CN110923338A - Microarray chip capable of detecting various bacterial genome DNAs and preparation method thereof - Google Patents
Microarray chip capable of detecting various bacterial genome DNAs and preparation method thereof Download PDFInfo
- Publication number
- CN110923338A CN110923338A CN201911116943.XA CN201911116943A CN110923338A CN 110923338 A CN110923338 A CN 110923338A CN 201911116943 A CN201911116943 A CN 201911116943A CN 110923338 A CN110923338 A CN 110923338A
- Authority
- CN
- China
- Prior art keywords
- probe
- chip
- bacteria
- modified
- negative
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6834—Enzymatic or biochemical coupling of nucleic acids to a solid phase
- C12Q1/6837—Enzymatic or biochemical coupling of nucleic acids to a solid phase using probe arrays or probe chips
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The embodiment of the invention relates to a microarray chip capable of detecting genomic DNAs of various bacteria and a preparation method thereof, wherein the microarray chip comprises: a chip solid phase carrier body; and a modified gene chip probe, the modified gene chip probe comprising the following structure according to the 5 '-3' direction: 5' modifying group-Cn‑(dT)mAn oligonucleotide 3' selected from the group consisting of nucleotide sequences of specific regions of genomic DNAs of two or more bacteria such as Acinetobacter baumannii, Klebsiella pneumoniae, Escherichia coli, and Pseudomonas aeruginosa, and complementary sequences thereof. The modified gene chip probe in the microarray chip of the embodiment of the invention effectively reduces the steric hindrance effect of the probe and a PCR product when the probe and the PCR product are combined specifically, the combination of 2 modification modes plays a synergistic role, and the genomic DNA of various bacteria can be well detected.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a microarray chip capable of detecting various bacterial genome DNAs and a preparation method thereof.
Background
Bacterial infections are the most common and serious infectious diseases in the clinic, such as: the fatality rate and disability rate of bacterial infections of the central nervous system, the respiratory system, the blood system and the like are high, and the lives of patients are seriously threatened.
With the development of molecular biotechnology, nucleic acid hybridization and the wide application of chip detection technology, DNA detection can be realized by adopting gene chip detection technology. The gene chip detection technology can arrange different probes on a solid phase carrier to form a microarray of probes, the probes are specifically combined with DNA molecules to be detected by utilizing the characteristic that double-stranded DNA molecules can realize denaturation-renaturation under certain conditions, and the combined probes are identified through the subsequent color development and detection processes. The gene chip has high detection flux, has advantages in the aspect of high-flux multi-gene combined detection, and can detect several to hundreds of different genes at one time. However, such detection techniques generally require expensive gene chips and specialized chip-supporting equipment, and are therefore mainly used for detecting genomic DNA of eukaryotic cells, such as: the kit is used for tumor detection, genetic variation detection, prenatal and postnatal care detection and the like.
Specific probes on the microarray chip include oligonucleotide probes designed and synthesized based on conserved sequence portions of specific gene sequences in the database. The 5' end of the oligonucleotide is usually modified to chemically react with a modifying group on the chip, thereby immobilizing the probe molecule on the surface of the solid support. However, after the probe molecule is fixed on the solid phase carrier, the probe molecule is bound with DNA specifically due to the steric hindrance effect, and the ability of the probe to bind with DNA, especially the binding with long-chain DNA, still needs to be further improved.
Meanwhile, most of the existing chips are used for scientific research, and are only suitable for operating a small number of chips or chip samples, so that the requirement on batch chip production or chip application is difficult to meet.
The information disclosed in this background section is only for enhancement of understanding of the general background of the invention and should not be taken as an acknowledgement or any form of suggestion that this information forms the prior art already known to a person skilled in the art.
Disclosure of Invention
Object of the Invention
The present invention is directed to a microarray chip capable of detecting genomic DNAs of various bacteria and a method for preparing the same, and also directed to a detection method using the microarray chip. Compared with C alonenOr poly dT to modify the probeIn terms of the mode of modification, the modified gene chip probe in the microarray chip of the present invention is obtained by using CnThe method is modified together with poly dT, so that the steric hindrance effect of the probe and a PCR product during specific combination is effectively reduced, the combination of the 2 modification modes plays a synergistic role, and the genomic DNA of various bacteria can be well detected. The detection method using the microarray chip provided by the embodiment of the invention does not need in-vitro culture of a sample, and has high overall detection time period and sensitivity.
Solution scheme
In order to achieve the purpose of the invention, the embodiment of the invention provides the following technical scheme:
a microarray chip capable of detecting genomic DNA of a plurality of bacteria, comprising:
a chip solid phase carrier body;
and modified gene chip probes distributed in an array manner and connected to the chip solid phase carrier body through covalent bonds, wherein the modified gene chip probes comprise the following structures according to the 5 '-3' direction: 5' modifying group-Cn-(dT)m-an oligonucleotide strand 3', wherein: the oligonucleotide chain represents the nucleotide sequence body of the gene chip probe, (dT)mRepresents m dT, said CnRepresents n carbon atoms connected in a straight chain form, the 5' modification group can perform chemical reaction with a group modified on the surface of the chip solid phase carrier body to form covalent bond connection, m is more than or equal to 8 and less than or equal to 15, and n is more than or equal to 5 and less than or equal to 15; alternatively, m is 10, n is 12;
the oligonucleotide chain is selected from nucleotide sequences of specific regions of genome DNA of two or more bacteria selected from acinetobacter baumannii, klebsiella pneumoniae, escherichia coli, pseudomonas aeruginosa, staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, streptococcus pneumoniae, enterococcus faecalis, haemophilus influenzae, listeria monocytogenes, neisseria meningitidis, burkholderia cepacia, streptococcus agalactiae, mycobacterium tuberculosis and coagulase-negative staphylococcus or complementary sequences thereof.
In another possible implementation manner, the modified genechip probes have 16 kinds, and the oligonucleotide chains in the 16 kinds of modified genechip probes are respectively nucleotide sequences of specific regions of genome DNA of acinetobacter baumannii, klebsiella pneumoniae, escherichia coli, pseudomonas aeruginosa, staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, streptococcus pneumoniae, enterococcus faecalis, haemophilus influenzae, listeria monocytogenes, neisseria meningitidis, burkholderia cepacia, streptococcus agalactiae, mycobacterium tuberculosis and coagulase-negative staphylococcus or complementary sequences thereof.
In another possible implementation, the chip solid phase carrier body is a silica glass slide.
In another possible implementation manner, the modification of the chip solid phase carrier body is an aldehyde modification, and the modification group on the gene chip probe is an amino group.
In another possible implementation mode, the method further comprises positive quality control probes, negative quality control probes, bacteria universal probes, gram-staining positive probes and gram-staining negative probes which are distributed in an array mode.
A method for preparing a microarray chip capable of detecting genomic DNAs of a plurality of bacteria, comprising the steps of:
1) modifying the solid phase carrier body of the chip to enable the solid phase carrier body to perform chemical reaction with a modified group of the modified gene chip probe to form covalent bond connection;
2) synthesizing a modified gene chip probe, wherein the modified gene chip probe comprises the following structures according to the 5 '-3' direction: 5' modifying group-Cn-(dT)m-an oligonucleotide strand 3', wherein: the oligonucleotide chain represents the nucleotide sequence body of the gene chip probe, (dT)mRepresents m dT, said CnThe modified group is a linear alkyl group with n carbon atoms, the 5' modified group can perform chemical reaction with a group modified on the surface of the solid phase carrier body of the chip to form covalent bond connection, m is more than or equal to 8 and less than or equal to 15, and n is more than or equal to 5 and less than or equal to 15; alternatively, m is 10, n is 12; said oligonucleotide strand is selected from the group consisting of Acinetobacter baumannii, Klebsiella pneumoniae, Escherichia coli, pseudoaeruginosaNucleotide sequences or complementary sequences of specific regions of genomic DNA of two or more bacteria selected from the group consisting of monad, Staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, Streptococcus pneumoniae, enterococcus faecalis, Haemophilus influenzae, Listeria monocytogenes, Neisseria meningitidis, Burkholderia cepacia, Streptococcus agalactiae, Mycobacterium tuberculosis, and coagulase-negative staphylococcus;
3) preparing detection probe spotting fluid, carrying out vortex oscillation and uniform mixing on the detection probe spotting fluid, and spotting the detection probe spotting fluid on the modified chip solid phase carrier body in an array mode on a chip spotting instrument.
In another possible implementation manner, the modified genechip probes have 16 kinds, and the oligonucleotide chains in the 16 kinds of modified genechip probes are respectively nucleotide sequences of specific regions of acinetobacter baumannii, klebsiella pneumoniae, escherichia coli, pseudomonas aeruginosa, staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, streptococcus pneumoniae, enterococcus faecalis, haemophilus influenzae, listeria monocytogenes, neisseria meningitidis, burkholderia cepacia, streptococcus agalactiae, mycobacterium tuberculosis and coagulase-negative staphylococcus or complementary sequences thereof.
In another possible implementation, the chip solid phase carrier body is a silica glass slide.
In another possible implementation manner, the modification of the chip solid phase carrier body is an aldehyde modification, and the modification group on the gene chip probe is an amino group.
In another possible implementation manner, the method further includes the following steps: preparing the sample solution of a positive quality control probe, a negative quality control probe, a bacteria universal probe, a gram-staining positive probe and a gram-staining negative probe, and carrying out sample application on the modified chip solid-phase carrier body in an array mode on a chip sample application instrument.
In another possible implementation manner, before modifying the chip solid phase carrier body, a step of cleaning and/or performing an acid-base treatment on the chip solid phase carrier body is included, and a slide holder is used in the cleaning and/or the acid-base treatment, and the slide holder includes:
the first glass slide fixing bracket is provided with a threaded through hole between the upper surface and the lower surface, and a glass slide fixing port between the upper surface and the lower surface;
the upper surface of the second glass slide fixing bracket is provided with a glass slide fixing groove corresponding to the position of the glass slide fixing port;
one end of the connecting rod is fixedly connected to the upper surface of the second glass slide fixing bracket, so that the connecting rod is perpendicular to the second glass slide fixing bracket, the outer surface of the connecting rod is provided with threads matched with the threads of the threaded through hole, and the other end of the connecting rod penetrates through the threaded through hole to fixedly connect the first glass slide fixing bracket and the second glass slide fixing bracket;
the slide glass clamp is made of acid-resistant and alkali-resistant materials.
In another possible implementation manner, the detection probe sample solution contains 0.1-1% of polyvinyl alcohol, 0.1-10mM of modified gene chip probe, and the balance of PBS buffer solution.
An assay method using a microarray chip, comprising the steps of:
1) extraction of bacterial genomic DNA from samples: processing the sample to obtain a bacterial pellet concentrate; adding lysozyme, muramidase and glass beads, destroying cell wall components of bacteria, then denaturing and degrading protein to fully release genome DNA of the bacteria, and separating the genome DNA of the bacteria;
2) preparing a PCR primer with a biotin label;
3) preparation of PCR products with Biotin labels: carrying out PCR reaction by taking the bacterial genome DNA in the step 1) as a template and the primer in the step 2 as a primer;
4) hybridizing the PCR product with biotin label with the microarray chip of claim 1 or the microarray chip prepared by the preparation method of claim 2;
5) developing the color of the hybridization product on the microarray chip;
6) detecting a color development result;
the biotin-labeled PCR primer is complementary to the base of the oligonucleotide chain in the gene chip probe.
In another possible implementation, the biotin-labeled PCR primers are bacterial 16S universal PCR primers.
In another possible implementation, the upstream primer that is common among the 16S universal PCR primers for bacteria: AGAGTTTGATCCTGGCTCAG; biotin-labeled downstream primer ontology: GGYTACCTTGTTACGACTT are provided.
In another possible implementation, the biotin-labeled PCR primers are PCR-reacted to obtain the biotin-labeled PCR product using genomic DNA from acinetobacter baumannii, klebsiella pneumoniae, escherichia coli, pseudomonas aeruginosa, staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, streptococcus pneumoniae, enterococcus faecalis, haemophilus influenzae, listeria monocytogenes, neisseria meningitidis, burkholderia cepacia, streptococcus agalactiae, mycobacterium tuberculosis, or coagulase-negative staphylococcus.
In another possible implementation, the sample is a sample that has not been cultured ex vivo, the sample comprising blood, tears, cerebrospinal fluid, pleural effusion, peritoneal hydroncus, alveolar lavage, urine, nasopharyngeal swab, pus, or semen.
Advantageous effects
(1) Compared with C alonenOr poly dT, the modified gene chip probe in the microarray chip of the present invention is obtained by using CnAnd the steric hindrance effect of the probe and a PCR product during specific combination is effectively reduced by a common modification mode with poly dT, and the combination of the 2 modification modes plays a synergistic role and can well detect the genomic DNA of 16 bacteria.
(2) The modified gene chip probe in the microarray chip provided by the embodiment of the invention is suitable for short-chain PCR products and long-chain PCR products. Of course, since the long-chain PCR product has more steric hindrance when it is specifically bound to the probe, the general method is adoptedIn the modification mode, the combination of the probe and the long-chain PCR product is not ideal, but the embodiment of the invention passes through CnThe gene chip probe modified together with polydT is very suitable for long-chain PCR products, so that a detector can detect more sites of the same PCR product, namely, the long-chain PCR product is obtained by only carrying out PCR once, and a plurality of sites can be detected; multiple sites can be detected without carrying out multiple PCR to obtain multiple short-chain PCR products.
(3) The microarray chip of the embodiment of the invention adopts a common glass slide and a conventional chemical reagent as materials, and the cost of the prepared chip is far lower than the market price after processing, and the performance difference between chips is small.
(4) The modified amino group on the gene chip probe in the microarray chip of the embodiment of the invention forms a covalent bond with the aldehyde group on the solid phase carrier body of the chip, the reaction is simple and easy, the probe can be more tightly combined with the surface of a glass slide, a larger space is provided for the combination of the probe and the subsequent hybridization reaction, and the invention is suitable for the detection of long-chain PCR products with larger molecular weight.
(5) In the preparation method of the microarray chip provided by the embodiment of the invention, the surface treatment of a plurality of slides can be simultaneously realized, because the invention provides the slide soaking clamp for soaking the slides in batches, the clamp adopts the method that 2 slide fixing brackets are used for fixing two ends of the slide instead of one end, so that the problem of instability of the plurality of slides is solved, and the problem of fixation of the plurality of slides is solved.
(6) In the preparation method of the microarray chip provided by the embodiment of the invention, 1% PVA is used as the chip sampling solution, so that a net-shaped structure is formed on the surface of the glass slide, and the hybridization space between the probe and the DNA to be detected is enlarged.
(7) The invention screens and compares various raw materials and a plurality of process procedures, optimizes the raw materials, finally establishes a whole set of low-density gene chips which adopt common glass slides as starting materials and are prepared to multi-gene loci by a series of technical treatments, and establishes a complete method and process for chip hybridization, color development and result identification. The invention has the advantage of effective quality control of the sample application and detection processes of the chip. The method designs and synthesizes a chip positive quality control system, thereby performing quality control on the chip sample application process and the chip detection process. And the working mode of the sample application probe of the chip positive quality control system is determined. The invention has the advantages of stable detection result and lower cost of the chip and the detection equipment. The method uses a biotin-avidin-alkaline phosphatase-TCIB/NBT color development system, the color development signal of the system is stable, the signal value is not attenuated and reduced, the chip detection result can be repeatedly reproduced, the chip detection equipment of a fluorescence method with higher cost is not needed, the chip detection equipment can be identified only by a common chip reader capable of identifying visible light, and the laboratory use cost is lower.
(8) The embodiment of the invention uses the detection method of the microarray chip to directly extract the bacterial genome DNA from the clinical sample and carry out chip detection without culturing the sample in vitro, thereby having short overall detection time, being capable of rapidly detecting the in vivo abnormal bacterial infection, having good accuracy and high sensitivity, and the detection result does not depend on the success or failure of the culture of the sample. Meanwhile, lysozyme and muramidase are added when the bacterial cell wall is damaged in the method, the damage effect of the bacterial cell wall cannot be influenced by the addition of the muramidase, and the method can be suitable for fungi, so that detection personnel are facilitated, and the error probability is reduced.
Drawings
One or more embodiments are illustrated by the corresponding figures in the drawings, which are not meant to be limiting. The word "exemplary" is used exclusively herein to mean "serving as an example, embodiment, or illustration. Any embodiment described herein as "exemplary" is not necessarily to be construed as preferred or advantageous over other embodiments.
FIG. 1 is a flowchart of an experiment of examples 1-2 of the present invention.
Fig. 2 is a schematic view of the structure of the slide holder in embodiments 1-2 of the present invention.
FIG. 3 is a schematic diagram of a hybrid formed by the positive control system in example 1-2 of the present invention.
FIG. 4 is a schematic diagram showing the relative position structures of the PCR primers and the probes required to satisfy the requirements in examples 1-2 of the present invention.
FIGS. 5-1 to 5-16 are photographs showing the results of detecting 16 types of bacterial standards, respectively, in example 2 of the present invention.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below, and it is obvious that the described embodiments are a part of the embodiments of the present invention, but not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention. Furthermore, in the following detailed description, numerous specific details are set forth in order to provide a better understanding of the present invention. It will be understood by those skilled in the art that the present invention may be practiced without some of these specific details. In some embodiments, materials, elements, methods, means, and the like that are well known to those skilled in the art are not described in detail in order to not unnecessarily obscure the present invention.
Throughout the specification and claims, unless explicitly stated otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or component but not the exclusion of any other element or component.
Gene chip: in a solid-phase detection technique for simultaneously detecting a plurality of gene fragments, a large number of probe molecules are generally fixed on a support (a silicon wafer, a glass slide, a nylon membrane, etc.), a molecular lattice of the probe is formed, the probe is hybridized with a DNA molecule with a fluorescent label or a biotin label, then a color development reaction is performed, and the information of the gene fragments contained in a sample is obtained by detecting the intensity of a color development signal after hybridization of each probe molecule.
Glass slide: a widely used glass product containing silicon dioxide as a component.
Surface modification of glass slides: the surface of the glass slide is generally SiO2The molecule, itself, is not biologically active. The slide surface can be treated with a series of laboratory chemical reagents to carry specific chemically reactive groups, such as carboxyl (-COOH), amino (-NH)3) Aldehyde (-CHO), etc., and these modified chemically reactive groups may participate in subsequent molecular binding with the probe.
Aldehyde modification of the surface of the glass slide: the surface of the glass slide is treated by using a series of chemical reagents, so that aldehyde groups are formed on the surface of the glass slide, the aldehyde groups do not necessarily need to be directly connected with the glass slide, other grafts can be arranged in the middle of the glass slide, and the end of the glass slide far away from the glass slide is aldehyde. The aldehyde group can chemically react with amino on the probe to form a covalent bond, so that the effect of capturing and fixing probe molecules on the surface of the glass slide is realized.
Microarray: a technology developed on the basis of nucleic acid hybridization is characterized in that a large number of known gene probes are fixed on the surface of a glass slide according to a certain arrangement on the surface of a solid-phase medium (a glass slide, a silicon chip, a nylon membrane and the like), and the rapid detection of gene information is realized by detecting hybridization probes at corresponding positions.
DNA Probe: under proper pH value, temperature and ionic strength, the DNA probe can be combined with complementary single-stranded DNA or RNA in a sample to be detected by hydrogen bonds through denaturation, renaturation and base complementary pairing of molecules to form a double-stranded complex. After washing off the unpaired bound material, the hybridization reaction result can be detected by a chromogenic detection system.
And (3) PCR: the method is polymerase chain reaction, a rapid amplification and enrichment technology of genome DNA, and can rapidly amplify a DNA molecule by using a pair of specific oligonucleotide fragments, an enzyme and a system for amplification reaction, thereby meeting the subsequent detection requirement of the genome DNA.
And (3) hybridization: according to the base complementary pairing principle, under a certain condition, the oligonucleotide DNA probe fixed on the surface of the chip and the sequence of the PCR product chain in the hybridization solution are subjected to specific base pairing combination.
Steric hindrance: the interaction of the biological macromolecules requires a certain reaction space, and when the molecules are larger and the reaction space is smaller, the interaction of the biological molecules is inhibited, which shows that the reaction rate is reduced, the reaction time is prolonged, and the reaction products are reduced.
Alkaline phosphatase-catalyzed dot method color reaction: in the present invention, alkaline phosphatase-streptavidin is bound to a PCR product containing biotin, and a color reaction is performed.
Clinical samples: the invention refers to a small amount of specimen collected from the body or body surface of a patient by medical institutions according to the requirements of relevant national regulations and operation specifications, and is used for detecting whether specific pathogenic substances are contained. The clinical examination specimens include blood, urine, feces, nasopharyngeal swab, alveolar lavage fluid, pleural effusion and peritoneal hydroncus.
Bacteria and fungi: the meaning in the present invention has its usual meaning. In the art, there is a particular concern that microorganisms present in the normal natural environment and in the human body may cause specific bacterial and fungal infections under certain induced conditions, such as surgery, use of ventilator tubes, interpopular transmission, and the like.
Bacterial genomic DNA, fungal genomic DNA: the meaning in the present invention has its usual meaning. Genomic DNA is a component of cells, is a marker of pathogen infection, and is generally used as a target substance for clinical genetic detection of bacterial and fungal infections.
Nucleic acid extraction: the meaning in the present invention has its usual meaning. In particular, the genomic DNA of bacteria or fungi is separated from bacterial cells and fungal cells, and the obtained genomic DNA has certain purity and content so as to meet the requirements of subsequent detection tests.
And (3) PCR: the meaning of the invention has its usual meaning, namely, it refers to polymerase chain reaction, a rapid amplification and enrichment technology of genome DNA, through using a pair of specific oligonucleotide fragments, amplification reaction using enzyme and system, can amplify a DNA molecule rapidly, thus meet the subsequent detection need of genome DNA.
Magnetic beads: the invention relates to a magnetic microsphere with a surface carrying silicon hydroxyl or carboxyl group, which has magnetic attraction property and can selectively combine and release DNA substances.
Example 1
1. Preparation of aldehyde modified micro-array chip carrier
In this example, a commercially available conventional silica slide was used as a chip solid phase carrier body of a microarray chip, which is a general slide for microscopic examination. The slide glass is prepared by the following steps: cleaning, acid-base treatment, surface silanization treatment, hydroformylation treatment and cleaning to form the microarray chip carrier with the surface provided with aldehyde groups. The preparation process comprises the following steps:
a common glass slide (76mm multiplied by 25mm multiplied by 1.2mm) is washed by deionized water for 3 times and dried, and water-soluble impurities adsorbed on the surface of the glass slide are removed.
And immersing the glass slide in chromic acid washing liquor for overnight, taking out, washing with deionized water, and airing to further remove impurities such as organic matters on the surface of the glass slide.
And soaking the glass slide in 10M NaOH overnight, taking out, washing with deionized water, and drying.
The glass slide is immersed in an ethanol solution containing 5% of 3-aminopropyltriethoxysilane (APES, silanization agent) for 30-120 minutes, taken out, washed clean by deionized water and dried.
The slide glass was immersed in a 5% glutaraldehyde solution in PBS (pH7.4) for 60 minutes, taken out, washed with the PBS solution, and dried.
And (3) storing the prepared glass slide at 2-8 ℃ in a vacuum and dark place to obtain the aldehyde group modified microarray chip.
When the glass slides are soaked, the glass slides are prevented from being adhered to each other, the glass slides can be placed in a special glass slide clamp, and the glass slide clamp is acid-resistant and alkali-resistant. In the above steps of the embodiment of the present invention, a special slide holder made of teflon material is used.
As shown in fig. 2, a slide holder used in an embodiment of the present invention includes:
the first glass slide fixing bracket 1 is provided with a threaded through hole 11 between the upper surface and the lower surface thereof, and a glass slide fixing through hole 12 between the upper surface and the lower surface thereof;
the upper surface of the second slide glass fixing bracket 2 is provided with a slide glass fixing groove 21 corresponding to the position of the slide glass fixing port 12;
one end of the connecting rod 3 is fixedly connected to the upper surface of the second slide glass fixing bracket 2, so that the connecting rod 3 is perpendicular to the second slide glass fixing bracket 2, the outer surface of the connecting rod 3 is provided with threads matched with the threads of the threaded through hole 11, and the other end of the connecting rod 3 penetrates through the threaded through hole 11 to fixedly connect the first slide glass fixing bracket and the second slide glass fixing bracket;
the slide glass clamp is made of acid-resistant and alkali-resistant materials.
In the slide clamp of the embodiment of the invention, the first slide fixing bracket 1 can rotate up and down on the connecting rod 3 through rotation to adjust the distance between the first slide fixing bracket and the second slide fixing bracket, so that a plurality of groups of slides can be stably fixed; and also to adjust the relative position of the slide retaining through holes. By designing the sizes of the first and second slide fixing brackets and the number of the slide fixing ports, a large number of slides can be soaked at a time in batches.
In the above embodiment, optionally, the acid-resistant and alkali-resistant material is teflon.
In the slide holder of the embodiment of the invention, the Teflon material is the most commonly used material in acid-resistant and alkali-resistant materials.
In the above embodiment, optionally, the lower surface of the second slide holding bracket 2 is provided with a support portion 4.
In the slide holder of the embodiment of the present invention, the support portion 4 is provided to keep the second slide fixing bracket 2 at a distance from the table top, thereby preventing the slide from being contaminated by the objects on the table top.
2. Design and synthesis of amination modified long-chain probe
The probe modification mode used in the embodiment of the invention has better hybridization effect, the probe is modified in a mode of 5 'amino-C12-dT (n is 10) -probe oligonucleotide chain-3', and the modified amino is bridged with a probe nucleotide sequence body through a long chain with 10 dTTP (thymidylate triphosphate) and a long chain with 12 carbon atoms, so that a long-chain probe is formed, and the steric hindrance effect existing in hybridization is eliminated. The long-chain probe has a longer arm and can be fixedly connected with the surface of the glass slide, so that the long-chain probe has certain advantages for overcoming the steric hindrance generated during the hybridization and enzymatic color development of a long-chain PCR product, and the signal value is obviously improved.
The oligonucleotide chain part in the gene chip probe is required to be complementary with the base of the PCR product chain with biotin label to be hybridized, the length is about 15-30 nucleotides generally, the annealing temperature is 40-60 ℃, and the oligonucleotide chain part belongs to the conserved region of the gene sequence, and the synthesized probe is PAGE pure or HPLC pure. The probe can be synthesized according to the above design by requesting a probe synthesis company to synthesize the probe according to the conventional technique.
In the above examples, the amino group-modified gene chip probes were designed to have either positive strand DNA or negative strand DNA, which could fulfill the detection function of the gene chip.
3. Preparation of microarray chips
Preparation of microarray chips is illustrated by reverse hybridization:
preparing a detection probe spotting fluid, carrying out vortex oscillation and uniform mixing on the detection probe spotting fluid, and spotting the detection probe spotting fluid on a modified chip solid phase carrier body in an array mode on a chip spotting instrument, wherein the detection probe spotting fluid contains 0.5% (g/v) of polyvinyl alcohol (PVA), 5mM of the modified gene chip probe and the balance of PBS buffer solution. After the sample application is finished, the glass slide is placed in a saturated KCI solution, sealed at room temperature overnight and fixed, so that the detection probe is fully combined with the glass slide, the fixed glass slide can be sealed in vacuum, and can be stored for 6-12 months at the temperature of 2-8 ℃ in a dark place.
Besides the above-mentioned probe sample application positions to be detected, a positive quality control probe sample application position and a negative quality control sample application position should be set on each chip respectively to form a microarray of low-density chips, as shown in Table 1Examples are illustrated. One microarray hybridization area of the chip was (5-8) × (5-8) mm2Wherein each probe of the probe to be detected occupies 3 sites, namely 3 parallels are equivalently arranged.
The microarray hybridization region of the chip is not limited to (5-8) × (5-8) mm2And the array of the probe arrangement are not limited to the above-mentioned arrangement, but may be designed according to the specific requirements of the number of genes to be detected or the number of targets.
4. Positive quality control system and negative quality control of the chip:
the positive quality control system consists of a chip positive quality control sample application probe and a biotin modified DNA template, wherein an oligonucleotide chain sequence of the DNA template and an oligonucleotide chain sequence of the probe are subjected to base complementary pairing, and the oligonucleotide chain sequence of the probe is not subjected to non-specific combination with a gene to be detected, for example, a chip for human clinical sample detection can use a conserved sequence from a plant genome or a randomly designed oligonucleotide sequence. The sequences of the spot-application probe with positive quality control and the DNA template selected in the embodiment of the invention are as follows:
wherein, the positive quality control sample application probe is as follows: 5' NH3-ttttttttttCCACATCAGGTTATGCCTTGC，
Wherein, the DNA template sequence corresponding to the positive quality control is as follows: the 5' biotin-GCAAGGCATAACCTGATGTGG, DNA template is modified with biotin, and the oligonucleotide sequence is complementary to the probe base sequence.
The positive quality control sample application probe sequence and the DNA template sequence are modified, but the positive quality control sample application probe sequence and the DNA template selected in the embodiment of the invention have strong binding capacity and strong signal value, so the modification is not needed to be carried out like a probe for detecting a sample to be detected, the bridging part is relatively short, and the specific modification mode is as follows: 5' amino-dT (n ═ 10) -probe oligonucleotide chain-3 ', the probe was bound to the aldehyde group on the chip surface via the 5' amino group. The positive quality control DNA template structure is as follows: 5' Biotin-oligonucleotide chain.
During the chip hybridization reaction, a hybrid of the glass slide-oligonucleotide double strand-biotin is formed, and the subsequent color reaction can be carried out. A schematic diagram of a hybrid formed by the positive control system is shown in FIG. 3.
The structure and the composition of the positive quality control system of the chip are not only suitable for the biological chip with enzymatic color development, but also suitable for the biological chip adopting a fluorescent signal detection technology.
The negative quality control product is prepared into sample application buffer solution by adopting nuclease-free water without a probe or 0.1 percent BSA.
5. Extraction of bacterial genomic DNA from different types of clinical specimens
1) Treating clinical specimens to obtain bacterial pellet concentrates
Different clinical samples are processed to realize effective separation of bacteria from somatic cells and body fluid components, so that thalli are concentrated to improve the unit effective concentration of the bacteria. The treatment of clinical samples for different characteristics is given below:
for a whole blood sample, because the sample contains a large amount of red blood cells, and heme released after the red blood cells are lysed has certain inhibition on subsequent DNA analysis, the operation of the invention for the whole blood sample is as follows: mu.l of anticoagulated blood is taken and 450. mu.l of erythrocyte lysate (the composition of erythrocyte lysate: 0.15M NH)4Cl，10mM KHCO30.1mM EDTA, water, pH7.2-8.0) was mixed by inversion, left to stand for 5 minutes to lyse erythrocytes, centrifuged at 12000rpm for 5 minutes, and the supernatant was discarded by aspiration, the pellet containing the bacterial pellet concentrate.
For cell-free body fluid samples or body fluid samples with only a small number of cells, such as: cerebrospinal fluid, alveolar lavage fluid, hydrothorax and abdominal cavity, etc., the operation of the invention is as follows: a500. mu.l specimen was centrifuged at 12000rpm for 5 minutes, and the supernatant was discarded by aspiration to concentrate the bacterial pellet present in the specimen to obtain a bacterial pellet concentrate.
For samples with low bacteria content, such as urine, the operation of the invention is as follows: 1-5mL of urine is taken, centrifuged at 12000rpm for 5 minutes, and the supernatant is discarded by suction to concentrate bacterial precipitates present in the specimen, thereby obtaining a bacterial precipitate concentrate.
The step carries out different treatments on different clinical samples, and finally, the bacteria are concentrated in the form of precipitates by a centrifugal method, so that the recovery rate of the genomic DNA is improved; while removing most of the liquid components of the human body that are not bacteria-related to reduce the disturbing effects of constituents from the human body on the subsequent processes that may occur.
2) Lysing bacteria to release genomic DNA
The method of combining enzyme degradation and mechanical disruption is adopted to break the cell wall of the bacteria and release the genome DNA of the bacteria. The specific operation is as follows: to the bacterial pellet concentrate obtained in step 1, 200. mu.l of lysozyme (200mg/ml), 10. mu.l of muramidase (10U/. mu.l) and 100mg of glass beads (diameter distribution of 0.1 to 3mm) were added, and cell wall components of the bacteria were disrupted by vortex shaking at 37 ℃ for 30 minutes.
Adding 200 μ l TE buffer containing 0.1-5.0% SDS and 1.0-10mg proteinase K into the specimen with destroyed bacterial cell wall components, mixing well, incubating at 56 deg.C for 10 min to denature and degrade protein components and release bacterial genome DNA to obtain mixed solution.
The lysozyme is adopted in the step to effectively decompose and destroy the cell wall of the bacteria, and the glass beads are also added, so that the cell wall destruction efficiency of the bacteria is improved, and the genome DNA recovery rate of the bacteria is improved. The lysozyme used for cracking the bacterial cell wall does not influence the extraction of the bacterial genome DNA, and the lysozyme used for cracking the bacterial cell wall does not influence the extraction of the fungal genome DNA. In addition, the addition of the denaturant and proteinase K not only promotes the destruction of the bacterial cell membrane, but also promotes the denaturation and degradation of most of the protein components in the bacterial cell into soluble substances with small molecular weight, so that the proteins are separated from the genomic DNA and the genomic DNA is released.
3) The step of separating the bacterial genomic DNA from the mixture can be performed by a conventional method, for example, by separating the bacterial genomic DNA using a silica gel membrane column or magnetic beads, and the method using magnetic beads will be described below.
a. Binding of bacterial genomic DNA to magnetic beads
And (3) adding 600 mu l of binding solution (the binding solution contains 1.0-5.0M of sodium perchlorate, 0.1-4.0M of sodium acetate and water) and 10mg of silicon hydroxyl magnetic beads (the diameter is distributed between 50 and 500nm) into the sample treated in the step (2), and uniformly mixing to combine the DNA with the silicon hydroxyl on the surfaces of the silicon hydroxyl magnetic beads, so that the DNA is combined with the magnetic beads. And (3) placing the sample reagent tube with the magnetic beads on a strong magnetic device (such as a magnetic frame, a magnetic rod and a full-automatic nucleic acid extractor) for 1-5 minutes, and carefully removing liquid parts except the magnetic beads when the magnetic beads are gathered until the sample liquid is transparent and colorless.
In this step, a solution with low pH and high salt (i.e., a binding solution) is added to the specimen to further lyse proteins and membrane substances in the bacterial cells, and to make the genomic DNA more easily precipitated from the solution state and easily bound to the silicon hydroxyl groups in the magnetic beads. Other components are as follows: protein degradation products, inorganic salts, and the like do not bind to the magnetic beads and remain in a solution state. Magnetic beads are magnetically attracted to each other by using a magnetic device such as a magnetic holder, and non-DNA components containing most impurities can be easily absorbed in a solution state.
b. Washing the magnetic beads to remove inorganic and organic impurities
Using 400-.
Using 400-.
The operation was repeated once with the washing solution B.
Through the washing process, residual protein impurities and degradation products, interference salt ions and soluble inhibiting substances in the specimen can be effectively removed. The invention adopts two different washing liquids to wash the magnetic beads combined with the DNA in sequence so as to remove denatured protein degradation products, salt ions and substances which have interference effect on DNA detection, such as medicines, bilirubin and the like, which are not specifically adhered to the surfaces of the magnetic beads, thereby further improving the purity of the DNA-magnetic beads.
c. Elution of bacterial genomic DNA
Adding a proper amount (30-100ul) of nuclease-free water (pH6.5-8.5) into the washed magnetic beads, and soaking the magnetic beads for 1-5 minutes to release and elute the genomic DNA from the magnetic beads. The eluate contains high-purity bacterial genomic DNA, and can be used for subsequent nucleic acid analysis.
6. PCR primer with biotin label and PCR product preparation
The PCR amplification of the target fragment of the bacterial genome DNA can amplify and detect the gene fragment specific to each bacterium, and can also amplify and identify the 16S conserved region specific to the bacterium. The bacterial 16S conserved region is a region that is highly conserved in all bacterial genomes, while the specificity is present in different species of bacteria. The detection of the 16S conserved region of bacteria is therefore a common method for the taxonomic identification of bacteria.
The invention adopts universal primers aiming at the 16S conserved regions of bacteria to amplify genome DNA of different bacteria to obtain 16S PCR products of 16 bacteria, and the size of the PCR product is 1500 bp.
The conventional methods for detecting bacterial 16S are to directly perform sequencing analysis on PCR products or perform other methodological analysis. The PCR product is used for chip hybridization detection, so that, different from the conventional method, the invention adds biotin molecule modification at the 5-terminal base position of the downstream primer of the bacterial universal primer. The PCR primer modified by biotin forms a PCR product modified by biotin through subsequent PCR amplification reaction, and is used as a detection target substance for chip hybridization to participate in subsequent chip hybridization reaction.
Biotin labeling of PCR primers: the method adopts 16S universal PCR primers (common upstream primer: AGAGAGTTTGATCCTGGCTCAG; biotin-labeled downstream primer body: GGYTACCTTGTTACGACTT) of bacteria for 16 bacteria, and the length of PCR product is about 1500 bp. Wherein the downstream primer is labeled with biotin at its 5' end. Primer synthesis and labeling can be accomplished by most commercial synthesis companies, requiring either PAGE or HPLC purification.
Preparing a conventional PCR reaction system by using the biotin-labeled PCR primer and the matched PCR primer on the other side, wherein the PCR amplification conditions are as follows: pre-denaturation, at 95 ℃ for 5 minutes; PCR circulation, denaturation at 95 ℃ for 30 seconds, annealing at 50-60 ℃ for 30 seconds, extension at 72 ℃ for 10-120 seconds, and 30-35 cycles in total; after PCR cycling was complete, extension was carried out at 72 ℃ for 5 minutes. The recommended PCR amplification conditions are: pre-denaturation at 95 ℃ for 5 minutes; and (3) PCR circulation: denaturation at 95 deg.C for 10 s, annealing at 55 deg.C for 15-30 s, and extension at 72 deg.C for 10-120 s for 30-35 cycles; after PCR cycling was complete, extension was carried out at 72 ℃ for 5 minutes. And carrying out PCR amplification on DNA products extracted from clinical samples, wherein the prepared PCR products carry biotin labels.
Hybridization reaction of PCR product with microarray chip
Different bacterial genome DNA templates can form different PCR products through the same group of PCR primers and reaction conditions, the length of each PCR product is about 1500bp, 16 bacteria specific conserved sequences are contained in the PCR products, and the conserved sequences can be specifically combined with probes corresponding to different reaction regions of a chip.
And (4) after the chip is taken out, balancing the chip at room temperature for 5-10 minutes, and carrying out hybridization on the chip after removing water vapor remained on the surface of the glass slide. The hybridization process of the chip can use a commercial hybridization fence special for the slide as a hybridization pool for hybridization reaction, can also use a commercial full-automatic chip hybridization instrument, and can also use conventional laboratory equipment (a slide centrifuge and a constant temperature oscillator) for hybridization operation. The reagents and reaction conditions required for the chip hybridization reaction are provided below:
100 microliters of prehybridization solution (TBST buffer containing 50mM ethanolamine) was added dropwise to the microarray hybridization area of the slide, and soaked for 10 minutes;
chip hybridization: 100 microliter of the PCR product obtained in step 5 was mixed well with a hybridization solution (2-5 XSSC buffer containing 25% formamide), the mixture was dropped on the hybridization area on the chip surface, and hybridization was carried out at 55 ℃ for 60 minutes, the length of the hybridization time was determined by the length of the PCR product, and the longer the fragment of the PCR product, the longer the time was.
Chip cleaning: the chip surface is washed by washing the chip hybridization region 2-3 times with 80-500. mu.l of phosphate buffer.
8. Alkaline phosphatase catalyzed dot method color reaction
In the hybridization reaction area of the chip, 100. mu.l of alkaline phosphatase-labeled streptavidin (1: 1000 volume dilution) was added, incubated at 37 ℃ for 15 minutes, and then washed 1 to 3 times with 200. mu.l of phosphate buffer to remove unbound enzyme.
Adding 100 μ l developing solution containing 0.03% BCIP/0.015% NBT and 2% DMF, incubating at 37 deg.C for 5-30 min, and allowing enzyme to react with the developing solution to form a water-insoluble dark purple precipitate at the binding site. Alkaline phosphatase-streptavidin was bound to the PCR product with biotin, and a color reaction was performed.
The color reaction was stopped by washing 1-2 times with 200. mu.l of phosphate buffer.
The hybridization and color development reaction of the PCR product and the chip is not the only hybridization and color development way, and the detection purpose of the gene chip can be realized by adopting other hybridization and color development systems, such as using different chemical reagents and optimizing the dosage.
9. Detection result identification method
The reaction result can be interpreted by using a full-automatic or semi-automatic chip reading device capable of identifying purple spots. The method for identifying the detection result does not specify the detection equipment of a specific manufacturer, and can be implemented by using certain conventional laboratory equipment such as heat preservation equipment, blending equipment, a magnifying glass, a camera and the like. The judgment of the chip result can be completed more efficiently by using fully-automatic equipment.
Example 216 detection results of pathogenic bacterium chips
1. The preparation of the aldehyde modified microarray chip carrier was performed in the manner described in example 1.
2. Design and synthesis of the amination modified long-chain probe. In this example, 16 common pathogenic bacteria were detected, and the 16 pathogenic bacteria were summarized and concluded based on the clinical incidence of bacteria over the years, and there may be some cross-over, but not complete coincidence, with the total number and species of bacteria detected by other inventions or methods. The 16 common pathogenic bacteria and possible clinical associated symptoms are detected, and the long-chain probe of C12-dT (n-10) is adopted aiming at 16 bacteria, and the unmodified DNA probe sequence body is shown as follows.
3. Preparation of microarray chips
Preparing a detection probe spotting fluid, carrying out vortex oscillation and uniform mixing on the detection probe spotting fluid, and spotting the detection probe spotting fluid on a modified chip solid phase carrier body in an array mode on a chip spotting instrument, wherein the detection probe spotting fluid contains 0.5% (g/v) of polyvinyl alcohol (PVA), 5mM of the modified gene chip probe and the balance of PBS buffer solution. After the sample application is finished, the glass slide is placed in a saturated KCI solution, sealed at room temperature overnight and fixed, so that the detection probe is fully combined with the glass slide, the fixed glass slide can be sealed in vacuum, and can be stored for 6-12 months at the temperature of 2-8 ℃ in a dark place.
Besides the probe sample application positions to be detected, a positive quality control probe sample application position and a negative quality control sample application position are respectively arranged on each chip to form a microarray of a low-density chip, which is explained by the example in table 1. One microarray hybridization area of the chip was (5-8) × (5-8) mm2Wherein each probe of the probe to be detected occupies 3 sitesI.e. equivalent to arranging 3 parallels.
Table 116 probe microarray spotting layout of bacterial DNA chips:
wherein the items corresponding to different numbers:
| chip site numbering | Corresponding item | Classification | Results |
| (1) | Acinetobacter baumannii sites | Gram-negative | Positive/negative |
| (2) | Klebsiella pneumoniae locus | Gram-negative | Positive/negative |
| (3) | Escherichia coli locus | Gram-negative | Positive/negative |
| (4) | Pseudomonas aeruginosa loci | Gram-negative | Positive/negative |
| (5) | Staphylococcus aureus sites | Gram positive | Positive/negative |
| (6) | Stenotrophomonas maltophilia loci | Gram-negative | Positive/negative |
| (7) | Enterococcus faecium sites | Gram positive | Positive/negative |
| (8) | Streptococcus pneumoniae loci | Gram positive | Positive/negative |
| (9) | Enterococcus faecalis sites | Gram positive | Positive/negative |
| (10) | Haemophilus influenzae sites | Gram-negative | Positive/negative |
| (11) | Listeria monocytogenes sites | Gram positive | Positive/negative |
| (12) | Neisseria meningitidis sites | Gram-negative | Positive/negative |
| (13) | Burkholderia cepacia loci | Gram-negative | Positive/negative |
| (14) | Streptococcus agalactiae sites | Gram positive | Positive/negative |
| (15) | Mycobacterium species | ----- | Positive/negative |
| (16)(17)(18) | Coagulase-negative staphylococci | Gram positive | Positive/negative |
| P1 | Positive quality control site | —— | Positive for |
| P2 | Universal bacterial site | —— | Positive/negative |
| G+ | Gram-positive bacterial site | Gram positive | Positive/negative |
| G- | Gram negative bacterial site | Gram-negative | Positive/negative |
| N | Negative quality control site | —— | Negative of |
Wherein: p1 is the positive quality control probe site of the chip; p2 is a bacterial universal probe site; g + is a general probe site of gram-positive bacteria; g-is a universal probe site for gram-negative bacteria; n is a negative quality control probe site; 1-18 are DNA probes for the bacterial species listed in the above table, respectively.
4. Quality control system of chip:
in addition to the positive quality control and the negative quality control in example 1, a general probe for bacteria, a general probe for gram-positive bacteria, and a general probe for gram-negative bacteria were provided in this example.
1) The positive quality control sample application probe comprises: 5' NH3ttttttttttCCACATCAGGTTATGCCTTGC, wherein the DNA template sequence corresponding to the positive quality control is: the 5' biotin-GCAAGGCATAACCTGATGTGG, DNA template is modified with biotin, and the oligonucleotide sequence is complementary to the probe base sequence.
2) The negative quality control material adopts nuclease-free water without a probe or 0.1 percent BSA to prepare sample application buffer solution.
3) General bacterial types: the method adopts a universal probe of the 16S gene of the bacteria to carry out primary classification on the detected bacteria. The probe site is located in the conserved region of the 16S gene of the bacteria and can be used as a specific probe of all bacteria. The probes and the modification modes of the universal type site P2 of the bacteria are as follows: 5-NH3-C12-TTTTTTTTTT-AACAGGATTAGATACCCTGGTAGTCCA。
4) Gram stain positive/negative probe site (G +/G-): specific gram-positive and gram-negative specific probe sites are arranged in a conserved region of a 16S gene of the bacteria, and the gram staining characteristics of different bacteria are classified respectively. The 16 pathogenic bacteria described in the method, except for mycobacteria, each bacteria has a unique gram stain classification.
Wherein, the DNA probe sequence corresponding to the gram staining positive locus (G +) is as follows:
5-NH3-C12-TTTTTTTTTT-GATGACGTCAAATCATCATGCCCCTTATG；
the DNA probe sequence corresponding to gram stain negative site (G-) is as follows:
5-NH3-C12-TTTTTTTTTT-CTGATGCAGCCATGCCGCGTGTGAAG。
5. extraction of bacterial genomic DNA from different types of samples
| Pathogenic bacteria | Origin of origin | Detecting the concentration |
| Acinetobacter baumannii | Urine (urinary incontinence) | 7.20×104 |
| Klebsiella pneumoniae | Alveolar lavage fluid | 2.40×104 |
| Escherichia coli | Urine (urinary incontinence) | 7.80×104 |
| Pseudomonas aeruginosa | Alveolar lavage fluid | 3.30×104 |
| Staphylococcus aureus | Blood, blood-enriching agent and method for producing the same | 1.11×104 |
| Stenotrophomonas maltophilia | Alveolar lavage fluid | 9.60×104 |
| Enterococcus faecium | Urine (urinary incontinence) | 3.30×104 |
| Streptococcus pneumoniae | Alveolar lavage fluid | 7.50×104 |
| Enterococcus faecalis | Urine (urinary incontinence) | 5.10×104 |
| Haemophilus influenzae | Cerebrospinal fluid | 5.70×104 |
| Listeria monocytogenes | Blood, blood-enriching agent and method for producing the same | 8.40×104 |
| Neisseria meningitidis | Cerebrospinal fluid | 1.02×104 |
| Burkholderia cepacia | Blood, blood-enriching agent and method for producing the same | 2.70×104 |
| Streptococcus agalactiae | Blood, blood-enriching agent and method for producing the same | 4.50×104 |
| Mycobacterium tuberculosis | Cerebrospinal fluid | 2.70×104 |
| Coagulase-negative staphylococci | Urine (urinary incontinence) | 1.14×104 |
The samples were treated according to the contents of example 1 according to their origin to obtain the DNA genomes of the corresponding bacteria.
6. PCR primer with biotin label and PCR product preparation
The preparation was carried out according to the conditions described in step 6 of example 1.
Hybridization reaction of PCR product with microarray chip
The preparation was carried out according to the conditions described in step 7 of example 1.
8. Alkaline phosphatase catalyzed dot method color reaction
The preparation was carried out according to the conditions described in step 8 of example 1.
9. Detection result identification method
The chip was placed horizontally in a chip slot of a chip reader (model: BD-2.0, manufactured by Shanghai Baiao science and technology, Ltd.), with the barcode side facing up, and a chip scanning program was run to scan the results at each site of the chip, with the following signal values.
1) Acinetobacter baumannii
| 200 | 210 | 201 | 169 | 189 | 163 | 0 | 0 | 0 | 0 | 0 | 0 |
| 192 | 208 | 192 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 218 | 229 | 229 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 200 | 229 | 207 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 226 | 224 | 214 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 213 | 218 | 205 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 208 | 217 | 210 | 176 | 161 | 179 | 0 | 0 | 0 | 173 | 183 | 168 |
| 211 | 228 | 227 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the general probe sites for bacteria, the general probe sites for gram-negative bacteria and the specific probe sites for Acinetobacter baumannii display signal values, and other sites do not display signal values, which is consistent with the actual situation.
2) Klebsiella pneumoniae
| 200 | 213 | 204 | 0 | 0 | 0 | 179 | 173 | 187 | 0 | 0 | 0 |
| 204 | 217 | 218 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 206 | 211 | 219 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 198 | 194 | 203 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 224 | 194 | 206 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 212 | 208 | 215 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 210 | 224 | 213 | 188 | 167 | 176 | 0 | 0 | 0 | 164 | 176 | 171 |
| 222 | 209 | 224 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table, all the positive quality control probe sites, the bacterial universal probe sites, the gram-negative bacteria universal probe sites and the Klebsiella pneumoniae specific probe sites display signal values, and other sites do not display signal values, which is consistent with the actual situation.
3. Escherichia coli
| 228 | 230 | 202 | 0 | 0 | 0 | 0 | 0 | 0 | 189 | 168 | 174 |
| 207 | 229 | 211 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 225 | 224 | 209 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 229 | 224 | 199 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 210 | 223 | 220 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 222 | 220 | 210 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 220 | 220 | 208 | 173 | 171 | 182 | 0 | 0 | 0 | 168 | 189 | 163 |
| 201 | 223 | 198 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-negative bacteria universal probe sites and the Escherichia coli specific probe sites show signal values, and other sites do not show signal values, which is consistent with the actual situation.
4. Pseudomonas aeruginosa
| 223 | 213 | 219 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 214 | 193 | 217 | 173 | 187 | 165 | 0 | 0 | 0 | 0 | 0 | 0 |
| 226 | 214 | 225 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 214 | 216 | 198 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 197 | 227 | 208 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 223 | 209 | 215 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 230 | 207 | 211 | 173 | 186 | 171 | 0 | 0 | 0 | 179 | 165 | 187 |
| 198 | 195 | 210 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-negative bacterial universal probe sites and the pseudomonas aeruginosa specific probe sites show signal values, and other sites do not show signal values, which is consistent with the actual situation.
5. Staphylococcus aureus
| 228 | 192 | 213 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 00 |
| 216 | 224 | 193 | 0 | 0 | 0 | 184 | 174 | 177 | 0 | 00 |
| 224 | 208 | 217 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 00 |
| 209 | 203 | 229 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 00 |
| 208 | 205 | 212 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 00 |
| 210 | 217 | 227 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 00 |
| 224 | 208 | 220 | 189 | 174 | 164 | 172 | 190 | 182 | 0 | 00 |
| 209 | 208 | 225 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 00 |
As shown in the table, all the positive quality control probe sites, the bacterial universal probe sites, the gram-positive bacterial universal probe sites and the staphylococcus aureus specific probe sites display signal values, and other sites do not display signal values, which is consistent with the actual situation.
6. Stenotrophomonas maltophilia
| 215 | 221 | 215 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 229 | 194 | 229 | 0 | 0 | 0 | 0 | 0 | 0 | 161 | 184 | 172 |
| 205 | 214 | 229 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 200 | 198 | 198 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 225 | 199 | 221 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 196 | 208 | 218 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 204 | 193 | 191 | 182 | 176 | 175 | 0 | 0 | 0 | 165 | 173 | 175 |
| 219 | 213 | 205 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the general probe sites for bacteria, the general probe sites for gram-negative bacteria and the specific probe sites for stenotrophomonas maltophilia show signal values, and other sites do not show signal values, which is consistent with the actual situation.
7. Enterococcus faecium
| 224 | 210 | 225 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 202 | 194 | 201 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 218 | 195 | 225 | 170 | 165 | 172 | 0 | 0 | 0 | 0 | 0 | 0 |
| 208 | 206 | 190 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 201 | 205 | 193 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 199 | 217 | 226 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 207 | 229 | 200 | 184 | 166 | 179 | 184 | 187 | 176 | 0 | 0 | 0 |
| 218 | 204 | 215 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-positive bacterial universal probe sites and the enterococcus faecium specific probe sites show signal values, and other sites do not show signal values, which is consistent with the actual situation.
8. Streptococcus pneumoniae
| 228 | 213 | 214 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 202 | 217 | 198 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 197 | 205 | 218 | 0 | 0 | 0 | 166 | 170 | 184 | 0 | 0 | 0 |
| 199 | 229 | 208 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 192 | 212 | 206 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 218 | 208 | 229 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 199 | 229 | 225 | 175 | 175 | 186 | 162 | 162 | 169 | 0 | 0 | 0 |
| 192 | 229 | 198 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-positive bacterial universal probe sites and the streptococcus pneumoniae specific probe sites show signal values, and other sites do not show signal values, which is consistent with the actual situation.
9. Enterococcus faecalis
| 230 | 213 | 208 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 208 | 217 | 226 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 217 | 227 | 222 | 0 | 0 | 0 | 0 | 0 | 0 | 187 | 193 | 188 |
| 210 | 219 | 202 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 219 | 208 | 223 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 223 | 192 | 209 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 197 | 211 | 224 | 183 | 168 | 178 | 180 | 163 | 180 | 0 | 0 | 0 |
| 191 | 214 | 202 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table, all the positive quality control probe sites, the bacterial universal probe sites, the gram-positive bacterial universal probe sites and the enterococcus faecalis specific probe sites display signal values, and other sites do not display signal values, which is consistent with the actual situation.
10. Haemophilus influenzae
| 215 | 191 | 200 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 208 | 223 | 210 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 228 | 193 | 194 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 197 | 229 | 202 | 195 | 174 | 176 | 0 | 0 | 0 | 0 | 0 | 0 |
| 219 | 205 | 205 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 204 | 192 | 203 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 215 | 225 | 198 | 185 | 180 | 184 | 0 | 0 | 0 | 187 | 190 | 193 |
| 214 | 219 | 202 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-negative bacterial universal probe sites and the haemophilus influenzae specific probe sites show signal values, and other sites do not show signal values, which is consistent with the actual situation.
11. Listeria monocytogenes
| 194 | 223 | 204 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 197 | 229 | 193 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 221 | 212 | 197 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 227 | 214 | 192 | 0 | 0 | 0 | 205 | 197 | 182 | 0 | 0 | 0 |
| 204 | 207 | 225 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 225 | 201 | 230 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 201 | 216 | 199 | 181 | 191 | 187 | 182 | 193 | 198 | 0 | 0 | 0 |
| 217 | 225 | 218 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-positive bacterial universal probe sites and the listeria monocytogenes specific probe sites display signal values, and other sites do not display signal values, which is consistent with the actual situation.
12. Neisseria meningitidis
| 197 | 225 | 209 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 191 | 192 | 196 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 194 | 209 | 213 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 190 | 229 | 199 | 0 | 0 | 0 | 0 | 0 | 0 | 196 | 195 | 190 |
| 227 | 209 | 201 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 214 | 215 | 204 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 195 | 196 | 192 | 184 | 192 | 196 | 0 | 0 | 0 | 194 | 186 | 187 |
| 212 | 200 | 205 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the general probe sites for bacteria, the general probe sites for gram-negative bacteria and the specific probe sites for Neisseria meningitidis show signal values, and other sites do not show signal values, which is consistent with the actual situation.
13. Burkholderia cepacia
| 230 | 211 | 213 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 207 | 218 | 195 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 195 | 214 | 225 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 209 | 211 | 199 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 205 | 223 | 198 | 186 | 191 | 198 | 0 | 0 | 0 | 0 | 0 | 0 |
| 191 | 211 | 204 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 220 | 228 | 229 | 187 | 184 | 184 | 0 | 0 | 0 | 183 | 188 | 174 |
| 195 | 206 | 191 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the general probe sites for bacteria, the general probe sites for gram-negative bacteria and the specific probe sites for Burkholderia cepacia show signal values, and other sites do not show signal values, which is consistent with the actual situation.
14. Streptococcus agalactiae
| 199 | 206 | 216 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 218 | 195 | 192 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 222 | 220 | 222 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 209 | 211 | 201 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 190 | 190 | 220 | 0 | 0 | 0 | 194 | 180 | 184 | 0 | 0 | 0 |
| 221 | 217 | 225 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 194 | 203 | 199 | 188 | 187 | 187 | 178 | 187 | 175 | 0 | 0 | 0 |
| 195 | 202 | 207 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-positive bacterial universal probe sites and the streptococcus agalactiae specific probe sites show signal values, and other sites do not show signal values, which is consistent with the actual situation.
15. Mycobacterium tuberculosis
| 196 | 214 | 210 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 213 | 228 | 206 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 216 | 213 | 192 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 210 | 192 | 219 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 201 | 212 | 216 | 0 | 0 | 0 | 0 | 0 | 0 | 183 | 190 | 192 |
| 222 | 219 | 196 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 194 | 222 | 208 | 182 | 183 | 187 | 0 | 0 | 0 | 0 | 0 | 0 |
| 214 | 214 | 214 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table, all the positive quality control probe sites, the bacterial universal probe sites and the mycobacterium tuberculosis specific probe sites display signal values, and other sites do not display signal values, which is consistent with the actual situation. Mycobacterium tuberculosis is neither a gram-negative nor a gram-positive bacterium.
16. Coagulase-negative staphylococci
| 209 | 195 | 208 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 216 | 221 | 229 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 202 | 206 | 204 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 220 | 221 | 203 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 209 | 209 | 199 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| 195 | 206 | 207 | 188 | 199 | 196 | 0 | 0 | 0 | 0 | 0 | 0 |
| 207 | 225 | 203 | 188 | 189 | 183 | 174 | 179 | 184 | 0 | 0 | 0 |
| 219 | 209 | 208 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
As shown in the table above, all the positive quality control probe sites, the bacterial universal probe sites, the gram-positive bacterial universal probe sites and the coagulase-negative staphylococcus specific probe sites display signal values, and other sites do not display signal values, which is consistent with the actual situation.
Example 3
On the aldehyde silica slide, prepare the bacterial chip by the method of example 2 in the form of 8 × 12 microarray, spot the fecal enterobacter probe, chip positive quality control probe, bacterial general probe, gram stain positive probe, gram stain negative probe on the corresponding microarray position.
The enterobacter faecalis probe adopts two forms respectively, wherein I is a conventional 5 'amino-dT (n ═ 10) -oligonucleotide probe, II is a 5' amino-C12-dT (n ═ 10) -oligonucleotide probe designed by the invention, and concretely is a enterobacter faecalis specific probe I:5-NH3-dT (n ═ 10) -TCGTTAGTACATGAACGTCCCCTG. Fecal enterobacter specific probe II: 5-NH3-C12-dT(n＝10)-TCGTTAGTACATGAACGTCCCCTG。
Two different enterobacter faecalis probes are spotted and fixed respectively, a biotin-labeled enterobacter faecalis 16S long-chain PCR amplification product (1500bp, the product is used for PCR amplification by an ordinary upstream primer AGAGAGTTTGATCCTGGCTCAG and a biotin-labeled downstream primer GGYTACCTTGTTACGACTT which are carried out in a conventional PCR system) is added for chip hybridization, after alkaline phosphatase enzymatic reaction color development is carried out according to the method in example 1, the chip is horizontally placed into a chip groove of a chip recognizer, one side of a bar code faces upwards, a chip scanning program is operated, results of each site of the chip are scanned, and the signal values generated by the 2 probes are tested and compared.
When the results of the chip positive quality control probe, the bacteria universal probe, the gram stain positive probe, and the gram stain negative probe all match, the fecal bacillus chip detection results using the 5 'amino-dT (n-10) -oligonucleotide probe (I) showed that the fecal bacillus specific probes at the three spotting sites had signal values of 126, 112, and 116, respectively, and the fecal bacillus chip detection results using the 5' amino-C12-dT (n-10) -oligonucleotide probe (II) showed that the fecal bacillus specific probes at the three spotting sites had signal values of 186, 187, and 191, respectively.
Wherein the signal value at the site of the enterococcus faecalis specific probe (I) modified with conventional dT (n ═ 10) is significantly lower than that of the enterococcus faecalis specific probe (II) modified with C12-dT (n ═ 10). Therefore, the probe modification method adopted by the invention is superior to the conventional probe modification mode for the chip hybridization signal of the long-chain PCR product.
Finally, it should be noted that: the above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical solutions described in the foregoing embodiments may still be modified, or some technical features may be equivalently replaced; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions of the embodiments of the present invention.
Claims (10)
1. A microarray chip capable of detecting genomic DNAs of a plurality of bacteria, comprising: the method comprises the following steps:
a chip solid phase carrier body;
and, distributed in an array and covalently bonded to said chip supportA modified gene chip probe of a phase carrier body, the modified gene chip probe comprising the following structure according to the 5 '-3' direction: 5' modifying group-Cn-(dT)m-an oligonucleotide strand 3', wherein: the oligonucleotide chain represents the nucleotide sequence body of the gene chip probe, (dT)mRepresents m dT, said CnThe modified group is a linear alkyl group with n carbon atoms, the 5' modified group can perform chemical reaction with a group modified on the surface of the solid phase carrier body of the chip to form covalent bond connection, m is more than or equal to 8 and less than or equal to 15, and n is more than or equal to 5 and less than or equal to 15; alternatively, m is 10, n is 12;
the oligonucleotide chain is selected from nucleotide sequences of specific regions of genome DNA of two or more bacteria selected from acinetobacter baumannii, klebsiella pneumoniae, escherichia coli, pseudomonas aeruginosa, staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, streptococcus pneumoniae, enterococcus faecalis, haemophilus influenzae, listeria monocytogenes, neisseria meningitidis, burkholderia cepacia, streptococcus agalactiae, mycobacterium tuberculosis and coagulase-negative staphylococcus or complementary sequences thereof.
2. A method for preparing a microarray chip capable of detecting genomic DNAs of a plurality of bacteria, comprising: the method comprises the following steps:
1) modifying the solid phase carrier body of the chip to enable the solid phase carrier body to perform chemical reaction with a modified group of the modified gene chip probe to form covalent bond connection;
2) synthesizing a modified gene chip probe, wherein the modified gene chip probe comprises the following structures according to the 5 '-3' direction: 5' modifying group-Cn-(dT)m-an oligonucleotide strand 3', wherein: the oligonucleotide chain represents the nucleotide sequence body of the gene chip probe, (dT)mRepresents m dT, said CnThe modified group is a linear alkyl group with n carbon atoms, the 5' modified group can perform chemical reaction with a group modified on the surface of the solid phase carrier body of the chip to form covalent bond connection, m is more than or equal to 8 and less than or equal to 15, and n is more than or equal to 5 and less than or equal to 15; alternatively, m is 10, n is 12; the oligonucleotide chain is selected from Bowman's immobilityNucleotide sequences or complementary sequences thereof of specific regions of genomic DNA of two or more bacteria selected from the group consisting of Bacillus, Klebsiella pneumoniae, Escherichia coli, Pseudomonas aeruginosa, Staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, Streptococcus pneumoniae, enterococcus faecalis, Haemophilus influenzae, Listeria monocytogenes, Neisseria meningitidis, Burkholderia cepacia, Streptococcus agalactiae, Mycobacterium tuberculosis, and coagulase-negative staphylococci;
3) preparing detection probe spotting fluid, carrying out vortex oscillation and uniform mixing on the detection probe spotting fluid, and spotting the detection probe spotting fluid on the modified chip solid phase carrier body in an array mode on a chip spotting instrument.
3. The microarray chip according to claim 1 or the production method according to claim 2, characterized in that: the 16 modified gene chip probes have 16 kinds, and the oligonucleotide chains in the 16 modified gene chip probes are respectively the nucleotide sequences of specific regions of genome DNA of acinetobacter baumannii, klebsiella pneumoniae, escherichia coli, pseudomonas aeruginosa, staphylococcus aureus, stenotrophomonas maltophilia, enterococcus faecium, streptococcus pneumoniae, enterococcus faecalis, haemophilus influenzae, listeria monocytogenes, neisseria meningitidis, burkholderia cepacia, streptococcus agalactiae, mycobacterium tuberculosis and coagulase-negative staphylococcus or complementary sequences thereof.
4. The microarray chip according to claim 3 or the production method according to claim 3, characterized in that: the chip solid phase carrier body is a silicon dioxide glass slide.
5. The microarray chip according to claim 4 or the production method according to claim 4, characterized in that: the modification of the chip solid phase carrier body is hydroformylation modification, and the modification group on the gene chip probe is amino.
6. The microarray chip of claim 1, wherein: the kit also comprises a positive quality control probe, a negative quality control probe, a bacteria universal probe, a gram staining positive probe and a gram staining negative probe which are distributed in an array mode.
7. The method of claim 2, wherein: further comprising the steps of: preparing the sample solution of a positive quality control probe, a negative quality control probe, a bacteria universal probe, a gram-staining positive probe and a gram-staining negative probe, and carrying out sample application on the modified chip solid-phase carrier body in an array mode on a chip sample application instrument.
8. The method of claim 5, wherein the step of washing and/or acid-base treating the chip solid phase carrier body is performed before modifying the chip solid phase carrier body, and a slide holder is used for washing and/or acid-base treating, and the slide holder comprises:
the first glass slide fixing bracket is provided with a threaded through hole between the upper surface and the lower surface, and a glass slide fixing port between the upper surface and the lower surface;
the upper surface of the second glass slide fixing bracket is provided with a glass slide fixing groove corresponding to the position of the glass slide fixing port;
one end of the connecting rod is fixedly connected to the upper surface of the second glass slide fixing bracket, so that the connecting rod is perpendicular to the second glass slide fixing bracket, the outer surface of the connecting rod is provided with threads matched with the threads of the threaded through hole, and the other end of the connecting rod penetrates through the threaded through hole to fixedly connect the first glass slide fixing bracket and the second glass slide fixing bracket;
the slide glass clamp is made of acid-resistant and alkali-resistant materials.
9. The method of claim 5, wherein the detection probe solution comprises 0.1-1% polyvinyl alcohol, 0.1-10mM modified gene chip probe, and the balance PBS buffer.
10. An assay method using a microarray chip, comprising the steps of:
1) extraction of bacterial genomic DNA from samples: processing the sample to obtain a bacterial pellet concentrate; adding lysozyme, muramidase and glass beads, destroying cell wall components of bacteria, then denaturing and degrading protein to fully release genome DNA of the bacteria, and separating the genome DNA of the bacteria;
2) preparing a PCR primer with a biotin label;
3) preparation of PCR products with Biotin labels: carrying out PCR reaction by taking the bacterial genome DNA in the step 1) as a template and the primer in the step 2 as a primer;
4) hybridizing the PCR product with biotin label with the microarray chip of claim 1 or the microarray chip prepared by the preparation method of claim 2;
5) developing the color of the hybridization product on the microarray chip;
6) detecting a color development result;
the biotin-labeled PCR primer is complementary with the base of the oligonucleotide chain in the gene chip probe; optionally, the PCR primer with the biotin label is a 16S universal PCR primer of bacteria; further alternatively, common upstream primers in the bacterial 16S universal PCR primers are: AGAGTTTGATCCTGGCTCAG; biotin-labeled downstream primer ontology: GGYTACCTTGTTACGACTT are provided.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911116943.XA CN110923338A (en) | 2019-11-15 | 2019-11-15 | Microarray chip capable of detecting various bacterial genome DNAs and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911116943.XA CN110923338A (en) | 2019-11-15 | 2019-11-15 | Microarray chip capable of detecting various bacterial genome DNAs and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN110923338A true CN110923338A (en) | 2020-03-27 |
Family
ID=69853065
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911116943.XA Pending CN110923338A (en) | 2019-11-15 | 2019-11-15 | Microarray chip capable of detecting various bacterial genome DNAs and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923338A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214393A (en) * | 2021-12-30 | 2022-03-22 | 上海百傲科技股份有限公司 | Universal nucleic acid microarray chip and detection method |
| CN117363767A (en) * | 2023-12-07 | 2024-01-09 | 上海美吉生物医药科技有限公司 | Probe combination, primer set and kit for real-time fluorescence PCR detection of target genes and application of probe combination and primer set and kit |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101160414A (en) * | 2005-01-18 | 2008-04-09 | 代夫特诊断实验室公司 | Detection method and materials therefor |
| CN101241097A (en) * | 2007-09-18 | 2008-08-13 | 中国科学院上海应用物理研究所 | Electrochemical DNA detection method adopting stem-loop structure for detecting probe, and reagent kit thereof |
| CN102031306A (en) * | 2010-11-04 | 2011-04-27 | 中国科学院上海微系统与信息技术研究所 | Oligonucleotides chain-based mercury ion fluorescent detection chip, manufacturing method thereof and using method thereof |
| CN102676646A (en) * | 2012-01-31 | 2012-09-19 | 康熙雄 | Reverse dot-blot hybridization gene chip and production method thereof |
| CN107287311A (en) * | 2017-07-06 | 2017-10-24 | 中国人民解放军总医院 | Pneumonia pathogenic bacteria quickly recognize genetic chip |
| CN208223930U (en) * | 2018-06-08 | 2018-12-11 | 南通市第二人民医院 | A kind of rotary pathology staining rack |
-
2019
- 2019-11-15 CN CN201911116943.XA patent/CN110923338A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101160414A (en) * | 2005-01-18 | 2008-04-09 | 代夫特诊断实验室公司 | Detection method and materials therefor |
| CN101241097A (en) * | 2007-09-18 | 2008-08-13 | 中国科学院上海应用物理研究所 | Electrochemical DNA detection method adopting stem-loop structure for detecting probe, and reagent kit thereof |
| CN102031306A (en) * | 2010-11-04 | 2011-04-27 | 中国科学院上海微系统与信息技术研究所 | Oligonucleotides chain-based mercury ion fluorescent detection chip, manufacturing method thereof and using method thereof |
| CN102676646A (en) * | 2012-01-31 | 2012-09-19 | 康熙雄 | Reverse dot-blot hybridization gene chip and production method thereof |
| CN107287311A (en) * | 2017-07-06 | 2017-10-24 | 中国人民解放军总医院 | Pneumonia pathogenic bacteria quickly recognize genetic chip |
| CN208223930U (en) * | 2018-06-08 | 2018-12-11 | 南通市第二人民医院 | A kind of rotary pathology staining rack |
Non-Patent Citations (5)
| Title |
|---|
| QINGSHENG GUO等: "Hybridization chain reaction on silica coated Qbeads for colorimetric detection of multiplex microRNAs", 《CHEM. COMMUN.》 * |
| 张英朗等: "常见角膜致病真菌基因芯片检测方法的实验", 《中国组织工程研究与临床康复》 * |
| 毛红菊等: "利用基因芯片快速检测多种临床常见致病菌及其耐药性基因", 《中华传染病杂志》 * |
| 马文丽: "《分子生物学实验手册》", 30 June 2011, 人民军医出版社 * |
| 鲁艳芹等: "利用寡核苷酸芯片检测乙型肝炎病毒基因突变", 《中华微生物学和免疫学杂志》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114214393A (en) * | 2021-12-30 | 2022-03-22 | 上海百傲科技股份有限公司 | Universal nucleic acid microarray chip and detection method |
| CN117363767A (en) * | 2023-12-07 | 2024-01-09 | 上海美吉生物医药科技有限公司 | Probe combination, primer set and kit for real-time fluorescence PCR detection of target genes and application of probe combination and primer set and kit |
| CN117363767B (en) * | 2023-12-07 | 2024-04-05 | 上海美吉生物医药科技有限公司 | Probe combination, primer set and kit for real-time fluorescence PCR detection of target genes and application of probe combination and primer set and kit |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11060082B2 (en) | Polynucleotide capture materials, and systems using same | |
| US10829805B2 (en) | Amplified nucleic acid detection method and detection device | |
| EP2843058B1 (en) | Method for amplifying nucleic acid and method for detecting amplified nucleic acid | |
| JP2002543980A (en) | Mixed bed solid phase and its use in nucleic acid isolation | |
| JP2008054660A (en) | Filter device for isolating nucleic acid | |
| CN110923338A (en) | Microarray chip capable of detecting various bacterial genome DNAs and preparation method thereof | |
| CN110863037A (en) | Microarray chip capable of detecting various fungal genome DNAs (deoxyribonucleic acids) and preparation method thereof | |
| CN109415721B (en) | Primer group, kit and method for detecting more than 2 target nucleic acids | |
| US20240025929A1 (en) | Methods and devices for ultrasensitive direct detection of microorganisms | |
| EP0235727A2 (en) | Rapid dna test for microbes | |
| Mamaev et al. | Method for automated extraction and purification of nucleic acids and its implementation in microfluidic system | |
| JP4831725B2 (en) | Simple nucleic acid extraction method | |
| CN110982913A (en) | Modified gene chip probe, preparation method thereof and microarray chip using gene chip probe | |
| AU2018202375B2 (en) | Polynucleotide capture materials, and methods of using same | |
| AU2023282224A1 (en) | Polynucleotide capture materials, and methods of using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20200327 |