CN110938124B - Application of arabidopsis KIX8 and KIX9 genes in seed size regulation - Google Patents
Application of arabidopsis KIX8 and KIX9 genes in seed size regulation Download PDFInfo
- Publication number
- CN110938124B CN110938124B CN201911292135.9A CN201911292135A CN110938124B CN 110938124 B CN110938124 B CN 110938124B CN 201911292135 A CN201911292135 A CN 201911292135A CN 110938124 B CN110938124 B CN 110938124B
- Authority
- CN
- China
- Prior art keywords
- kix8
- kix9
- glu
- sequence
- ser
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention discloses application of arabidopsis KIX8 and/or KIX9 genes in regulating and controlling seed size. The invention provides an application of any one of the following substances 1) to 3) in regulating and controlling the size of plant seeds; 1) protein KIX8 and/or KIX 9; 2) nucleic acid molecules encoding proteins KIX8 and/or KIX 9; 3) a recombinant vector, expression cassette or recombinant bacterium comprising a nucleic acid molecule encoding protein KIX8 and/or KIX 9; the experiment of the invention proves that the Arabidopsis KIX8 and/or KIX9 gene has an important regulation effect on seed size, a KIX8 and/or KIX9 gene function deletion mutant can produce large seeds, a plant (35S: Myc-KIX8 or KIX9) with over-expression KIX8 and/or KIX9 gene can produce small seeds, and the gene can be used for regulating and controlling the seed yield of plants and has important revelation significance for plant breeding.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to application of arabidopsis KIX8 and KIX9 genes in seed size regulation.
Background
Human staple foods are derived mainly from the seeds of crops, such as rice and wheat. The yield of rice and wheat is determined to have three elements: spike number, grain weight and tiller number. Seed grain weight is closely related to seed size, and thus seed size is an important agronomic trait and also an important factor in determining seed yield of plants. With the rapid growth of the population, the continuous reduction of the per capita cultivated land area and the influence of global climate change on the environment, the shortage of human food is caused, and how to increase the human food becomes a major problem to be solved urgently, so that the mining of genes influencing the size of plant seeds, the development of high-yield gene resources and the improvement of food yield have very important values for ensuring the food safety in China.
Most diploid plant seeds consist of three parts, the seed coat, the endosperm and the embryo. The endosperm and embryo develop from the zygote after fertilization, while the seed coat develops from the maternal component, so the final seed size is synergistically regulated by the maternal and zygote components. Several signaling pathways affecting plant seed maternal and zygotic components have been reported, including: ubiquitinated protein pathways such as AtDA1, AtSAMBA, OsGW2, OsWTG1 genes, and the like; g protein pathway such as OsRGB1, GS3, OsMADS1 and OsRGA1 gene, etc.; MAPK pathway (mitogen-activated protein kinase (MAPK) signaling), such as osmkkkk 10, OsMKK4, OsMAPK6, and OsMKP1 genes, and the like; plant hormone pathways such as OsGSK2, OsGSE5, OsBG1 and OsARF4 genes, etc.; transcription factor regulatory pathways such as OsGRF4, OsGW6, AtAP2 and MtBS1 genes, and the like. However, the process of seed development is complex and the molecular mechanisms that ultimately determine seed size are still unclear. Further digging genes influencing the size of the plant seeds, has important significance for further understanding the development process of the plant seeds and improving the crop yield for human beings.
Disclosure of Invention
An object of the present invention is to provide the use of protein KIX8 and/or KIX9 and related biomaterials for regulating plant seed size.
The invention provides an application of any one of the following substances 1) to 3) in regulating and controlling the size of plant seeds;
1) protein KIX8 and/or KIX 9;
2) nucleic acid molecules encoding proteins KIX8 and/or KIX 9;
3) a recombinant vector, expression cassette or recombinant bacterium comprising a nucleic acid molecule encoding protein KIX8 and/or KIX 9;
the protein KIX8 is as follows (1), (2) or (3):
(1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;
(2) a protein formed by adding a tag sequence at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;
(3) protein which is derived from (1) or (2) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table;
the protein KIX9 is as follows (4), (5) or (6):
(4) a protein consisting of an amino acid sequence shown in a sequence 4 in a sequence table;
(5) protein formed by adding a tag sequence to the tail end of an amino acid sequence shown in a sequence 4 in a sequence table;
(6) and (b) protein which is derived from the protein (4) or (5) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 4 in the sequence table.
In the above, the substitution and/or deletion and/or addition of one or several amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.
The labels are specifically shown in table 1.
TABLE 1 sequences of tags
| Label (R) | Residue of | Sequence of |
| Poly-Arg | 5-6 (typically 5) | RRRRR |
| Poly-His | 2-10 (generally 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
| HA | 9 | YPYDVPDYA |
In the embodiment of the invention, the tag sequence is a Myc sequence, and in the application, the amino acid sequence of the protein KIX8 shown in (2) is the sequence 7; (5) the amino acid sequence of the protein KIX8 is shown as sequence 8.
In the above application, the nucleic acid molecule encoding the protein KIX8 is a DNA molecule of any one of the following 1) to 4):
1) the coding region is a DNA molecule shown as a sequence 1 in a sequence table;
2) the coding region is a DNA molecule shown as a sequence 5 in a sequence table;
3) DNA molecules which hybridize under stringent conditions with the DNA sequences defined in 1) or 2) and which code for proteins having the same function;
4) a DNA molecule having at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to the DNA sequence defined in 1) or 2) and encoding a protein having the same function;
the nucleic acid molecule encoding the protein KIX9 is a DNA molecule of any one of the following 5) to 8):
5) the coding region is a DNA molecule shown as a sequence 3 in a sequence table;
6) the coding region is a DNA molecule shown as a sequence 6 in a sequence table;
7) DNA molecules which hybridize under stringent conditions with the DNA sequences defined in 5) or 6) and which code for proteins having the same function;
8) DNA molecules which have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology with the DNA sequences defined in 5) or 6) and which code for proteins having the same function.
The stringent conditions may be hybridization with a solution of 6 XSSC, 0.5% SDS at 65 ℃ followed by washing the membrane once with each of 2 XSSC, 0.1% SDS and 1 XSSC, 0.1% SDS.
In the above application, the regulating and controlling of the size of the plant seed is to reduce the size of the plant seed.
The use of the above substances for growing plants with reduced seed size or small seed plants is also within the scope of the present invention.
The use of a substance that reduces the content and/or activity of protein KIX8 and/or KIX9 in a plant, or a substance that reduces the expression of a nucleic acid molecule encoding protein KIX8 and/or KIX9 in a plant for growing plants with increased seed size or large seed plants is also within the scope of the present invention.
It is another object of the present invention to provide a method for breeding transgenic plants with reduced seed size.
The method provided by the invention is 1) or 2):
1) the method comprises the following steps: increasing the content and/or activity of protein KIX8 and/or KIX9 in a target plant to obtain a transgenic plant;
2) the method comprises the following steps: increasing expression of a nucleic acid molecule encoding protein KIX8 and/or KIX9 in a plant of interest to obtain a transgenic plant;
the transgenic plant has smaller seeds than the target plant;
the protein KIX8 is as follows (1), (2) or (3):
(1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;
(2) a protein formed by adding a tag sequence at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;
(3) protein which is derived from (1) or (2) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table;
the protein KIX9 is as follows (4), (5) or (6):
(4) a protein consisting of an amino acid sequence shown in a sequence 4 in a sequence table;
(5) protein formed by adding a tag sequence to the tail end of an amino acid sequence shown in a sequence 4 in a sequence table;
(6) and (b) protein which is derived from the protein (4) or (5) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 4 in the sequence table.
In the above method, the increasing of the content and/or activity of the protein KIX8 and/or KIX9 in the plant of interest, or the increasing of the expression of the nucleic acid molecule encoding the protein KIX8 and/or KIX9 in the plant of interest is performed by introducing the nucleic acid molecule encoding the protein KIX8 and/or KIX9 into the plant of interest. In particular by a recombinant vector comprising a nucleic acid molecule encoding protein KIX8 and/or a recombinant vector comprising a nucleic acid molecule encoding protein KIX9,
the recombinant vector containing the nucleic acid molecule of the encoded protein KIX8 is pCAMBIA1300-221-Myc-KIX8, the recombinant vector expresses Myc-KIX8 fusion protein, the amino acid sequence of the fusion protein is shown in a sequence 7, and the 1 st to 73 th sites are Myc label sequences (on a vector framework); KIX8 at positions 74-416.
The recombinant vector containing the nucleic acid molecule of the encoded protein KIX9 is pCAMBIA1300-221-Myc-KIX9, the recombinant vector pCAMBIA1300-221-Myc-KIX9 expresses Myc-KIX9 fusion protein, the amino acid sequence of the fusion protein is shown in a sequence 8, and the 1 st to 73 th sites are Myc tag sequences; KIX9 at positions 74-311.
The 3 rd object of the present invention is to provide a method for cultivating a plant of interest having an increased seed size.
The method provided by the invention is 3) or 4):
3) the method comprises the following steps: reducing the content and/or activity of protein KIX8 and/or KIX9 in a recipient plant to obtain a target plant;
4) the method comprises the following steps: reducing expression of a nucleic acid molecule encoding protein KIX8 and/or KIX9 in a recipient plant to obtain a plant of interest;
the seeds of the target plant are larger than the recipient plant;
the protein KIX8 is as follows (1), (2) or (3):
(1) a protein consisting of an amino acid sequence shown in a sequence 2 in a sequence table;
(2) a protein formed by adding a tag sequence at the tail end of an amino acid sequence shown in a sequence 2 in a sequence table;
(3) protein which is derived from (1) or (2) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 2 in the sequence table;
the protein KIX9 is as follows (4), (5) or (6):
(4) a protein consisting of an amino acid sequence shown in a sequence 4 in a sequence table;
(5) protein formed by adding a tag sequence to the tail end of an amino acid sequence shown in a sequence 4 in a sequence table;
(6) and (b) protein which is derived from the protein (4) or (5) and has the same function and is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 4 in the sequence table.
In the method of the present object, the recipient plant is wild type Arabidopsis thaliana and the object plant is mutant kix8-1, kix9-1 or kix8-1 kix 9-1.
In the above, the plant is a dicotyledonous plant or a monocotyledonous plant.
Experiments of the invention prove that Arabidopsis genes KIX8 and KIX9 have an important regulation effect on seed size, small seeds are generated by KIX8 gene soma variant kix8-1(GABI _422H04) and kix8-1 kix9-1 double-outburst variant, and big seeds can be generated by over-expression KIX8 gene plants (35S: Myc-KIX8) and over-expression KIX9 gene plants (35S: Myc-KIX9), and the genes can be used for regulating and controlling the yield of plant seeds and have important revelation on plant breeding.
Drawings
FIG. 1 is T3Analysis of KIX8 gene expression level in Myc-KIX8 plant (n-3); analysis of day 9T by qPCR3Generation 35S, expression quantity of KIX8 gene in Myc-KIX8 plant; the ACTIN2 gene was used for data correction; error is representative of standard error; represents a significant difference compared to wild type plant values; one-way ANOVA P-values for significant Difference analysis<0.01。
FIG. 2 is T3Generation 35S-K in Myc-KIX9 plantAnalysis of expression level of IX9 gene (n ═ 3); analysis of day 9T by qPCR3Generation 35S, expression quantity of KIX9 gene in Myc-KIX9 plant; the ACTIN2 gene was used for data correction; error is representative of standard error; represents a significant difference compared to wild type plant values; one-way ANOVA P-values for significant Difference analysis<0.01。
FIG. 3 shows the expression level analysis of KIX8 gene in kix8-1 plants (n-3); analyzing the expression quantity of KIX8 genes in kix8-1 plants on day 9 by a qPCR method; the ACTIN2 gene was used for data correction; error is representative of standard error; represents a significant difference compared to wild type plant values; one-way ANOVA P-values were used for significant difference analysis: < 0.01.
FIG. 4 shows the expression level analysis of KIX9 gene in kix9-1 plants (n-3); analyzing the expression quantity of KIX9 genes in kix9-1 plants on day 9 by a qPCR method; the ACTIN2 gene was used for data correction; error is representative of standard error; represents a significant difference compared to wild type plant values; one-way ANOVA P-values were used for significant difference analysis: < 0.01.
FIG. 5 is a photograph of seeds of wild type plants (Col-0), kix8-1, kix8-1 kix9-1, 35S: Myc-KIX8 and 35S: Myc-KIX9, at a scale bar of 0.5 mm.
FIG. 6 is the seed size (n 100) of wild type plants (Col-0), kix8-1, kix8-1 kix9-1, 35S: Myc-KIX8 and 35S: Myc-KIX 9; error is representative of standard error; represents a significant difference compared to wild type plant values; one-way ANOVA P-values were used for significant difference analysis.P <0.05 and P < 0.01.
Detailed Description
The experimental procedures used in the following examples are all conventional procedures unless otherwise specified.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
In the following examples, all m/v are g: mL unless otherwise specified.
KIX8 Genome variant kix8-1 was purchased from NASC (Nottingham Arabidopsis Stock centre) seed center under catalog number GABI _422H 04;
KIX9 Genome variant kix9-1 was purchased from ABRC (Arabidopsis Biological Resource centre) seed center under catalog number SAIL _1168_ G09;
kix8-1 kix9-1 ditubulin variant, awarded by Leyun researchers' theme, institute of genetics and developmental biology, academy of Chinese sciences, which is described in: li, n., Liu, z., Wang, z., Ru, l., Gonzalez, n., Baekelandt, a, Pauwels, l., Goossens, a, Xu, r., Zhu, z., Inze, d., Li, Y. (2018), STERILE APETALA models the stability of a depressing protein complex to control organ size in Arabidopsis thaliana plos gene t.14, e 1007218.
Wild type Arabidopsis thaliana Col-0 is described in the following documents: li, n., Liu, z., Wang, z., Ru, l., Gonzalez, n., Baekelandt, a, Pauwels, l., Goossens, a, Xu, r., Zhu, z., Inze, d., Li, Y. (2018), STERILE APETALA models the stability of a depressing protein complex to control organ size in Arabidopsis thaliana plos gene t.14, e 1007218.
KIX8 genome variant kix8-1(GABI _422H04) and wild type Arabidopsis thaliana Col-0 have only KIX8 gene with T-DNA insertion mutation, and the rest of the genes are identical.
KIX9 genome variant kix9-1(SAIL _1168_ G09) and wild type Arabidopsis thaliana Col-0 have only KIX9 gene with T-DNA insertion mutation, and the rest genes are identical.
KIX8 gene has the nucleotide sequence as sequence 1 in the sequence list, and the coded protein KIX8 has the amino acid sequence as sequence 2 in the sequence list.
KIX9 gene has the nucleotide sequence as sequence 3 in the sequence table, and the coded protein KIX9 has the amino acid sequence as sequence 4 in the sequence table.
Example 1 application of Arabidopsis KIX8 and KIX9 genes to regulation of plant seed size
Preparation of over-expressed KIX8 gene Arabidopsis thaliana and over-expressed KIX9 gene Arabidopsis thaliana
1. Amplification of KIX8 Gene and KIX9 Gene
Taking a wild arabidopsis Col-0 seedling growing for 9 days on 1/2MS culture medium as a material, and extracting total RNA in the seedling by using a plant total RNA extraction kit (TIANGEN, DP 432); synthesizing a cDNA sequence by using an lnRcute lncRNACUDNA first strand synthesis kit (TIANGEN, KR202) by taking the total RNA as a template; the cDNA is used as a template, and sequences of V6-KIX8F and V6-KIX8R are used as primers to carry out PCR amplification, so that a PCR amplification product V6-KIX8 with the length of 1074bp is obtained.
The nucleotide sequence of the PCR product is sequence 5 after sequencing.
In the sequence 5, the 22 th-1053 th site is KIX8 gene, the 1 st-21 st site is pCAMBIA1300-221-Myc plasmid adaptor sequence, and the 1054 th site is pCAMBIA1300-221-Myc plasmid adaptor sequence.
Taking a wild arabidopsis Col-0 seedling growing for 9 days on 1/2MS culture medium as a material, and extracting total RNA in the seedling by using a plant total RNA extraction kit (TIANGEN, DP 432); synthesizing a cDNA sequence by using an lnRcute lncRNA cDNA first strand synthesis kit (TIANGEN, KR202) by taking the total RNA as a template; the cDNA is used as a template, and sequences of V6-KIX9F and V6-KIX9R are used as primers to carry out PCR amplification to obtain 759bp PCR amplification product V6-KIX 9.
The nucleotide sequence of the PCR product is sequence 6 after sequencing.
In the sequence 6, the 22 th to 738 th genes are KIX9 th genes, the 1 st to 21 st sites are pCAMBIA1300-221-Myc plasmid adaptor sequences, and the 739 st sites and 759 th sites are pCAMBIA1300-221-Myc plasmid adaptor sequences. .
Primer name sequence
V6-KIX8F：
GAGGACTTGAATTCGGTACCCATGCCGAGGCCAGGACCAAGAC
V6-KIX8R：
CGATTTCGAACCCGGGGTACCCTAAAGGAAGTCTCCACACAAA
V6-KIX9F：
GAGGACTTGAATTCGGTACCCATGCCGAGGCCAGGGCCAAGAC
V6-KIX9R：
CGATTTCGAACCCGGGGTACCTCAGTTGTTATTGTTGCTGCTT
2. Construction of recombinant plasmid
The pCAMBIA1300-221-Myc plasmid (Liu, Z., Chen, G., Gao, F., Xu, R., Li, N., Zhang, Y.and Li, Y. (2019). transactional expression of the APC/C activities CCS52A1/A2 by the media complex subplasmid MED16 control end expression and growth in Arabidopsis Cell 31 (1899-1912)) was digested with Kpn I restriction enzymes, and the digested products were recovered by gel to give a linearized pCAMBIA1300-221-Myc plasmid.
The amplification products V6-KIX8 and V6-KIX9 obtained in the above step 1 were respectively ligated with the linearized pCAMBIA1300-221-Myc plasmid using a homologous recombination kit (Beijing Bomaide Gene technology Co., Ltd., product No. CL116-01) to obtain recombinant vectors pCAMBIA1300-221-Myc-KIX8 and pCAMBIA1300-221-My-KIX 9.
The recombinant vector pCAMBIA1300-221-Myc-KIX8 expresses Myc-KIX8 fusion protein, the amino acid sequence of the fusion protein is shown in a sequence 7, and the 1 st to 73 th sites are Myc label sequences (on a vector framework); KIX8 at positions 74-416.
The recombinant vector pCAMBIA1300-221-Myc-KIX9 expresses Myc-KIX9 fusion protein, the amino acid sequence of the fusion protein is shown in a sequence 8, and the 1 st to 73 th sites are Myc label sequences; KIX9 at positions 74-311.
3. Preparation of recombinant bacterium
The recombinant vectors pCAMBIA1300-221-Myc-KIX8 and pCAMBIA1300-221-My-KIX9 prepared above are respectively transferred into a GV3101 agrobacterium-sensitive state, and are screened by a solid LB culture medium containing 50 mu g/mL kanamycin, 10 mu g/mL rifampicin and 40 mu g/mL gentamicin to respectively obtain a recombinant bacterium 1 and a recombinant bacterium 2.
The recombinant bacterium 1 is identified by PCR, and amplified by V6-KIX8F and V6-KIX8R to obtain a 1074bp fragment which is a positive recombinant bacterium GV3101/pCAMBIA1300-221-Myc-KIX 8.
The recombinant bacterium 2 is identified by PCR, and V6-KIX9F and V6-KIX9R are amplified to obtain 759bp which is a positive recombinant bacterium GV3101/pCAMBIA1300-221-Myc-KIX 9.
4. 35S Myc-KIX8 and 35S Myc-KIX9 plant creation process
Positive recombinant bacteria GV3101/pCAMBIA1300-221-Myc-KIX8 and GV3101/pCAMBIA1300-221-Myc-KIX9 were mixed with transformation solution (0.22% (m/v) MS, 0.5% (m/v) MES, 5% (m/v) Sucrose, 40ul/100ml Silwett L-77, water as solvent) to make the concentration of the bacterial solution OD6000.6; then infecting wild type Arabidopsis (Col-0) with the transformation solution containing the target bacteria for 5 weeksInflorescence (Zhang, X., Henriques, R., Lin, S.S., Niu, Q.W., and Chua, N.H. (2006.) Agrobacterium-mediated transformation of Arabidopsis thaliana using the floral dip method. Nat. Protoc.1: 641-646.) is collected after seed maturation1And (5) seed generation.
Transferring T of pCAMBIA1300-221-Myc-KIX8 vector1The seeds are sowed in 1/2MS culture medium containing hygromycin of 30 mug/mL for screening, and the positive seedling is named as T1Transfer KIX8 Arabidopsis (35S: Myc-KIX 8); transferring T of pCAMBIA1300-221-Myc-KIX9 vector1The seeds are sowed in 1/2MS culture medium containing hygromycin of 30 mug/mL for screening, and the positive seedling is named as T1KIX9 Arabidopsis thaliana (35S: Myc-KIX9) was transgenic.
Cultivating each strain to obtain T3And (5) plant generation.
5. Analysis of target gene expression in transgenic plant
T growth on 1/2MS Medium for 9 days 335S, Myc-KIX8, T 335S, Myc-KIX9 and Col-0 seedlings are taken as materials, and total RNA in the seedlings is extracted by a total RNA extraction kit (TIANGEN, DP 432); the total RNA is used as a template, KIX8-qF/KIX8-qR, KIX9-qF/KIX9-qR and ACTIN2-qF/ACTIN2-qR sequences are used as primers, a Quant one step qRT-PCR kit (TIANGEN, FP303) is used for carrying out qPCR analysis on the RNA expression quantity of KIX8 and KIX9 genes, and the experiment is repeated for 3 times.
Primer:
KIX8-qF：AATAGTGAAGGTCAGAATTC
KIX8-qR：CTAAAGGAAGTCTCCACACA
KIX9-qF：TGGTGGGTGTGAATGTGATC
KIX9-qR：TCAGTTGTTATTGTTGCTGC
ACTIN2-qF:GAAATCACAGCACTTGCACC
ACTIN2-qR:AAGCCTTTGATCTTGAGAGC
T3FIG. 1 shows the results for the generation 35S Myc-KIX8, T3The RNA expression level of KIX8 in the generation 35S Myc-KIX8 seedling is obviously higher than that of Col-0 seedling, thereby indicating that T3Generation 35S, Myc-KIX8 plant is an over-expression plant of KIX8 gene;
T3FIG. 2 shows the results of generation 35S Myc-KIX9, T3The RNA expression level of KIX9 in the generation 35S Myc-KIX9 seedling is obviously higher than that of Col-0 seedling, thereby indicating that T3Generation 35S Myc-KIX9 plant is an over-expression plant of KIX9 gene.
6. Analysis of expression level of target Gene in mutant
Using kix8-1, kix9-1 and Col-0 seedlings growing for 9 days on 1/2MS culture medium as materials, extracting total RNA in the seedlings by using a total RNA extraction kit (TIANGEN, DP 432); the total RNA is used as a template, KIX8-qF/KIX8-qR, KIX9-qF/KIX9-qR and ACTIN2-qF/ACTIN2-qR sequences are used as primers, a Quant one step qRT-PCR kit (TIANGEN, FP303) is used for carrying out qPCR analysis on the RNA expression quantity of KIX8 and KIX9 genes, and the experiment is repeated for 3 times.
Primer:
KIX8-qF：AATAGTGAAGGTCAGAATTC
KIX8-qR：CTAAAGGAAGTCTCCACACA
KIX9-qF：TGGTGGGTGTGAATGTGATC
KIX9-qR：TCAGTTGTTATTGTTGCTGC
ACTIN2-qF:GAAATCACAGCACTTGCACC
ACTIN2-qR:AAGCCTTTGATCTTGAGAGC
kix8-1 results are shown in FIG. 3, the RNA expression level of KIX8 in kix8-1 seedlings is almost zero, which indicates that kix8-1 mutant is KIX8 gene function complete loss mutant;
kix9-1 results are shown in FIG. 4, the RNA expression level of KIX9 in kix9-1 seedlings is almost zero, which indicates that kix9-1 mutant is KIX9 gene function complete loss mutant.
kix8-1 kix9-1 is mutant with complete loss of KIX8 gene and KIX9 gene.
II, overexpression of phenotypes of transgenic Arabidopsis thaliana and mutants
Will T3KIX8 Arabidopsis thaliana (35S: Myc-KIX8) and T3KIX9 Arabidopsis thaliana (35S: Myc-KIX9), KIX8 genome variant kix8-1, kix8-1 kix9-1 double-outburst variant and wild type Arabidopsis thaliana Col-0 seeds were sown. After the seeds are mature, collecting the seeds of the 3 rd to 7 th siliques on the main stem, and mixing. After the seeds were photographed with a 2-fold magnification scope (Leica, DM2500), each grain was measured with Image J softwareSeed area (surface area, setting 1116 pixels to 0.5 cm). 100 seeds per line were used for measurement, the experiment was repeated 3 times, and the average value was used for comparative analysis.
The results of photographing seeds with a camera are shown in FIG. 5, and the seeds of the KIX8 genome variants kix8-1 and kix8-1 kix9-1 double-process variant were larger than the seeds of the wild type Arabidopsis thaliana Col-0; t is3Transformation of KIX8 Arabidopsis thaliana and T3The generation-transferred KIX9 Arabidopsis seeds are all smaller than the seeds of the wild Arabidopsis Col-0.
The results of the seed area detection are shown in FIG. 6, and the relative seed areas of the KIX8 genome variants kix8-1 and kix8-1 kix9-1 double-spike variant are larger than the corresponding values of wild type Arabidopsis thaliana Col-0; t is3Transformation of KIX8 Arabidopsis thaliana and T3The relative areas of the seeds of the transgenic KIX9 Arabidopsis are smaller than the corresponding values of the wild Arabidopsis Col-0.
The above results indicate that overexpression of KIX9 or KIX8 gene can reduce seed size (area) and suppression of KIX9 and/or KIX8 gene expression can increase seed size (area).
SEQUENCE LISTING
<110> institute of genetics and developmental biology of Chinese academy of sciences
<120> application of Arabidopsis KIX8 and KIX9 genes in seed size regulation
<160> 8
<170> PatentIn version 3.5
<210> 1
<211> 1032
<212> DNA
<213> Arabidopsis thaliana (Arabidopsis thaliana)
<400> 1
atgccgaggc caggaccaag accttacgag tgtgtgaaac gagcttggca tagcgatcgt 60
catcaaccta ttcgtggttc gattattcgc cagattttca gactcgcaat ggaagcacat 120
agcgcagcga cgaggaagaa caaagaatgg caggagaaat tgcctgtggt tgtgttaaaa 180
gctgaagaaa tcatgtactc taaagccaat tccgaggaag agtatacaga tgctgatact 240
atgtggaata gagtaaatga tgccattgat acaattatta gaagagatga gagtacagaa 300
actggtcctc ttttgcctcc atgtgttgaa gctgctctta atttgggatg tattgctgta 360
agagcttcaa gaagccaacg acatagtagc ggaaggactt acctcggtcc taaaattcag 420
gaaccggttt ctgcgtcgac taatgagccg tcttaccatc atgaatatcg tcagcaagct 480
caacaatcat caaccaaacc aagccagaca gttcaagctg cagtccctgt tgatgtactt 540
gataacagca acaagcgtgt agctactcct cgcggttacc cgtttcttca tgaatccatg 600
cagatgcatc aaaagccatt ggcaattaga caaggaactg gtcctgcttc tgctcctgct 660
ccagctccag tcaacttggg ttcggtctat cctttgtatt acgaaggtaa taatcaaacg 720
cagcaagctg acatgtcttt tagagtccct gaagcgccca taatcattgg catgcctatt 780
ggtataaagc cctcagaaga agcaactgag agggtctgtg atttatcctt gaggctcggt 840
atatcttcag aaccgtctac aagaatagat gtcgggtcta gtcgggctta cccgggaaga 900
aaccaagaag agttatgttt attcgcagag gtaaagaaga atgataggtt tgaatggttt 960
tcaaatagtg aaggtcagaa ttcagattcg agagttaaaa agcacagaac tttgtgtgga 1020
gacttccttt ag 1032
<210> 2
<211> 343
<212> PRT
<213> Arabidopsis thaliana (Arabidopsis thaliana)
<400> 2
Met Pro Arg Pro Gly Pro Arg Pro Tyr Glu Cys Val Lys Arg Ala Trp
1 5 10 15
His Ser Asp Arg His Gln Pro Ile Arg Gly Ser Ile Ile Arg Gln Ile
20 25 30
Phe Arg Leu Ala Met Glu Ala His Ser Ala Ala Thr Arg Lys Asn Lys
35 40 45
Glu Trp Gln Glu Lys Leu Pro Val Val Val Leu Lys Ala Glu Glu Ile
50 55 60
Met Tyr Ser Lys Ala Asn Ser Glu Glu Glu Tyr Thr Asp Ala Asp Thr
65 70 75 80
Met Trp Asn Arg Val Asn Asp Ala Ile Asp Thr Ile Ile Arg Arg Asp
85 90 95
Glu Ser Thr Glu Thr Gly Pro Leu Leu Pro Pro Cys Val Glu Ala Ala
100 105 110
Leu Asn Leu Gly Cys Ile Ala Val Arg Ala Ser Arg Ser Gln Arg His
115 120 125
Ser Ser Gly Arg Thr Tyr Leu Gly Pro Lys Ile Gln Glu Pro Val Ser
130 135 140
Ala Ser Thr Asn Glu Pro Ser Tyr His His Glu Tyr Arg Gln Gln Ala
145 150 155 160
Gln Gln Ser Ser Thr Lys Pro Ser Gln Thr Val Gln Ala Ala Val Pro
165 170 175
Val Asp Val Leu Asp Asn Ser Asn Lys Arg Val Ala Thr Pro Arg Gly
180 185 190
Tyr Pro Phe Leu His Glu Ser Met Gln Met His Gln Lys Pro Leu Ala
195 200 205
Ile Arg Gln Gly Thr Gly Pro Ala Ser Ala Pro Ala Pro Ala Pro Val
210 215 220
Asn Leu Gly Ser Val Tyr Pro Leu Tyr Tyr Glu Gly Asn Asn Gln Thr
225 230 235 240
Gln Gln Ala Asp Met Ser Phe Arg Val Pro Glu Ala Pro Ile Ile Ile
245 250 255
Gly Met Pro Ile Gly Ile Lys Pro Ser Glu Glu Ala Thr Glu Arg Val
260 265 270
Cys Asp Leu Ser Leu Arg Leu Gly Ile Ser Ser Glu Pro Ser Thr Arg
275 280 285
Ile Asp Val Gly Ser Ser Arg Ala Tyr Pro Gly Arg Asn Gln Glu Glu
290 295 300
Leu Cys Leu Phe Ala Glu Val Lys Lys Asn Asp Arg Phe Glu Trp Phe
305 310 315 320
Ser Asn Ser Glu Gly Gln Asn Ser Asp Ser Arg Val Lys Lys His Arg
325 330 335
Thr Leu Cys Gly Asp Phe Leu
340
<210> 3
<211> 717
<212> DNA
<213> Arabidopsis thaliana (Arabidopsis thaliana)
<400> 3
atgccgaggc cagggccaag accgtacgac tgtatcagaa gagcttggca tagtgacaga 60
caccaaccca tgaggggttt gctcatccaa gagattttca ggattgtttg tgagattcac 120
agccaatcca ccaggaaaaa cacagaatgg caagagaagc tccctgttgt tgtcttgaga 180
gctgaagaaa tcatgtattc caaagccaat tctgaggctg agtatatgga catgaagacc 240
cttttagacc gtacaaacga cgccatcaac acaatcatac gacttgatga gaccaccgaa 300
acaggggaat ttcttcagcc ttgtattgaa gctgcattgc atttggggtg cacaccaagg 360
agagcttcaa ggagccaacg gaacattaac ccgagatgtt atcttagcca agactcaact 420
aacttggaca acatgttgtc ccaagtattc atgaaaccaa acaactttgc tccaaagaat 480
cttgcagtag cacaagagaa ttgccctgtc tccaagtact ctgcctaccc tttatgctat 540
tcattccggc caatcagtga ctcgtgtaag tccaagaaca gtagaccggc gagtctcatt 600
gacgcaacaa atggcattac ctttggtggg tgtgaatgtg atctatctct gcgcttaggt 660
cctcttggac ctcctactca aaaacgaagt aagataagca gcaacaataa caactga 717
<210> 4
<211> 238
<212> PRT
<213> Arabidopsis thaliana (Arabidopsis thaliana)
<400> 4
Met Pro Arg Pro Gly Pro Arg Pro Tyr Asp Cys Ile Arg Arg Ala Trp
1 5 10 15
His Ser Asp Arg His Gln Pro Met Arg Gly Leu Leu Ile Gln Glu Ile
20 25 30
Phe Arg Ile Val Cys Glu Ile His Ser Gln Ser Thr Arg Lys Asn Thr
35 40 45
Glu Trp Gln Glu Lys Leu Pro Val Val Val Leu Arg Ala Glu Glu Ile
50 55 60
Met Tyr Ser Lys Ala Asn Ser Glu Ala Glu Tyr Met Asp Met Lys Thr
65 70 75 80
Leu Leu Asp Arg Thr Asn Asp Ala Ile Asn Thr Ile Ile Arg Leu Asp
85 90 95
Glu Thr Thr Glu Thr Gly Glu Phe Leu Gln Pro Cys Ile Glu Ala Ala
100 105 110
Leu His Leu Gly Cys Thr Pro Arg Arg Ala Ser Arg Ser Gln Arg Asn
115 120 125
Ile Asn Pro Arg Cys Tyr Leu Ser Gln Asp Ser Thr Asn Leu Asp Asn
130 135 140
Met Leu Ser Gln Val Phe Met Lys Pro Asn Asn Phe Ala Pro Lys Asn
145 150 155 160
Leu Ala Val Ala Gln Glu Asn Cys Pro Val Ser Lys Tyr Ser Ala Tyr
165 170 175
Pro Leu Cys Tyr Ser Phe Arg Pro Ile Ser Asp Ser Cys Lys Ser Lys
180 185 190
Asn Ser Arg Pro Ala Ser Leu Ile Asp Ala Thr Asn Gly Ile Thr Phe
195 200 205
Gly Gly Cys Glu Cys Asp Leu Ser Leu Arg Leu Gly Pro Leu Gly Pro
210 215 220
Pro Thr Gln Lys Arg Ser Lys Ile Ser Ser Asn Asn Asn Asn
225 230 235
<210> 5
<211> 1074
<212> DNA
<213> Artificial sequence
<400> 5
gaggacttga attcggtacc catgccgagg ccaggaccaa gaccttacga gtgtgtgaaa 60
cgagcttggc atagcgatcg tcatcaacct attcgtggtt cgattattcg ccagattttc 120
agactcgcaa tggaagcaca tagcgcagcg acgaggaaga acaaagaatg gcaggagaaa 180
ttgcctgtgg ttgtgttaaa agctgaagaa atcatgtact ctaaagccaa ttccgaggaa 240
gagtatacag atgctgatac tatgtggaat agagtaaatg atgccattga tacaattatt 300
agaagagatg agagtacaga aactggtcct cttttgcctc catgtgttga agctgctctt 360
aatttgggat gtattgctgt aagagcttca agaagccaac gacatagtag cggaaggact 420
tacctcggtc ctaaaattca ggaaccggtt tctgcgtcga ctaatgagcc gtcttaccat 480
catgaatatc gtcagcaagc tcaacaatca tcaaccaaac caagccagac agttcaagct 540
gcagtccctg ttgatgtact tgataacagc aacaagcgtg tagctactcc tcgcggttac 600
ccgtttcttc atgaatccat gcagatgcat caaaagccat tggcaattag acaaggaact 660
ggtcctgctt ctgctcctgc tccagctcca gtcaacttgg gttcggtcta tcctttgtat 720
tacgaaggta ataatcaaac gcagcaagct gacatgtctt ttagagtccc tgaagcgccc 780
ataatcattg gcatgcctat tggtataaag ccctcagaag aagcaactga gagggtctgt 840
gatttatcct tgaggctcgg tatatcttca gaaccgtcta caagaataga tgtcgggtct 900
agtcgggctt acccgggaag aaaccaagaa gagttatgtt tattcgcaga ggtaaagaag 960
aatgataggt ttgaatggtt ttcaaatagt gaaggtcaga attcagattc gagagttaaa 1020
aagcacagaa ctttgtgtgg agacttcctt tagggtaccc cgggttcgaa atcg 1074
<210> 6
<211> 759
<212> DNA
<213> Artificial sequence
<400> 6
gaggacttga attcggtacc catgccgagg ccagggccaa gaccgtacga ctgtatcaga 60
agagcttggc atagtgacag acaccaaccc atgaggggtt tgctcatcca agagattttc 120
aggattgttt gtgagattca cagccaatcc accaggaaaa acacagaatg gcaagagaag 180
ctccctgttg ttgtcttgag agctgaagaa atcatgtatt ccaaagccaa ttctgaggct 240
gagtatatgg acatgaagac ccttttagac cgtacaaacg acgccatcaa cacaatcata 300
cgacttgatg agaccaccga aacaggggaa tttcttcagc cttgtattga agctgcattg 360
catttggggt gcacaccaag gagagcttca aggagccaac ggaacattaa cccgagatgt 420
tatcttagcc aagactcaac taacttggac aacatgttgt cccaagtatt catgaaacca 480
aacaactttg ctccaaagaa tcttgcagta gcacaagaga attgccctgt ctccaagtac 540
tctgcctacc ctttatgcta ttcattccgg ccaatcagtg actcgtgtaa gtccaagaac 600
agtagaccgg cgagtctcat tgacgcaaca aatggcatta cctttggtgg gtgtgaatgt 660
gatctatctc tgcgcttagg tcctcttgga cctcctactc aaaaacgaag taagataagc 720
agcaacaata acaactgagg taccccgggt tcgaaatcg 759
<210> 7
<211> 416
<212> PRT
<213> Artificial sequence
<400> 7
Ala Met Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Glu Met Glu
1 5 10 15
Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Glu Met Glu Gln Lys Leu
20 25 30
Ile Ser Glu Glu Asp Leu Asn Glu Met Glu Gln Lys Leu Ile Ser Glu
35 40 45
Glu Asp Leu Asn Glu Met Glu Ser Leu Gly Asp Leu Thr Met Glu Gln
50 55 60
Lys Leu Ile Ser Glu Glu Asp Leu Asn Met Pro Arg Pro Gly Pro Arg
65 70 75 80
Pro Tyr Glu Cys Val Lys Arg Ala Trp His Ser Asp Arg His Gln Pro
85 90 95
Ile Arg Gly Ser Ile Ile Arg Gln Ile Phe Arg Leu Ala Met Glu Ala
100 105 110
His Ser Ala Ala Thr Arg Lys Asn Lys Glu Trp Gln Glu Lys Leu Pro
115 120 125
Val Val Val Leu Lys Ala Glu Glu Ile Met Tyr Ser Lys Ala Asn Ser
130 135 140
Glu Glu Glu Tyr Thr Asp Ala Asp Thr Met Trp Asn Arg Val Asn Asp
145 150 155 160
Ala Ile Asp Thr Ile Ile Arg Arg Asp Glu Ser Thr Glu Thr Gly Pro
165 170 175
Leu Leu Pro Pro Cys Val Glu Ala Ala Leu Asn Leu Gly Cys Ile Ala
180 185 190
Val Arg Ala Ser Arg Ser Gln Arg His Ser Ser Gly Arg Thr Tyr Leu
195 200 205
Gly Pro Lys Ile Gln Glu Pro Val Ser Ala Ser Thr Asn Glu Pro Ser
210 215 220
Tyr His His Glu Tyr Arg Gln Gln Ala Gln Gln Ser Ser Thr Lys Pro
225 230 235 240
Ser Gln Thr Val Gln Ala Ala Val Pro Val Asp Val Leu Asp Asn Ser
245 250 255
Asn Lys Arg Val Ala Thr Pro Arg Gly Tyr Pro Phe Leu His Glu Ser
260 265 270
Met Gln Met His Gln Lys Pro Leu Ala Ile Arg Gln Gly Thr Gly Pro
275 280 285
Ala Ser Ala Pro Ala Pro Ala Pro Val Asn Leu Gly Ser Val Tyr Pro
290 295 300
Leu Tyr Tyr Glu Gly Asn Asn Gln Thr Gln Gln Ala Asp Met Ser Phe
305 310 315 320
Arg Val Pro Glu Ala Pro Ile Ile Ile Gly Met Pro Ile Gly Ile Lys
325 330 335
Pro Ser Glu Glu Ala Thr Glu Arg Val Cys Asp Leu Ser Leu Arg Leu
340 345 350
Gly Ile Ser Ser Glu Pro Ser Thr Arg Ile Asp Val Gly Ser Ser Arg
355 360 365
Ala Tyr Pro Gly Arg Asn Gln Glu Glu Leu Cys Leu Phe Ala Glu Val
370 375 380
Lys Lys Asn Asp Arg Phe Glu Trp Phe Ser Asn Ser Glu Gly Gln Asn
385 390 395 400
Ser Asp Ser Arg Val Lys Lys His Arg Thr Leu Cys Gly Asp Phe Leu
405 410 415
<210> 8
<211> 311
<212> PRT
<213> Artificial sequence
<400> 8
Ala Met Glu Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Glu Met Glu
1 5 10 15
Gln Lys Leu Ile Ser Glu Glu Asp Leu Asn Glu Met Glu Gln Lys Leu
20 25 30
Ile Ser Glu Glu Asp Leu Asn Glu Met Glu Gln Lys Leu Ile Ser Glu
35 40 45
Glu Asp Leu Asn Glu Met Glu Ser Leu Gly Asp Leu Thr Met Glu Gln
50 55 60
Lys Leu Ile Ser Glu Glu Asp Leu Asn Met Pro Arg Pro Gly Pro Arg
65 70 75 80
Pro Tyr Asp Cys Ile Arg Arg Ala Trp His Ser Asp Arg His Gln Pro
85 90 95
Met Arg Gly Leu Leu Ile Gln Glu Ile Phe Arg Ile Val Cys Glu Ile
100 105 110
His Ser Gln Ser Thr Arg Lys Asn Thr Glu Trp Gln Glu Lys Leu Pro
115 120 125
Val Val Val Leu Arg Ala Glu Glu Ile Met Tyr Ser Lys Ala Asn Ser
130 135 140
Glu Ala Glu Tyr Met Asp Met Lys Thr Leu Leu Asp Arg Thr Asn Asp
145 150 155 160
Ala Ile Asn Thr Ile Ile Arg Leu Asp Glu Thr Thr Glu Thr Gly Glu
165 170 175
Phe Leu Gln Pro Cys Ile Glu Ala Ala Leu His Leu Gly Cys Thr Pro
180 185 190
Arg Arg Ala Ser Arg Ser Gln Arg Asn Ile Asn Pro Arg Cys Tyr Leu
195 200 205
Ser Gln Asp Ser Thr Asn Leu Asp Asn Met Leu Ser Gln Val Phe Met
210 215 220
Lys Pro Asn Asn Phe Ala Pro Lys Asn Leu Ala Val Ala Gln Glu Asn
225 230 235 240
Cys Pro Val Ser Lys Tyr Ser Ala Tyr Pro Leu Cys Tyr Ser Phe Arg
245 250 255
Pro Ile Ser Asp Ser Cys Lys Ser Lys Asn Ser Arg Pro Ala Ser Leu
260 265 270
Ile Asp Ala Thr Asn Gly Ile Thr Phe Gly Gly Cys Glu Cys Asp Leu
275 280 285
Ser Leu Arg Leu Gly Pro Leu Gly Pro Pro Thr Gln Lys Arg Ser Lys
290 295 300
Ile Ser Ser Asn Asn Asn Asn
305 310
Claims (4)
1. The use of any one of the following 1) to 3) for reducing the size of an Arabidopsis seed;
1) protein KIX8 or KIX8 and KIX 9;
2) a nucleic acid molecule encoding proteins KIX8 or KIX8 and KIX 9;
3) a recombinant vector, expression cassette or recombinant bacterium comprising a nucleic acid molecule encoding proteins KIX8 or KIX8 and KIX 9;
the amino acid sequence of the protein KIX8 is a sequence 7 in a sequence table;
the amino acid sequence of the protein KIX9 is a sequence 8 in a sequence table.
2. Use of the substance of claim 1 for breeding seed-reduced Arabidopsis thaliana or small-seed Arabidopsis thaliana.
3. A method for cultivating transgenic arabidopsis with reduced seed size comprises the following steps 1) or 2):
1) the method comprises the following steps: improving the content of the proteins KIX8 or KIX8 and KIX9 in the target arabidopsis thaliana to obtain transgenic arabidopsis thaliana;
2) the method comprises the following steps: improving the expression of nucleic acid molecules of coding proteins KIX8 or KIX8 and KIX9 in the target arabidopsis thaliana to obtain transgenic arabidopsis thaliana;
the seed of the transgenic arabidopsis is smaller than that of the target arabidopsis;
the amino acid sequence of the protein KIX8 is a sequence 7 in a sequence table;
the amino acid sequence of the protein KIX9 is a sequence 8 in a sequence table.
4. The method of claim 3, wherein:
the method for improving the content of the protein KIX8 or KIX8 and KIX9 in the target arabidopsis thaliana or improving the expression of the nucleic acid molecule for coding the protein KIX8 or KIX8 and KIX9 in the target arabidopsis thaliana is to introduce the nucleic acid molecule for coding the protein KIX8 or KIX8 and KIX9 into the target arabidopsis thaliana.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911292135.9A CN110938124B (en) | 2019-12-16 | 2019-12-16 | Application of arabidopsis KIX8 and KIX9 genes in seed size regulation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911292135.9A CN110938124B (en) | 2019-12-16 | 2019-12-16 | Application of arabidopsis KIX8 and KIX9 genes in seed size regulation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110938124A CN110938124A (en) | 2020-03-31 |
| CN110938124B true CN110938124B (en) | 2022-02-18 |
Family
ID=69911278
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911292135.9A Active CN110938124B (en) | 2019-12-16 | 2019-12-16 | Application of arabidopsis KIX8 and KIX9 genes in seed size regulation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110938124B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001018036A2 (en) * | 1999-09-03 | 2001-03-15 | Beth Israel Deaconess Medical Center | Methods and reagents for regulating gene expression |
| CN108368491A (en) * | 2015-11-02 | 2018-08-03 | 合成基因组股份有限公司 | The algae mutant of lipid production rate with raising |
| CN111349633A (en) * | 2020-03-18 | 2020-06-30 | 中国科学院西双版纳热带植物园 | INP1 gene capable of positively regulating size of lateral organs of plant and homologous gene thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20060150283A1 (en) * | 2004-02-13 | 2006-07-06 | Nickolai Alexandrov | Sequence-determined DNA fragments and corresponding polypeptides encoded thereby |
-
2019
- 2019-12-16 CN CN201911292135.9A patent/CN110938124B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2001018036A2 (en) * | 1999-09-03 | 2001-03-15 | Beth Israel Deaconess Medical Center | Methods and reagents for regulating gene expression |
| CN108368491A (en) * | 2015-11-02 | 2018-08-03 | 合成基因组股份有限公司 | The algae mutant of lipid production rate with raising |
| CN111349633A (en) * | 2020-03-18 | 2020-06-30 | 中国科学院西双版纳热带植物园 | INP1 gene capable of positively regulating size of lateral organs of plant and homologous gene thereof |
Non-Patent Citations (13)
| Title |
|---|
| A Repressor Protein Complex Regulates Leaf Growth in Arabidopsis;Nathalie Gonzalez 等;《Plant Cell》;20150731;第27卷(第8期);第2279、2285页 * |
| Arabidopsis thaliana histone acetyltransferase (AT4G32295), mRNA;GenBank;《GenBank》;20190214;NM_148390.3 * |
| Arabidopsis thaliana hypothetical protein (AT3G24150), mRNA;GenBank;《GenBank》;20190214;NM_001338670.1 * |
| Fine-Mapping of a Wild Genomic Region Involved in Pod and Seed Size Reduction on Chromosome A07 in Peanut ( Arachis hypogaea L.);Mounirou Hachim Alyr 等;《Genes (Basel)》;20201125;第11卷(第12期);第1402页 * |
| PEAPOD limits developmental plasticity in Arabidopsis;Derek W.R. White;《bioRxiv》;20170123;摘要、第4页倒数第2段、第5页第1段、第14页倒数第2段、图1 * |
| SCF(SAP) controls organ size by targeting PPD proteins for degradation in Arabidopsis thaliana;Zhibiao Wang 等;《Nat Commun》;20160406;第7卷;第11192页 * |
| Sequence and expression analyses of KIX domain proteins suggest their importance in seed development and determination of seed size in rice, and genome stability in Arabidopsis;Jitendra Kumar Thakur 等;《Mol Genet Genomics》;20130612;第288卷(第7-8期);第329-346页 * |
| SlKIX8 and SlKIX9 are negative regulators of leaf and fruit growth in tomato;Gwen Swinnen 等;《bioRxiv》;20210613;第1-44页 * |
| STERILE APETALA modulates the stability of a repressor protein complex to control organ size in Arabidopsis thaliana;Na Li 等;《PLoS Genet》;20180205;第14卷(第2期);第e1007218页 * |
| The Mediator subunit OsMED15a is a transcriptional co-regulator of seed size/weight-modulating genes in rice;Nidhi Dwivedi 等;《Biochim Biophys Acta Gene Regul Mech》;20190913;第1862卷(第10期);第194432页 * |
| Transcriptional repression of GIF1 by the KIX-PPD-MYC repressor complex controls seed size in Arabidopsis;Zupei Liu 等;《Nat Commun》;20200415;第11卷(第1期);第1846页 * |
| UniProtKB-Q0WQ76;UniProtKB;《UniProtKB》;20060905;Q0WQ76_ARATH * |
| 调控植物种子大小的分子机制综述;曹维 等;《江苏农业科学》;20200630;第48卷(第6期);第1-7页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110938124A (en) | 2020-03-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107435047B (en) | Low-phosphorus-resistant key gene GmPHR25 in plant phosphorus signal network and application thereof | |
| CN108948170B (en) | Plant type growth and development related protein and coding gene and application thereof | |
| CN112226455B (en) | Rice grain length and grain weight related protein, and coding gene and application thereof | |
| CN109750047B (en) | Tea tree hexose transporter gene CsSWEET17 and application thereof in regulating and controlling vegetative growth and seed size of plants | |
| CN110862442B (en) | Application of Arabidopsis MYC3 and MYC4 genes in seed size regulation | |
| CN114369147A (en) | Application of BFNE gene in tomato plant type improvement and biological yield improvement | |
| CN111171127B (en) | Astragalus sinicus LHY gene and application thereof | |
| CN109666069B (en) | Plant flowering time character related protein AtJAZ5, and coding gene and application thereof | |
| CN110904146B (en) | Application of arabidopsis GIF1 gene in regulation of seed size | |
| CN112175058A (en) | Cloning, identification and application of salt tolerance related gene splice | |
| CN110684088B (en) | Protein ZmbZIPa3 and application of coding gene thereof in regulating and controlling plant growth and development and stress tolerance | |
| CN108610405B (en) | Application of protein TaNRT2.5 in regulation and control of plant root system development | |
| CN107973844B (en) | Wheat heading period related protein Ta-Hd4A and application thereof | |
| CN110938124B (en) | Application of arabidopsis KIX8 and KIX9 genes in seed size regulation | |
| CN114540529B (en) | Corn genotype and functional molecular marker InDel-K2 for increasing yield of semi-dwarf and application thereof | |
| CN108690127B (en) | Stress-resistance-associated protein TaMYB85 and coding gene and application thereof | |
| CN107012166B (en) | Application of rice OsAT1 protein in improving boron content of plants | |
| CN113201558B (en) | Soybean GmHDA12 gene and protein and application thereof | |
| CN110407922B (en) | Rice cold-resistant gene qSCT11 and application thereof | |
| WO2021047377A1 (en) | Application of tpst gene in regulation of traits of plant | |
| CN108660150A (en) | A method of improving Rice Salt ability | |
| CN114703199A (en) | Plant drought resistance related gene TaCML46 and application | |
| CN110862441B (en) | Application of PPD1 and PPD2 genes of arabidopsis thaliana in regulating and controlling seed size | |
| CN110627888B (en) | Stiff1 gene for regulating and controlling stalk strength of corn and application of encoded protein thereof | |
| CN109112137B (en) | Gene SNG1 for controlling size and weight of rice grains and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |