lys Lys Ala His Glu Phe Leu Lys Ile

435 440 445

Ser Gln Val Arg Ile Asn Thr Ser Gly Asp Tyr Leu Ser His Phe Arg

450 455 460

His Ile Ser Lys Gly Ala Trp Thr Phe Ser Asp Arg Asp His Gly Trp

465 470 475 480

Gln Val Ser Asp Cys Thr Ala Glu Ala Leu Arg Cys Cys Cys Ile Phe

485 490 495

Ala Asn Met Ser Pro Glu Val Val Gly Glu Pro Met Glu Ala Glu Arg

500 505 510

Met Tyr Asp Ser Val Asn Val Ile Met Ser Leu Gln Ser Pro Asn Gly

515 520 525

Gly Val Ser Ala Trp Glu Pro Thr Gly Ala Pro Lys Trp Leu Glu Trp

530 535 540

Leu Asn Pro Val Glu Phe Leu Glu Asp Leu Val Ile Glu Tyr Glu Tyr

545 550 555 560

Ile Glu Cys Thr Ser Ser Ser Ile Gln Ala Leu Thr Leu Phe Arg Lys

565 570 575

Leu Tyr Pro Gly His Arg Arg Lys Glu Ile Asn Asn Phe Ile Thr Arg

580 585 590

Ala Ala Asp Tyr Ile Glu Asp Ile Gln Tyr Pro Asp Gly Ser Trp Tyr

595 600 605

Gly Asn Trp Gly Ile Cys Phe Val Tyr Gly Ser Trp Phe Ala Ile Lys

610 615 620

Gly Leu Glu Ala Ala Gly Arg Thr Tyr Asn Asn Cys Glu Ala Val Arg

625 630 635 640

Lys Gly Val Asp Phe Leu Leu Lys Thr Gln Arg Ala Asp Gly Gly Trp

645 650 655

Gly Glu His Tyr Thr Ser Cys Thr Asn Lys Lys Tyr Thr Ala Gln Asp

660 665 670

Ser Thr Asn Leu Val Gln Thr Ala Leu Gly Leu Met Gly Leu Ile His

675 680 685

Gly Arg Gln Ala Glu Arg Asp Pro Thr Pro Ile His Arg Ala Ala Ala

690 695 700

Val Leu Met Asn Gly Gln Leu Asp Asp Gly Asp Phe Pro Gln Gln Glu

705 710 715 720

Leu Met Gly Val Phe Met Arg Asn Ala Met Leu His Tyr Ala Ala Tyr

725 730 735

Arg Asn Ile Phe Pro Leu Trp Ala Leu Gly Glu Tyr Arg Thr Leu Val

740 745 750

Ser Leu Pro Ile Lys Lys Ile Ala

755 760

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

atgtggaaga tcaagtttgg agagg 25

<210> 4

<211> 26

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

tcaagcgatc tttttgatag gcaacg 26

Claims (8)

1. The application of the coding gene with the nucleotide sequence shown as SEQ ID NO.1 as loquat alpha-amyrin synthetase gene.

2. The protein with amino acid sequence shown as SEQ ID NO.2 is used as loquat alpha-amyrin synthetase.

3. A recombinant vector comprising the coding gene of claim 1 linked thereto.

4. An engineered bacterium carrying the recombinant vector of claim 3.

5. Use of any one of the encoding gene of claim 1, the protein of claim 2, the recombinant vector of claim 3, or the engineered bacterium of claim 4 for up-regulating the synthesis of loquat α -amyrin.

6. Use of any one of the coding gene of claim 1, the protein of claim 2, the recombinant vector of claim 3, or the engineered bacterium of claim 4 in the in vitro synthesis of α -amyrin.

7. The use of any one of the coding gene of claim 1, the protein of claim 2, the recombinant vector of claim 3, or the engineered bacterium of claim 4 for promoting the synthesis of triterpenic acid from loquat uridine.

8. The use according to claim 7, wherein said triterpene acid is ursolic acid.

Images