CN110923363B - Kit for detecting hand-foot-and-mouth disease pathogen nucleic acid and application thereof - Google Patents
Kit for detecting hand-foot-and-mouth disease pathogen nucleic acid and application thereof Download PDFInfo
- Publication number
- CN110923363B CN110923363B CN201911315941.3A CN201911315941A CN110923363B CN 110923363 B CN110923363 B CN 110923363B CN 201911315941 A CN201911315941 A CN 201911315941A CN 110923363 B CN110923363 B CN 110923363B
- Authority
- CN
- China
- Prior art keywords
- probe
- detection
- enterovirus
- amplification
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6816—Hybridisation assays characterised by the detection means
- C12Q1/682—Signal amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a kit for detecting hand-foot-mouth disease pathogen nucleic acid and application thereof. And (3) the collected sample is subjected to cell lysate pyrolysis to release pathogen nucleic acid, and the pathogen nucleic acid fragments are amplified through reverse transcription and transcription processes. Adding the amplified RNA product into a micropore coated with a coated probe, and simultaneously adding a specific probe and an amplifying probe, wherein the coated probe can be combined with one end of a specific probe CES to fix amplified product RNA; one end of the specific probe LES is combined with the RNA product, and the other end of the specific probe LES is combined with the amplifying probe, so that signal amplification is realized. The amplified probe labeled with the biotin is then bound to a streptavidin-HRP enzyme conjugate, and finally an HRP enzyme chemiluminescent substrate is added for detection on a chemiluminescent instrument. The method does not need RNA extraction, is not easy to pollute in detection, has high sensitivity and strong specificity, and can be widely used for detecting hand-foot-mouth disease pathogen nucleic acid.
Description
Technical Field
The invention relates to the technical field of biological detection, in particular to a kit for detecting hand-foot-and-mouth disease pathogens and determining whether the pathogens are coxsackievirus A group 16 or enterovirus 71 nucleic acid based on a double amplification (RNA isothermal amplification and multi-biotin signal amplification) technology and application thereof.
Background
Hand-foot-mouth disease is a common infectious disease which is caused by infection of part of enteroviruses and is mainly characterized by fever, sore throat, general discomfort, rash or herpes at hands, feet, oral cavity and other parts. Most hand-foot-and-mouth disease patients are slightly symptomatic and self-limiting, but a significant proportion of patients have fatal cardiopulmonary function diseases and neurological complications, and individual severe patients progress rapidly and can even lead to death. The epidemic situation of hand-foot-and-mouth disease in China is particularly severe, and the hand-foot-and-mouth disease becomes a public health problem which seriously affects the life and health of residents in China. Enteroviruses causing hand-foot-and-mouth disease include Coxsackie type A group 2, 4, 5, 6, 7, 9, 10, 16 and the like, type B group 1, 2, 3, 4, 5 and the like, enterovirus type 71, and Epstein-Barr virus and the like, wherein EV71 and CA16 are common.
There are many laboratory diagnosis methods for hand-foot-mouth disease, and the methods commonly used clinically at present include virus isolation culture method, serological analysis method, virus nucleic acid detection method and the like. The virus isolation culture method is a gold standard for identifying virus infectious diseases, and is characterized in that virus culture is carried out on cell lines with different virus sensitivities according to different selections of epidemic strains in different periods and different areas. However, the method has complicated virus culture process, has higher requirements on the operation skills of virus separation culture personnel, consumes a great amount of manpower and material resources, can not meet the detection of large samples in popular areas, and limits the clinical application of the method. Serological assays commonly used include neutralizing antibody assays, enzyme-linked immunosorbent assays (ELISA), complement fixation assays (CF), and the like. The serological analysis method detects viruses in serum samples through antigen-antibody specific binding reaction to make diagnosis, is quick and simple, has no special requirements on experimental operators, has low requirements on detection equipment, and is suitable for popularization and application in primary hospitals. However, the method has the uncertainty of results caused by long observation time, antigen drift, cross immune reaction and the like, and the patient needs a certain time for generating antibodies by immune response after being infected by viruses, so that the method is not suitable for early diagnosis of HFMD. Compared with the traditional serological detection method, the virus nucleic acid detection method has the advantages of rapidness, specificity and sensitivity, and has the advantages of shortening the detection window period and improving the pathogen detection rate. The existing common hand-foot-and-mouth disease pathogen nucleic acid detection is based on RT-PCR methods, which require complex RNA extraction processes, special PCR amplification conditions, special laboratories and fluorescent quantitative PCR instruments, and are extremely easy to produce pollution in the detection process. Therefore, on the basis of RNA isothermal amplification technology and by combining with a multi-biotin signal amplification technology, the method for establishing single-tube combined detection of enterovirus universal type, coxsackie virus A group 16 type and enterovirus 71 type nucleic acid has very important significance.
Disclosure of Invention
In view of the above-mentioned shortcomings of the prior art, the present invention aims to provide a kit for detecting hand-foot-and-mouth disease pathogens and determining whether it is coxsackievirus group a type 16 or enterovirus type 71 nucleic acid based on RNA isothermal amplification-multi-biotin signal amplification technology and application thereof. The kit releases pathogen nucleic acid after a collected sample is cracked by cell lysate, and then the pathogen nucleic acid fragments are amplified through reverse transcription and transcription processes under the action of reverse transcriptase and T7RNA polymerase. The amplified RNA product is added into the microwell coated with the coated probe for hybridization, and a specific probe and an amplifying probe corresponding to the coated probe are added. Wherein the coated probe can be complementarily paired with one end sequence of CES series probe of each index, and the other end of CES series probe can be combined with RNA product to anchor the RNA product into the microwell; one end of each LES series probe of each index can be combined with the RNA product, and the other end is combined with the amplifying probe, so that the signal amplifying process is realized. The amplified probe marked with the multi-biotin is combined with a streptavidin-HRP enzyme-linked compound to finally form a coated probe-specific probe-RNA amplified product-specific probe-amplified probe-streptavidin-HRP enzyme-linked compound complex, and finally an HRP enzyme chemiluminescent substrate is added for detection on a chemiluminescent instrument. Detection of pathogen nucleic acid is achieved. Therefore, the invention has no complex RNA extraction process, can realize amplification reaction even in one water bath kettle, is not easy to pollute in actual detection based on the characteristic of easy degradation of RNA molecules, has the advantages of high sensitivity, strong specificity and simple operation, and makes the wide application of common hand-foot-and-mouth pathogen, coxsackievirus A group 16 and enterovirus 71 nucleic acid detection possible.
In order to achieve the above object, the present invention adopts the following technical scheme:
in a first aspect, a kit for jointly detecting enterovirus universal type, coxsackievirus a group 16 type and enterovirus 71 type nucleic acids based on RNA isothermal amplification-multi-biotin signal amplification technology is provided, comprising:
1) Amplification reaction solution: containing 40mM Tris-HCl(pH 8.0)，12mM MgCl 2 70mM KCl,15%DMSO,5mM DTT each dNTP was 1mM, each NTP was 2mM, and each amplification primer was 0.2. Mu.M;
the invention aims at three detection indexes of hand-foot-mouth disease pathogen nucleic acid, namely enterovirus general EV-U, enterovirus 71 (EV 71), coxsackie virus A group 16 (CA 16) and human 18SrRNA genes serving as internal reference indexes, wherein an amplification object selected in RNA isothermal amplification is a section of conserved sequence distributed in different regions, wherein the 5' end of an R primer is provided with a T7RNA polymerase promoter sequence, and the distributed region and two corresponding amplification primer sequences are shown in a table 1;
TABLE 1 amplification primer sequences
2) Three enzymes required in isothermal amplification of RNA: reverse transcriptase (e.g., AMV or M-MLV), T7RNA polymerase and RnaseH;
3) Cell lysate: cells can be lysed to release nucleic acids;
4) Amplification probe FDP: a nucleic acid sequence marked with Biotin, which can be combined with one end of a specific probe LES series, wherein the specific sequence (5 '-3') is AGAAGGCGTCCGTCTTTGAGGC-Biotin-ACCCGATGGATAGGTCGGTGAA-Biotin-TAAGCATCGTGCCCTTTCGCAG-Biotin-ACCACGTTCGCGTTCTCACATG;
5) Specific probes: the specific probes are divided into CES series and LES series, and the CES series and the LES series which are used correspondingly by the three indexes detected by the method and the internal reference indexes are different; and a plurality of the probes can be hybridized and combined with different parts of the nucleic acid to be detected, so that the detection sensitivity is improved; the specific probe sequences are shown in Table 2;
TABLE 2 specific probe sequences
6) Microplates: each microwell is internally coated with a coated probe which can be complementarily matched and combined with one end sequence of CES series probes of each index, and the specific sequence is as follows: ACATACATACGTACAG;
7) HRP-streptavidin enzyme conjugate: an HRP enzyme-linked compound marked with streptavidin, which can be combined with biotin on an amplifying probe;
8) Hybridization solution, wash A (5X), wash B (5X), blocking solution, substrate dilution solution, hybridization solution: 5 XSSC containing 0.1% SDS; wash a (5×): 5 XSSC containing 0.5% SDS; wash B (5×): 5 XPBS with 0.5% SDS; sealing liquid: containing 0.5% BSA, 1 XPBS; substrate dilution: 50mM pH 8.5Tris-HCl;
9) A substrate: luminol chemiluminescent substrate (available from Thermo Fisher, cat. No. 37075) is capable of generating a chemiluminescent signal upon catalysis by HRP enzyme, which is detected by the instrument.
The invention provides a method for detecting enterovirus universal type, coxsackie virus A group 16 type and enterovirus 71 type nucleic acids by using the kit for jointly detecting enterovirus universal type, coxsackie virus A group 16 type and enterovirus 71 type nucleic acids based on the RNA isothermal amplification-multi-biotin signal amplification technology, which comprises the following steps:
(1) Isothermal amplification of RNA
The detection indexes of the invention are four: enterovirus universal type (EV-U), enterovirus 71 type (EV 71) and coxsackievirus group A16 (CA 16) and reference human 18SrRNA genes. A pair of (F/R primers) amplification primers was designed for each index, wherein the 5' end of the R primer carries a T7RNA polymerase promoter. The invention realizes the amplification of each index nucleic acid in the same amplification tube, and specifically comprises the following steps: during amplification, under the action of an R primer with a T7 promoter and reverse transcriptase, converting RNA to be detected into RNA, namely cDNA heterozygote; RNA in cDNA is digested by RNaseH in the amplified enzyme to obtain single-stranded cDNA; synthesizing a second strand under the action of the F primer and the DNA polymerase function of reverse transcriptase to form double-stranded DNA with a T7 promoter; double-stranded DNA with a T7 promoter is transcribed by T7RNA polymerase to produce an RNA molecule product. The transcribed RNA molecular product can enter a cyclic amplification process, firstly, F primer can combine with the transcribed RNA molecular product, and the transcribed RNA is converted into RNA by reverse transcriptase; RNA in cDNA is digested by RNaseH in the amplified enzyme to obtain single-stranded cDNA; the R primer is then bound to the single-stranded cDNA, the second strand is synthesized by the action of the reverse transcriptase DNA polymerase, and is again enriched to form more double-stranded DNA molecules with the T7 promoter, so that more transcription templates are provided for the T7RNA polymerase, and a large amount of RNA molecule products are transcribed by the action of the T7RNA polymerase (as shown in figure 1).
The invention designs the detection of the internal reference genes of the human beings to monitor the effectiveness of sample collection and the effectiveness of an amplification system. When the sample is collected to be qualified, the sample must contain human abscission cells, the human abscission cells must be detected in detection, the internal reference is positive in detection of the sample, otherwise, the whole detection needs resampling for retesting.
(2) Multi-biotin signal amplification
a, designing a specific probe, an amplifying probe and a coating probe
Specific probes: each index-specific probe is comprised of two types: CES series and LES series, each probe may be designed in multiple pieces. Wherein the CES probe comprises two parts, one end of the CES probe can be specifically combined with amplified RNA products, the other end of the CES probe can be assembled with a coated probe coated in a micro-pore plate to play a role of fixing the amplified product RNA, and the two parts are linked by 4-5T. Each LES probe also comprises two parts, one end of each LES probe can be specifically combined with an amplified RNA product, the other end of each LES probe can be combined with the amplifying probe to play a role of linking the amplifying probe, and the two parts are linked by 4-5T.
Amplification probe: the amplifying probe is a probe containing a plurality of biotins, the probe can be combined with one end of a specific probe LES, and the biotins on the probe can be combined with an HRP-streptavidin enzyme-linked substance.
Coating a probe: the coated probe is fixed in the micro-pore plate and can be combined with one end of the specific probe CES to play a role in fixation.
The specific probes are required to be free from crossing among probes with the same index and different indexes in design, and CES series, amplifying probes and coating probes are required to be free from crossing so as to ensure the detection specificity.
The CES and LES series of the specific probes are designed in a plurality of ways in order to increase the sensitivity of the multi-biotin amplification step and thus the sensitivity of the detection system.
b, judging the detection result
A negative control was also set up during the amplification test, i.e., the negative control (cell lysate, available from Signosis, USA, cat. CL-0001) was also amplified at the same time as the sample was tested. Each tube of amplified product is equally divided into four microwell plate microwells (plate distribution diagram is shown in figure 3), wherein EV-U microwells are added with enterovirus universal type specific probes during hybridization, EV71 microwells are added with enterovirus 71 type specific probes during hybridization, CA16 microwells are added with coxsackie virus A group 16 type during hybridization, and 18S microwells are added with reference human 18SrRNA gene specific probes during hybridization. Adding a chemiluminescent substrate after hybridization washing, measuring a chemiluminescent value, and calculating a ratio R of a sample detection index, wherein R=a value of a sample detection index to be detected relative to a light unit (RLU)/(5 x negative quality control object detection index relative to the light unit (RLU); and (3) carrying out qualitative judgment on the sample according to the ratio R, wherein the ratio R is positive when the ratio is greater than 1.0, and is negative when the ratio is less than or equal to 1.0.
In combination with the principle, the working process of the method of the invention is described as follows:
(1) Nucleic acid extraction
And collecting a throat swab sample of a suspected hand-foot-mouth patient, and releasing the viral RNA molecules by using a cell lysate lysis method.
(2) Isothermal amplification of RNA
To 17. Mu.L of the amplification reaction solution containing enterovirus universal type (EV-U), enterovirus 71 type (EV 71) and coxsackievirus A group 16 type (CA 16) and the internal reference, 2. Mu.L of the nucleic acid extract was added, heated at 95℃for two minutes, preheated at 42℃for 2 minutes, 1. Mu.L of the amplification enzyme was added, and the amplification was carried out at 42℃for 1 hour at constant temperature. If the sample to be detected has corresponding index nucleic acid, a large amount of amplification and enrichment are carried out on the index RNA molecules during amplification.
(3) Multi-biotin signal amplification
a, adding the RNA isothermal amplification product, a specific probe (comprising CES series probes and LES series probes), an amplification probe and a hybridization solution into a microplate at the same time, and incubating at a constant temperature of 50 ℃ for 1 hour.
The amplified RNA molecules are complementarily paired with specific probes (including CES-series probes and LES-series probes). One end of CES series probes are hybridized and complementarily paired with RNA molecules, and the other end of CES series probes are combined with coated probes in the micro-pore plate, so that the RNA molecules can be fixed in the micro-pore plate; one end of the LES series probe is hybridized and complementarily paired with the RNA molecule, and the other end of the LES series probe can be complementarily paired with the amplifying probe to form CES probe-RNA molecule-LES probe-amplifying probe complex, and the complex is immobilized on a microplate (see fig. 2).
b, washing the RNA molecules, the specific probes and the amplifying probes which are not bound on the microwell plate by using the washing solution A.
c, adding a blocking solution, blocking for 1-2 minutes at room temperature, and blocking nonspecific sites.
d, adding the HRP-streptavidin enzyme-linked substance into the micro-porous plate for incubation, wherein the enzyme-linked substance can be combined with biotin on the amplifying probe to finally form CES probe-RNA molecule-LES probe-amplifying probe-HRP-streptavidin enzyme-linked substance, and fixing the enzyme-linked substance on the micro-porous plate.
e, washing free HRP-streptavidin enzyme-linked compound with washing liquid B.
f, preparing a substrate according to the ratio of substrate A to substrate B to substrate diluent=1:1:8, adding the substrate to each microwell, and measuring a chemiluminescence value.
g, calculating the ratio R of each target of the sample to be detected.
R=sample detection index to be measured relative to light unit (RLU)/(5 x negative quality control object detection index relative to light unit (RLU) value).
And if the ratio R is greater than 1.0, the result is positive, and if the ratio R is less than or equal to 1.0, the result is negative.
In a second aspect, the application of the kit for jointly detecting enterovirus universal type, coxsackievirus A group 16 type and enterovirus 71 type nucleic acid based on RNA isothermal amplification-multi-biotin signal amplification technology in preparation of hand-foot-mouth disease pathogens and determining whether the pathogens are coxsackievirus A group 16 type or enterovirus 71 type detection reagents is provided.
Compared with the prior art, the invention has the following beneficial effects:
1. the invention can amplify four indexes of enterovirus general type, enterovirus 71 type, coxsackievirus A group 16 type and human reference gene 18sRNA simultaneously in the same tube by an RNA isothermal amplification method. The amplified nucleic acid product is RNA, RNA is easy to degrade in natural environment, and compared with the PCR method, the amplified DNA has the effect of preventing pollution. The isothermal amplification of RNA is carried out in an environment of 42 ℃, and even one water bath kettle can realize the amplification reaction, so that the requirement of an experimental instrument is reduced to the greatest extent.
2. Because the general sequence variation of the enteroviruses is large, the primer design of the invention must ensure that all common subtype epidemic strain nucleic acids can be amplified, and the selected gene areas are relatively conservative, so that the general common epidemic strain of the enteroviruses can be fully covered. Meanwhile, the primers are designed and subjected to Torons test, so that the single-primer amplification efficiency is high, different primers have no interference, and the overall amplification effect is good. Table 10 shows that the kit has good detection capability for 16 enteroviruses from different sources.
3. The invention introduces the function of specific probe CES series and specific probe LES series bridged molecule components during design, and the two probes successfully combine the amplified probes and the RNA nucleic acid amplified fragments in series to realize the specific detection of the index RNA nucleic acid fragments. The use of the two sets of probes ensures that any one set of probes and the index nucleic acid amplification fragment cannot be successfully immobilized on a micro-pore plate due to hybridization failure, and positive detection results cannot be generated, so that the detection specificity is ensured. The detection results of the kit of the invention on 30 other microorganisms listed in table 9 are all negative, and the fact that the kit of the invention has no cross reaction with other microorganisms is proved. More than two probes can be designed for each set of probes, and the design is beneficial to improving the sensitivity of the test strip. The lowest detection limit of the enterovirus universal detection hole of the kit disclosed by the invention on enterovirus 71 (EV 71) (ATCC VR-1432) is 5 multiplied by 10TCID 50 Minimal detection of/mL, ECHO9 (ATCC VR-39)Limited to 2.5X10 TCID 50 A minimum detection limit of 3.5X10 TCID for/mL, coxB5 (ATCC VR-185) 50 A minimum detection limit of 2X 10TCID for/mL, CA16 (ATCC number: VR-1022) 50 /mL; EV71 assay wells have a minimum limit of detection of enterovirus type 71 (EV 71) (ATCC VR-1432) of 1X 10TCID 50 /mL; CA16 detection well has a minimum detection limit of 5TCID for CA16 (ATCC number: VR-1022) 50 /mL. For 681 diagnosis results, enterovirus universal type, coxsackievirus A group 16 type or enterovirus 71 type detection is carried out on clinical samples related to hand-foot-and-mouth pathogen infection, and the detection sensitivity and specificity of the kit are higher than those of a commercial fluorescent quantitative PCR kit for detecting hand-foot-and-mouth pathogen.
Drawings
FIG. 1 is a schematic diagram of isothermal amplification of RNA;
FIG. 2 is a schematic diagram of a multi-biotin signal amplification;
FIG. 3 is a schematic diagram of a 96-well microplate layout.
Detailed Description
A further understanding of the nature and advantages of the present invention may be realized by reference to the remaining portions of the specification taken in conjunction with the drawings. The examples provided are merely illustrative of the methods of the present invention and are not intended to limit the remainder of the disclosure in any way whatsoever. The chemiluminescent detection device used in the examples was a chemiluminescent immunoassay device, model TZD-CL-200G, available from Xiamen Tianzhong, inc.
The experimental procedure, which does not specify specific conditions in the following examples, is generally followed by conventional conditions, such as "molecular cloning: the conditions described in laboratory Manual 3 rd edition (New York: cold Spring Harbor laboratory Press, 2005) were followed.
The minimum detection limit of the stock solutions of the viruses ECHO9 (ATCC No. VR-39), coxB5 (ATCC No. VR-185), EV71 (ATCC No. VR-1432) and CA16 (ATCC No. VR-1022) from the ATCC is determined by carrying out gradient dilution, 3 to 5 parts of each gradient of the virus dilution is repeated, 20 times of repeated detection are carried out on each part, and the virus level with the positive detection rate of 90 to 95 percent is taken as the minimum detection limit, and the detection result is as follows:
echo9 minimum detection limit (EV-U detection hole)
TABLE 3.1 detection experiment data for different titres Echo9
TABLE 3.2 lowest detection limit experimental data for Echo9
CoxB5 minimum detection limit (EV-U detection hole)
TABLE 4.1 test data for the detection of CoxB5 at different titres
TABLE 4.2 CoxB5 minimum limit of detection experimental data
EV71 minimum detection limit detection (EV-U detection hole)
TABLE 5.1 test data for EV71 at various titers
TABLE 5.2 lowest detection limit experimental data for EV71
CA16 minimum detection limit (EV-U detection hole)
TABLE 6.1 test data for different titres CA16
TABLE 6.2 CA16 minimum detection limit experimental data
EV71 minimum detection limit detection (EV 71 detection hole)
TABLE 7.1 test data for EV71 at various titers
TABLE 7.2 minimum detection limit experimental data for EV71
CA16 minimum detection limit (CA 16 detection hole)
TABLE 8.1 test data for different titres CA16
TABLE 8.2 CA16 minimum detection limit experimental data
The detection sensitivity of the kit of the invention is finally determined as follows:
[ example 2 ] specificity verification
1, testing strain information and detection results
After extracting nucleic acid from different microorganisms, detecting, and verifying the design specificity of the primer and the probe of the kit. Relevant pathogen information and detection results are as follows:
TABLE 9 specificity verification test results
2 conclusion
From the data, the detection results of the kit provided by the invention on the microorganisms are negative, and the fact that the kit provided by the invention has no cross reaction with other microorganisms is proved, so that the kit is high in pathogen detection specificity.
Example 3 pathogen detection output validation
The kit of the invention is used for experiments on enteroviruses from different sources (respectively from ATCC (American type culture Collection), martial arts virus donation, martial arts university donation, hubei province disease control center donation and Fujian province establishment hospital donation) so as to analyze the detection capability of the kit on enteroviruses from different regions. The results were as follows:
TABLE 10 detection results of different viral strains
The detection result shows that the kit has good detection capability for different source strains of enteroviruses, EV71 and CA 16.
Example 4 verification of clinical samples
In 681 cases of a sample taken by the national academy of preventive medicine/disease prevention control center of Hubei province, the women and child health care center of Hubei province and the Fujian province, the kit of the invention and a commercial fluorescent PCR kit are used for comparison, and the detection results are as follows:
1, enterovirus universal detection result
Four-grid table detection result:
reagent to be checked and sequencing method detection result (four-grid table)
The sequencing method is adopted to retest 37 inconsistent samples, and 27 cases of enteroviruses are positive, including 25 cases of the kit provided by the invention for detecting positive commercial fluorescent PCR kit for detecting negative samples, and 2 cases of the kit provided by the invention for detecting negative commercial fluorescent PCR kit for detecting positive samples.
According to overall analysis, the detection sample of the kit disclosed by the invention is higher in sensitivity and higher in specificity in the enterovirus detection condition.
2, enterovirus 71 type detection result
Four-grid table detection result:
reagent to be checked and sequencing method detection result (four-grid table)
The sequencing method is adopted to retest 23 inconsistent samples, and 20 cases of enteroviruses are positive, including 17 cases of the kit provided by the invention for detecting positive and a commercial fluorescent PCR kit for detecting negative samples, and 3 cases of the kit provided by the invention for detecting negative and a commercial fluorescent PCR kit for detecting positive samples.
According to overall analysis, the detection sample of the kit disclosed by the invention is higher in sensitivity and higher in specificity in the enterovirus detection condition.
3, CA16 detection results
Four-grid table detection result:
reagent to be checked and sequencing method detection result (four-grid table)
Retesting is carried out on 15 inconsistent samples by adopting a sequencing method, and 10 enteroviruses are positive as a result, wherein the 15 inconsistent samples comprise 8 samples of positive commercial fluorescent PCR (polymerase chain reaction) kit detection positive commercial fluorescent PCR kit detection negative samples and 2 samples of negative commercial fluorescent PCR kit detection positive samples.
According to overall analysis, the detection sample of the kit disclosed by the invention is higher in sensitivity and higher in specificity in the enterovirus detection condition.
Sequence listing
<110> Wu Hanzhong Account of Biotech Co., ltd
<120> kit for detecting hand-foot-and-mouth disease pathogen nucleic acid and application thereof
<160> 30
<170> SIPOSequenceListing 1.0
<210> 1
<211> 21
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
gttatccggc tagctacttc g 21
<210> 2
<211> 45
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
taatacgact cactataggg agagctcagt agactcttca cacca 45
<210> 3
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
gaaagttcca taggagatag 20
<210> 4
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
taatacgact cactataggg agaggacaca gcgtgtctca atc 43
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
ggaatttctt tagccgtgct 20
<210> 6
<211> 43
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
taatacgact cactataggg agagccaagc aaacgaatct ctg 43
<210> 7
<211> 19
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
agaaacggct accacatcc 19
<210> 8
<211> 41
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
taatacgact cactataggg agacaccaga cttgccctcc a 41
<210> 9
<211> 88
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<220>
<221> misc_feature
<222> (22)..(23)
<223> ligation between two bases with biotin
<220>
<221> misc_feature
<222> (44)..(45)
<223> ligation between two bases with biotin
<220>
<221> misc_feature
<222> (66)..(67)
<223> ligation between two bases with biotin
<400> 9
agaaggcgtc cgtctttgag gcacccgatg gataggtcgg tgaataagca tcgtgccctt 60
tcgcagacca cgttcgcgtt ctcacatg 88
<210> 10
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
cggaaaacct agtaacacca ttttctgtac gtatgtatgt 40
<210> 11
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
tgaaagttgc ggagagcttc ttttctgtac gtatgtatgt 40
<210> 12
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
gttcagcact cccccagtgt ttttcatgag aacgcgaacg tggt 44
<210> 13
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
agatcaggcc gatgagtcac ttttcatgag aacgcgaacg tggt 44
<210> 14
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
cgcattcccc acgggcgacc ttttcatgag aacgcgaacg tggt 44
<210> 15
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
cgtgagcaga gccctcactc ttttctgtac gtatgtatgt 40
<210> 16
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
gctctaccag cacccacagg ttttctgtac gtatgtatgt 40
<210> 17
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
ccagaacaca caggtgagca ttttcatgag aacgcgaacg tggt 44
<210> 18
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
gtcatcgact ggatacgggc ttttcatgag aacgcgaacg tggt 44
<210> 19
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 19
aaggttccag cactccaagc ttttcatgag aacgcgaacg tggt 44
<210> 20
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 20
atgcccacca cgggtacaca ttttctgtac gtatgtatgt 40
<210> 21
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 21
acagatggtt atgttaattg ttttctgtac gtatgtatgt 40
<210> 22
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 22
ggacattgat ttaatgggat ttttcatgag aacgcgaacg tggt 44
<210> 23
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 23
gctcagctgc ggcggaaatg ttttcatgag aacgcgaacg tggt 44
<210> 24
<211> 44
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 24
gagttattta cctacatgcg ttttcatgag aacgcgaacg tggt 44
<210> 25
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 25
aaggaaggca gcaggctttt ctgtacgtat gtatgt 36
<210> 26
<211> 36
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 26
gcgcaaatta cccacttttt ctgtacgatt gtatgt 36
<210> 27
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 27
cccgacccgg ggaggttttt catgagaacg cgaacgtggt 40
<210> 28
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 28
agtgacgaaa aataactttt catgagaacg cgaacgtggt 40
<210> 29
<211> 40
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 29
aatacaggac tctttctttt catgagaacg cgaacgtggt 40
<210> 30
<211> 16
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 30
acatacatac gtacag 16
Claims (3)
1. A kit for jointly detecting enterovirus universal type, coxsackievirus A group 16 type and enterovirus 71 type nucleic acid based on RNA isothermal amplification-multi-biotin signal amplification technology is characterized by comprising the following components:
1) Amplification reaction solution: containing 40mM Tris-HCl, pH 8.0, 12mM MgCl 2 70mM KCl,15%DMSO,5mM DTT each dNTP was 1mM, each NTP was 2mM, and each amplification primer was 0.2. Mu.M; wherein the amplification primers comprise four pairs: enterovirus general EV-U, enterovirus 71, coxsackievirus A group 16 and human 18SrRNA gene as internal reference index are as follows:
(1) Enterovirus general EV-U:
EV-U-F primer (5 '-3'): GTTATCCGGCTAGCTACTTCG;
EV-U-R primer (5 '-3'): TAATACGACTCACTATAGGGAGAGCTCAGTAGAC TCTTCACACCA;
(2) Amplification primers for enterovirus type 71:
EV71-F primer (5 '-3'): GAAAGTTCCATAGGAGATAG;
EV71-R primer (5 '-3'): TAATACGACTCACTATAGGGAGAGGACACAGCG TGTCTCAATC;
(3) Amplification primers for coxsackievirus a group 16:
CA16-F primer (5 '-3'): GGAATTTCTTTAGCCGTGCT;
CA16-R primer (5 '-3'): TAATACGACTCACTATAGGGAGAGCCAAGCA AACGAATCTCTG;
(4) Amplification primers of reference gene:
18SrRNA-F primer: AGAAACGGCTACCACATCC;
18SrRNA-R primer: TAATACGACTCACTATAGGGAGACACCAGACTTGCC CTCCA;
2) Three enzymes required in isothermal amplification of RNA: comprises three, reverse transcriptase, T7RNA polymerase and RnaseH;
3) Cell lysate;
4) Amplification probe FDP: a nucleic acid sequence marked with Biotin, which can be combined with one end of a specific probe LES series, wherein the specific sequence (5 '-3') is AGAAGGCGTCCGTCTTTGAGG C-Biotin-ACCCGATGGATAGGTCGGTGAA-Biotin-TAAGCATCGTGCCCTTTC GCAG-Biotin-ACCACGTTCGCGTTCTCACATG;
5) Specific probes: two specific probes are used for each index, namely a CES series and an LES series, wherein a plurality of CES series and LES series can be designed, and the specific (5 '-3') is as follows:
(1) EV-U specific probe
EV-U CES1：CGGAAAACCTAGTAACACCAttttCTGTACGTATGTATGT；EV-U CES2：TGAAAGTTGCGGAGAGCTTCttttCTGTACGTATGTATGT；
EV-U LES1：GTTCAGCACTCCCCCAGTGTttttCATGAGAACGCGAACGT GGT；
EV-U CES2：TGAAAGTTGCGGAGAGCTTCttttCTGTACGTATGTATGT；
EV-U LES3：CGCATTCCCCACGGGCGACCttttCATGAGAACGCGAACGT GGT；
(2) EV71 specific probe
EV71 CES1：CGTGAGCAGAGCCCTCACTCttttCTGTACGTATGTATGT；
EV71 CES2：GCTCTACCAGCACCCACAGGttttCTGTACGTATGTATGT；
EV71 LES1：CCAGAACACACAGGTGAGCAttttCATGAGAACGCGAACG TGGT；
EV71 LES2：GTCATCGACTGGATACGGGCttttCATGAGAACGCGAACGT GGT；
EV71 LES3：AAGGTTCCAGCACTCCAAGCttttCATGAGAACGCGAACGT GGT；
(3) CA16 specific probe:
CA16 CES1：ATGCCCACCACGGGTACACAttttCTGTACGTATGTATGT；CA16 CES2：ACAGATGGTTATGTTAATTGttttCTGTACGTATGTATGT；
CA16 LES1：GGACATTGATTTAATGGGATttttCATGAGAACGCGAACGT GGT；
CA16 LES2：GCTCAGCTGCGGCGGAAATGttttCATGAGAACGCGAACGT GGT；
CA16 LES3：GAGTTATTTACCTACATGCGttttCATGAGAACGCGAACGT GGT；
(4) Human reference gene (18 SrRNA) specific probe:
internal reference CES1: AAGGAAGGCAGCAGGCttttCTGTACGTATGTATGT;
internal reference CES2: GCGCAAATTACCCACTttttCTGTACGATTGTATGT;
internal reference LES1: CCCGACCCGGGGAGGTttttCATGAGAACGCGAACGTGGT;
internal reference LES2: AGTGACGAAAAATAACttttCATGAGAACGCGAACGTGGT;
internal reference LES3: AATACAGGACTCTTTCttttCATGAGAACGCGAACGTGGT;
6) Microplates: coating probes in each microwell, wherein the coating probes can be complementarily matched and combined with one end sequence of CES series probes of each index, and the specific sequences (5 '-3') are as follows: ACATACATACGT ACAG;
7) HRP-streptavidin enzyme conjugate: an HRP enzyme-linked compound marked with streptavidin, which can be combined with biotin on an amplifying probe;
8) Preparing hybridization solution, 5 Xwashing solution A, 5 Xwashing solution B, blocking solution and substrate dilution solution, wherein the hybridization solution is as follows: 5 XSSC containing 0.1% SDS; 5 Xwashing liquor A: 5 XSSC containing 0.5% SDS; 5 Xwashing liquid B: 5 XPBS with 0.5% SDS; sealing liquid: containing 0.5% BSA, 1 XPBS; substrate dilution: 50mM pH 8.5Tris-HCl;
9) A substrate: luminol chemiluminescent substrate, when catalyzed by HRP enzyme, can generate chemiluminescent signal, which is detected by instrument.
2. The kit of claim 1, wherein the reverse transcriptase is AMV or M-MLV.
3. The use of the kit according to claim 1 or 2 for the preparation of enterovirus universal type, coxsackievirus a group 16 type and enterovirus 71 type detection reagents.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911315941.3A CN110923363B (en) | 2019-12-19 | 2019-12-19 | Kit for detecting hand-foot-and-mouth disease pathogen nucleic acid and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911315941.3A CN110923363B (en) | 2019-12-19 | 2019-12-19 | Kit for detecting hand-foot-and-mouth disease pathogen nucleic acid and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110923363A CN110923363A (en) | 2020-03-27 |
| CN110923363B true CN110923363B (en) | 2023-06-27 |
Family
ID=69864335
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911315941.3A Active CN110923363B (en) | 2019-12-19 | 2019-12-19 | Kit for detecting hand-foot-and-mouth disease pathogen nucleic acid and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923363B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112111609A (en) * | 2020-10-29 | 2020-12-22 | 上海伯杰医疗科技有限公司 | Universal nucleic acid detection kit for enteroviruses |
| CN114280016A (en) * | 2021-12-07 | 2022-04-05 | 广州兆瑞医学生物科技有限公司 | Exosome detection method |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008090340A2 (en) * | 2007-01-23 | 2008-07-31 | Cambridge Enterprise Limited | Nucleic acid amplification and testing |
| JP2012065568A (en) * | 2010-09-22 | 2012-04-05 | Tosoh Corp | Method and reagent for detecting enterovirus 71 rna |
Family Cites Families (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20020142293A1 (en) * | 2000-11-29 | 2002-10-03 | Institut Pasteur | Enteroviral polynucleotides, methods of detecting enteroviruses and kits containing the polynucleotides |
| US20090317796A1 (en) * | 2008-06-20 | 2009-12-24 | Centers For Disease Control Department Of Health | Indirect immunofluorescence assay typing kit for coxsackievirus A group and method for typing coxsackievirus A group |
| CN103388033B (en) * | 2012-05-07 | 2016-08-10 | 上海仁度生物科技有限公司 | A kind of enterovirns type 71 (EV71) real-time fluorescence nucleic acid isothermal amplification detection kit |
| CN103388032B (en) * | 2012-05-07 | 2016-08-03 | 上海仁度生物科技有限公司 | A kind of coxsackie virus A 16-type (CA16) real-time fluorescence nucleic acid isothermal amplification detection kit |
| CN104846122A (en) * | 2015-05-13 | 2015-08-19 | 宝瑞源生物技术(北京)有限公司 | Nucleic acid detection kit of enterovirus type 71 (EV71) and coxsackievirus type A16 (CA16) (fluorescent polymerase chain reaction (PCR) method) |
| CN105420411A (en) * | 2015-12-11 | 2016-03-23 | 湖南圣湘生物科技有限公司 | Nucleic acid fluorescence PCR detection kit for universal enterovirus, coxsackievirus A16 and enterovirus 71 |
| CN107529559B (en) * | 2017-08-31 | 2021-02-19 | 南京美宁康诚生物科技有限公司 | Multiple fluorescence PCR detection kit for hand-foot-and-mouth disease virus and application |
| CN109609693A (en) * | 2018-12-26 | 2019-04-12 | 山东艾克韦生物技术有限公司 | Method that is a kind of while detecting a variety of enteroviruses |
-
2019
- 2019-12-19 CN CN201911315941.3A patent/CN110923363B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008090340A2 (en) * | 2007-01-23 | 2008-07-31 | Cambridge Enterprise Limited | Nucleic acid amplification and testing |
| JP2012065568A (en) * | 2010-09-22 | 2012-04-05 | Tosoh Corp | Method and reagent for detecting enterovirus 71 rna |
Non-Patent Citations (1)
| Title |
|---|
| 荧光恒温扩增技术检测肠道病毒71型方法的建立与评价;曹凌峰;苏犁云;董妞妞;徐锦;;检验医学(第11期);第51-55页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110923363A (en) | 2020-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109207567B (en) | Method for determining staphylococcus aureus based on aptamer and strand displacement amplification reaction | |
| CN110964854B (en) | Kit for simultaneously detecting seven respiratory tract pathogen nucleic acids and application thereof | |
| CN113234856B (en) | DENV one-step method nucleic acid detection method based on CRISPR/Cas12a and isothermal amplification | |
| CN110964853B (en) | Kit for jointly detecting respiratory syncytial virus, parainfluenza virus and adenovirus based on double amplification technology and application of kit | |
| CN110923363B (en) | Kit for detecting hand-foot-and-mouth disease pathogen nucleic acid and application thereof | |
| Prabhakar et al. | Recent advances in the nucleic acid-based diagnostic tool for coronavirus | |
| KR20130005208A (en) | Method and kit for detecting carbapenem resistant enterobacteriaceae using real-time pcr | |
| CN107058628B (en) | LAMP primer composition for detecting hand-foot-and-mouth disease related pathogens and related application thereof | |
| CN111334611B (en) | Kit for detecting novel coronavirus (2019-nCoV) based on double amplification technology and application thereof | |
| CN102367488B (en) | Enterovirus triple real-time fluorescent quantitative RT-PCR detection kit | |
| CN114262759B (en) | PCR primer group and kit for combined detection of multiple respiratory viruses | |
| CN110904194B (en) | Mycoplasma pneumoniae and Chlamydia pneumoniae nucleic acid combined detection kit and application thereof | |
| CN111808987A (en) | 2019 novel coronavirus S protein gene isothermal color development amplification primer group, screening kit and detection method | |
| Miao et al. | Rapid detection of Nipah virus using the one-pot RPA-CRISPR/Cas13a assay | |
| TW201245452A (en) | Nucleic acid detection | |
| CN102994650B (en) | Multi-gene detection method of encephalitis viruses based on capillary electrophoresis | |
| CN111172242B (en) | Kit for combined detection of influenza A and B virus based on double amplification technology and application thereof | |
| Young et al. | A reverse-transcription competitive PCR assay based on chemiluminescence hybridization for detection and quantification of hepatitis C virus RNA | |
| CN105400908B (en) | A kind of primer, kit and detection method using pyrosequencing techniques detection channel catfish virus | |
| CN110964852B (en) | Colloidal gold chromatographic kit for combined detection of respiratory syncytial virus and parainfluenza virus and application thereof | |
| WO2021191473A1 (en) | Method and kit for the detection of sars-cov-2 virus in a sample based on reverse transcription loop-mediated isothermal amplification (rt-lamp) | |
| EA000613B1 (en) | Microorganism quantitation and detection method and kit | |
| CN110923347B (en) | Ureaplasma urealyticum nucleic acid detection colloidal gold chromatography kit and application thereof | |
| Sharma et al. | Covid-19 detection using qRT-PCR-A review | |
| CN113106170B (en) | Triple TaqMan fluorescent quantitative PCR detection reagent, kit, detection method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |