CN110923318B - Marker for predicting neoadjuvant chemotherapy curative effect in breast cancer patient and application thereof - Google Patents
Marker for predicting neoadjuvant chemotherapy curative effect in breast cancer patient and application thereof Download PDFInfo
- Publication number
- CN110923318B CN110923318B CN201911254411.2A CN201911254411A CN110923318B CN 110923318 B CN110923318 B CN 110923318B CN 201911254411 A CN201911254411 A CN 201911254411A CN 110923318 B CN110923318 B CN 110923318B
- Authority
- CN
- China
- Prior art keywords
- breast cancer
- abtb2
- epirubicin
- chemotherapy
- neoadjuvant chemotherapy
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/172—Haplotypes
Abstract
The invention provides rs6484711 as a marker for predicting the curative effect of breast cancer neoadjuvant chemotherapy, and proves that rs6484711 variant participates in the resistance of tumor cells to neoadjuvant chemotherapy containing epirubicin and docetaxel by regulating ABTB2 expression. This contributes to the personalized treatment of neoadjuvant chemotherapy and is expected to be the target of development of new therapeutic drugs.
Description
Technical Field
The invention belongs to the field of cancers, and particularly relates to a marker for predicting the curative effect of neoadjuvant chemotherapy in a breast cancer patient and application thereof, in particular to the curative effect of luminal breast cancer on neoadjuvant chemotherapy containing epirubicin and docetaxel.
Background
Breast Cancer (BC) is the most common malignancy in women, accounting for approximately 25.2% of global cancer cases and 14.7% of global cancer-related deaths. Early breast cancer is considered curable. Neoadjuvant chemotherapy (NAC) increases breast cancer milk retention and also provides surgical opportunities for partially inoperable patients, and has become the standard treatment for patients with locally advanced breast cancer. Complete remission of pathology (pCR) was proposed as the most common clinical observation endpoint in neoadjuvant therapy and was associated with long-term survival of patients. HER-2 positive and triple negative breast cancers, the pCR rate can reach 60 percent or higher, but the Luminal type breast cancers are lower.
Luminal-type breast cancer is a highly endocrine-responsive disease, Estrogen Receptor (ER) positive and human epidermal growth factor receptor 2(HER-2) negative, accounting for 70% of all BC. Despite the lower pCR rates of luminel-type breast cancer, some patients may benefit from neoadjuvant chemotherapy. In addition, many breast cancer patients receiving chemotherapy develop resistance to chemotherapeutic drugs, and the underlying mechanism is not well defined. At present, no clear new auxiliary chemotherapy curative effect prediction biomarker exists, and potential people who can benefit from chemotherapy cannot be judged, which may be one of the reasons for poor response of patients to drug treatment. The status of ER and PR receptors is one of the main predictive markers of clinical efficacy. Due to the existence of individual differences, it is important to identify more effective markers to select a more rational patient treatment regimen.
Currently, the regimen containing epirubicin and docetaxel is the cornerstone of breast cancer chemotherapy. However, as mentioned above, resistance to chemotherapeutic drugs is a key challenge in the treatment of breast cancer, especially Luminal-type breast cancer, which accounts for the majority of breast cancer. The response of breast cancer cells to epirubicin is closely related to the effectiveness of the treatment, which in turn affects the choice of treatment regimen and affects the prognosis of the patient. The regulatory process of chemotherapeutic drug sensitivity involves a number of factors, specific genetic or epigenetic changes and genomic plasticity associated with cancer are the basis of drug resistance, however, the underlying molecular mechanisms have not been fully elucidated.
Previous studies have shown that the genetic susceptibility genes involved in the metabolism or action of chemotherapeutic drugs, if germline variation occurs, may cause differences in therapeutic efficacy among patients by affecting the apoptotic capacity. The identification of these variants can help facilitate individualized treatment of patients and discover new accurate biomarkers and drug targets. The potential regulatory genetic variation of epirubicin/docetaxel response gene may play an important role in the pathological response of Luminal-type breast cancer neoadjuvant chemotherapy. This study attempted to find effective markers of neoadjuvant chemotherapy response in luminel-type breast cancer.
Disclosure of Invention
We integrated bioinformatics approaches to screen for functional variations that could modulate the epirubicin/docetaxel response gene. A two-stage cohort study was then performed to identify associations of candidate variations with the epirubicin/docetaxel NAC pathological response in luminal breast cancer patients. Finally, biological assays were performed to determine the effect of genetic variation on the efficacy of neoadjuvant chemotherapy containing epirubicin.
In particular, the invention provides the use of an agent for detecting the expression level of ABTB2 in a sample for the manufacture of a tool for predicting the responsiveness of a breast cancer patient to neoadjuvant chemotherapy, i.e. chemotherapy comprising epirubicin.
Specifically, when ABTB2 expression levels were significantly elevated compared to normal controls, the patient was indicated to be resistant to epirubicin.
Specifically, ABTB2 enhances the resistance of tumor cells to epirubicin by inhibiting caspase-3 activation.
Also provided is the use of an agent for detecting the genotyping of rs6484711 in a sample for the preparation of a tool for predicting the responsiveness of a breast cancer patient to neoadjuvant chemotherapy, i.e. chemotherapy comprising epirubicin and docetaxel.
Specifically, the curative effect of the rs6484711 containing allele A on chemotherapy is obviously reduced.
In particular, rs6484711 significantly affected the expression level of ABTB2, and the expression of ABTB2 was significantly higher in patients carrying the GA and AA genotypes of rs6484711 than in patients with the GG genotype.
Preferably, the breast cancer of the present invention is a luminal breast cancer.
Preferably, the reagent for detecting the expression level of ABTB2 in the sample or the reagent for detecting the genotyping of rs6484711 in the sample comprises a reagent required for detecting the expression level of ABTB2 by using a PCR (polymerase chain reaction) and a hybridization sequencing method.
Preferably, the reagent for detecting the expression level of ABTB2 by PCR is the following primer pair: ABTB 2-F: 5'-TGCGGCAAGAACGCCAATG-3' and ABTB 2-R: 5'-ACGGGAGACCAAGTCACTCAGCT-3' are provided.
The invention provides a tool for predicting the responsiveness of a breast cancer patient to neoadjuvant chemotherapy, which is characterized by comprising a reagent for detecting the expression level of ABTB2 and/or a reagent for detecting rs6484711 genotyping, wherein the neoadjuvant chemotherapy refers to chemotherapy containing epirubicin and docetaxel.
In addition, the invention also provides application of rs6484711 in preparing a reagent for regulating the expression level of ABTB2 gene.
Specifically, the GA and AA genotypes of rs6484711 can significantly improve the expression level of ABTB2 compared to the GG genotype.
The invention has the following positive effects:
1. the invention discovers the important value of rs6484711 in the aspect of predicting the sensitivity of chemotherapy, particularly the prediction effect of the novel adjuvant chemotherapy curative effect of Luminal type breast cancer, particularly chemotherapy based on epirubicin and docetaxel for the first time. The physician is aided in determining the chemotherapy regimen for breast cancer patients by predicting their responsiveness to neoadjuvant chemotherapy.
2. The invention discovers for the first time that the expression of ABTB2 has a significant negative correlation with the chemosensitivity of epirubicin. This suggests that ABTB2 plays an important role in response to NAC treatment in tumour patients, especially breast cancer patients.
3. The invention discovers that rs6484711 participates in the epirubicin resistance of a tumor cell line by regulating ABTB2 expression for the first time, and is expected to be used as a target for developing a new therapeutic drug.
4. By providing a prediction of the responsiveness of breast cancer patients, particularly luminal breast cancer patients, to neoadjuvant chemotherapy, more effective and rational patient treatment regimens can be determined based on individual differences.
Drawings
FIG. 1 is the relative reporter gene expression driven by fragments comprising different rs6484711 alleles found in MCF-7 (left panel) and T-47D (right panel) cells. Luciferase activity showed several fold increase in its expression levels relative to cells transfected with the empty vector (pGL 3-Basic). All constructs were co-transfected with PRL-TK to normalize transfection efficiency. Data shown are mean ± standard deviation. From three independent experiments, each experiment had three replicates. P < 0.0001.
Fig. 2 is an eQTL analysis of rs 6484711. In breast cancer tissues, ABTB2 mRNA levels were correlated with rs6484711 genotype (N ═ 65). The levels of ABTB2 mRNA in tissues carrying rs6484711[ GA ] and [ AA ] genotypes were significantly higher than rs6484711[ GG ] genotypes (× P ═ 0.004). Results are expressed as mean ± standard deviation, P values from both sides t test.
FIG. 3 is the effect of ABTB2 on cell viability in epirubicin-treated MCF-7 and T-47D cells. MCF-7(A-B) and T-47D (C-D) cells were treated with epirubicin (0.5. mu.M and 1.0. mu.M, respectively) for 0, 24,48 and 72h, respectively, after 24 hours of transfection with pcDNA-ABTB2 or control vector. (E-F) caspase-3 activity in ABTB2 overexpressing cells and control cells assayed in two breast tumor cell lines treated with 1.0 μ M epirubicin. The experiment was repeated three times with mean ± standard deviation. P <0.05, P <0.01, P < 0.001.
FIG. 4 is a correlation between expression levels of ABTB2 and poor clinical outcome of ER positive breast cancer analyzed by GOBO gene set analysis (A) and Kaplan-Meier mapper database (B).
Fig. 5 is a potential biological functional feature of rs 6484711. Histone modification markers and DNase peaks in breast cancer cells and tissues were obtained from the ENCODE project; the red dashed line is the position of rs 6484711. (this figure is adapted from the WashU Epigenome browser).
Detailed Description
The present invention is further described in detail below with reference to the attached drawings so that those skilled in the art can implement the invention by referring to the description text.
The following examples employ the following statistical analysis: χ of Pearson2Tests (for categorical variables) and Student's t tests (for continuous variables) were used to examine differences between groups with different clinical outcomes in the demographic profile. By Pearson%2The test calculates the distribution of genotype frequencies between groups with different clinical outcomes. After adjusting for clinical factors, associations between candidate SNPs and response to neoadjuvant chemotherapy were estimated by Odds Ratio (OR) and confidence interval (95% CI) using unconditional multivariate logistic regression analysis. All P values were two-sided, and differences with P values less than 0.05 were considered statistically significant. All statistical analyses were performed by statistical analysis system software (version 8.2, SAS Institute, Cary, NC).
Example 1 screening of candidate SNPs
1. Preliminary screening for candidate SNPs
Resistance/sensitivity-associated genes for either epirubicin (NCI No. 256942) or docetaxel (NCI No. 628503) were first screened in the CellMiner database (http:// discover. NCI. nih. gov/cellminier /). 284 epirubicin genes and 228 docetaxel genes were obtained by using gene expression having a pearson correlation coefficient and a growth inhibition value (GI50, a measurement index of cell line sensitivity) of less than-0.4 or more than 0.4 as a standard. In view of redundancy, 511 genes were removed from it and considered as potential biomarkers of resistance or sensitivity. Then, we obtained all SNPs located 5kb upstream and genes in Han's with Minor Allele Frequency (MAF) >0.05 from 1000genome projects (http:// www.1000genomes.org /). Finally, the ANNOVAR software tool was applied to annotate the function of genetic variation and to prioritize 14 SNPs as candidate regulatory SNPs for the following genotyping. Information on candidate SNPs is shown in table 1.
TABLE 1.14 candidate regulatory SNPs
Abbreviations: chr, chromosome; MAF, minor allele frequency; CHB, chinese han nationality of beijing; TF, transcription factor. Pearson's correlation coefficient is based on population size of 60. Positive and negative correlation comparisons (P <0.05) for epirubicin (bolded) or docetaxel treatment are indicated by positive or negative signs. b. Transcription factors are annotated by ENCODE.
2. Selection of the subject
A luminal (HER2 negative) type of breast cancer confirmed by gross needle puncture histopathology in 421 patients >18 years of age at the T1-4N1-3M0 stage (AJCC 7 th edition). The exploration cohort (DC) was 231 breast cancer patients enrolled at the chinese medical academy of medicine oncology hospital in 2015 year 1 to 2016 month 12, and the validation cohort (RC) was 190 patients enrolled at 2017 months 1 and 2017 months 12, including 95 patients from the fourth hospital of the north river medical university and 100 patients at the chinese medical academy of medicine oncology hospital. The molecular subtype of the patient was determined by IHC (immunohistochemistry) and FISH results according to st.gallen guideline 2013 edition.
The tumor tissue is subjected to immunohistochemical staining, and ER and PR positive is defined as that ER and PR staining is more than or equal to 10 percent of tumor cells are positive. The percentage of Ki-67 was determined by immunohistochemistry(0 to 100)%. Human epidermal growth factor receptor-2 (HER2) ranges from 0 to 3+, HER20-2+ is defined as HER2 negative, and when IHC score is 3+, it is defined as overexpression of HER 2. Luminal breast cancer is defined as ER and/or PR positive and HER2 negative. All patients were luminal breast cancer with the protocol: epirubicin 75mg/m2d1, docetaxel 75mg/m2d1, 1 cycle every 21 days. Complete breast magnetic resonance imaging every 2 cycles to evaluate the treatment effect. Pathological complete remission (pCR) is defined as complete disappearance of tumor cells in the mammary and axillary lymph nodes after surgery and clinical Complete Remission (CR) is defined as the imagewise disappearance of tumor foci. In our study, patients with pCR, Complete Remission (CR) and Partial Remission (PR) responses were divided into the active group, and patients with efficacy assessed as disease Stable (SD) and disease Progressive (PD) were divided into the null group. 65.8% (152/231) of the patients in DCs had axillary lymph node metastases or ipsilateral clavicular lymph node metastases, and 69.5% (132/190) in RC. In total 75.5% (318/421) patients, 77.5% (179/231) in DC and 73.2% (139/190) in RC were evaluated for efficacy. The rates of patients with overall population, exploration cohort (DC), validation cohort (RC) assessed as stable or progressive disease were 24.5% (103/421), 22.5% (52/231), 26.8% (51/190), respectively.
Each participant signed an informed consent prior to participation in the study. Blood samples are collected before and after treatment of a patient, and demographic characteristics of the patient including age, obstetric history, first family history of cancer and disease stage, treatment response and side effects and other clinical information are collected. And the side effect data were evaluated according to RECIST criteria version 1.1 and by the NCI-CTC 3.0 scoring system.
The program was approved by the ethical committee of the tumor hospital of the Chinese medical academy of sciences and the fourth hospital of the university of Hebei medical sciences.
As a result: the demographic characteristics of the patients in the two-phase cohort study are shown in table 2. In stage 1, the effective rate of neoadjuvant therapy was 77.5%, the median ages of the effective and ineffective groups were 47.9 years old, the ineffective group was 50.3 years old, and the age distribution of both groups was well matched (P ═ 0.112). 150 patients were Invasive Ductal Carcinoma (IDC) grade I, 36 patients were IDC grade II, 43 patients were IDC grade III, and the remaining 2 patients had unknown corresponding pathological types. There were no statistical differences between the effective and ineffective groups in menopausal status (P0.337), lymph node metastasis (P0.368), bone marrow suppression (P0.085) and gastrointestinal side effects (P0.546). In addition, an effective rate of 73.2% was observed after phase 2 neoadjuvant therapy. The profile was similar between the two groups except for myelosuppression (P > 0.05).
TABLE 2 clinical pathological characteristics of the two-stage patients
3. Genotyping
Genomic DNA was isolated from 2ml of peripheral Blood lymphocytes using the Relax Gene Blood DNA System DP319-02(Tiangen, Beijing, China). The 14 candidate variants were genotyped using the TaqMan Openarray assay system in phase 1 of the study. When the probe design fails or interferes with other polymerase chain reaction primers in the reaction system, the candidate SNPs are replaced by their highly-linkage-disequilibrium (LD) SNPs for genotyping. Each 96 sample array chip contained one NTC (no template DNA) and one replicate sample to verify genotyping accuracy. The average detection rate of candidate SNPs for all genotypes was > 95% and the consensus rate for the repeat group was 100%. In the validation phase, potential SNPs are analyzed by TaqMan real-time Polymerase Chain Reaction (PCR) assays (Applied Biosystems, Foster City, CA) or direct sequencing, without knowing the clinical outcome of the subject. Approximately 5% of random samples from the active and inactive groups were genotyped twice, with 100% agreement.
As a result: in stage 1, as shown in table 3, the association between SNPs with therapeutic effects was evaluated by unconditional logistic regression after adjusting age, menopausal status, lymph node metastasis and side effects. Compared with CG and GG genotypes, the CC genotype of rs1925368 (completely LD with rs 6484711) is significantly associated with poor chemotherapy treatment (recessive model: OR 0.39, 95% CI 0.15-0.98, P0.044). The TT genotype of rs10747780 (with intact LD of rs 184301136) is also significantly associated with low efficacy compared to the CC genotype (OR ═ 0.44, 95% CI ═ 0.22-0.89, P ═ 0.023). Therefore, these two SNPs were selected for validation studies. In the validation stage, only the rs6484711 variant a allele was significantly associated with poor therapeutic efficacy, OR 0.36 (95% CI-0.13-0.96, P-0.041), consistent with stage 1 results (table 4). The combination analysis in table 5 further confirmed that rs6484711 containing allele a had significantly reduced efficacy in chemotherapy (recessive model, OR 0.42, 95% CI 0.23-0.78, P0.006).
TABLE 3 relationship between stage 1 candidate variation and neoadjuvant chemotherapy efficacy
Abbreviations: HW, wild type homozygote; HT, heterozygote; HV, homozygous variant; OR, odds ratio; 95% CI, 95% confidence interval. Important results are shown in bold.
a. Data were calculated by an unconditional logistic regression model after correcting age, climacteric status, lymph node metastasis, bone marrow suppression, gastrointestinal side effects.
Rs1925368 stands for rs6484711 (r)21); rs10747780 represents rs184301136 (r)2＝0.97).
TABLE 4 relationship between stage 2 mononucleotide variation and neoadjuvant chemotherapy efficacy
a. Data were calculated by an unconditional logistic regression model after correcting age, climacteric status, lymph node metastasis, bone marrow suppression, gastrointestinal side effects.
TABLE 5 relationship between rs6484711 and the therapeutic effects of neoadjuvant chemotherapy
a. The effective group comprises participants who respond to the neoadjuvant chemotherapy with pCR, CR or PR; the null group included participants with SD and PD in neoadjuvant chemotherapy. b. The data are calculated by an unconditional logistic regression model after adjusting age, climacteric state, lymph node metastasis, bone marrow suppression and gastrointestinal side effects.
Example 2 biological verification
1. Luciferase reporter assay
Plasmid construction
The DNA fragment containing rs6484711[ G ] or rs6484711[ A ] was subcloned into pGL3-Basic vector (Promega, USA), respectively. The full-length cDNA of ABTB2 was subcloned into pcDNA3.1(+) vector (Invitrogen, USA). All recombinant plasmids were synthesized and sequence verified by Genewiz corporation (suzhou, china).
Cell culture
Human MCF-7 and T-47D BC cell lines were purchased from the Chinese type culture Collection (Wuhan, China). The cell lines were cultured in Dulbecco's Modified Eagle's Medium (DMEM) or Roswell Park Memori Institute (RPMI)1640 Medium (Gibco, USA) supplemented with 10% fetal bovine serum (FBS; Gibco, USA) and 1% antibiotics (100U/mL penicillin and 0.1mg/mL streptomycin) at 37 deg.C in a humidified environment of 5% CO 2. All cell lines were routinely tested for DNA sequencing using an Applied Biosystems AmpF/STR Identifier kit and were tested for mycoplasma-free infection (MycoAlert, USA).
Dual luciferase reporter gene assay
Luciferase reporter gene assays were performed using the dual luciferase reporter kit (Promega) according to the instructions. MCF-7 and T-47D cells were seeded in 96-well plates for 24 hours. Subsequently, the construction vectors with the different alleles rs6484711 and the negative control pGL3-Basic vector were transiently co-transfected into cells with pRL-TK Renilla luciferase vector (Promega) using Lipofectamine 3000reagent (Invitrogen), respectively. Luciferase activity was measured 24 hours after transfection. Relative activity was calculated by the ratio of firefly to Renilla luciferase signal for each sample. Three independent experiments were performed and triplicate wells were transfected in each experiment.
As a result: since variants in the non-coding region may be involved in gene expression regulation, we performed a dual luciferase reporter assay with the pGL3-Basic firefly luciferase expression vector containing a different fragment of the rs6484711 allele. Transfection of these plasmids into MCF-7 and T-47D cells showed significant differences in relative luciferase activity in the cells (FIGS. 1A and B), with the rs6484711[ A ] allele having higher luciferase activity (P <0.0001) than the rs6484711[ G ] allele in both cell lines. These results indicate that rs6484711 may function as a promoter activity that regulates the transcription of ABTB 2.
2. Analysis of the Effect of expression quantitative trait Locus (eQTL) rs6484711 on ABTB2 expression
According to the instructions, total RNA was extracted from tumor tissues of 65 Luminal type patients recruited by the tumor hospital of the Chinese medical science institute using TRIzol LS Reagent (Invitrogen, Carlsbad, Calif., USA) and immediately reverse-transcribed into cDNA by using (PrimeScript RT Master Mix (Kyoto TaKaRa, Japan)). Quantitative PCR (qPCR) was performed using Power SYBR Green PCR Master Mix (TaKaRa) according to the SYBR-Green method on ABI 7900 real-time PCR System (Applied Biosystems, Foster City, Calif., USA). ABTB2 expression was normalized to GAPDH expression. The primers used in qPCR were as follows: ABTB 2-F: 5'-TGCGGCAAGAACGCCAATG-3' and ABTB 2-R: 5'-ACGGGAGACCAAGTCACTCAGCT-3' are provided. Each sample was repeated 2 times to reduce confounding variations. DNA was also extracted from tumor tissue and rs6484711 genotyping was performed as described above.
As a result: by performing eQTL analysis to determine whether rs6484711 is associated with the mRNA expression level of the ABTB2 gene in Luminal-type tumor tissue. The results are shown in fig. 2, rs6484711 significantly affected the expression level of ABTB2 (P ═ 0.004, fig. 2). The expression of ABTB2 was significantly higher in patients with the GA and AA genotype of rs6484711 than in patients with the GG genotype.
3. Effect of ABTB2 on drug resistance of the breast cancer cell line epirubicin
Cell viability assay
MCF-7 and T-47D cells were seeded and plated with the construction vectors containing full-length ABTB2 cDNA or pcDNA3.1(+) vector (control) separately in 12-well flat bottom plates (1X 10 per well)5Individual cells). After 24 hours of incubation, cells were trypsinized and plated in 96-well plates overnight at 37 ℃ with 7X 10 cells per well3And (4) cells. Cells were treated with different concentrations of epirubicin (MedChemexpress) in culture medium for 24,48 and 72 hours. At each time point, cell viability was measured using the CCK-8 kit (Dojindo, Tokyo, Japan) according to the instructions.
Apoptosis detection
Apoptosis was measured by the CCK-8 method described above 24 hours after treatment of cells with 1.0 μ M epirubicin. Cells in 96-well plates were washed with 0-4 ℃ phosphate buffered saline, and then Cell lysis buffer was added (#7018, Cell Signaling Technology, Danvers, MA, USA). Caspase activity assays were performed (Caspase-3 activity assay kit #5723, Cell Signaling Technology, Danvers, MA, USA). Fluorescence was measured at an excitation wavelength of 380nm and an emission wavelength of 460nm and expressed in Relative Fluorescence Units (RFU).
As a result: MCF-7 and T-47D cells were treated with epirubicin for a period of time after overexpression of ABTB 2. Upon exposure to 0.5 μ M epirubicin, MCF-7 cell viability was reduced. However, cell survival was significantly increased in the ABTB 2-overexpressed MCF-7 cells compared to the control group (fig. 3A). Furthermore, epirubicin resistance was more pronounced in MCF-7 cells with overexpression of ABTB2 when treated with 1.0 μ M epirubicin (FIG. 3B), with consistent results also being observed in the ABTB2 overexpressed T-47D cell line from D2-D4 (FIGS. 3C, 3D).
Furthermore, to explore whether ABTB2 helped to enhance resistance to epirubicin-induced apoptosis, we evaluated caspase-3 activity in MCF-7 and T-47D cells in the presence of epirubicin. After overexpression of ABTB2, cells were treated with 1.0 μ M epirubicin for 24h, which we detected that epirubicin significantly activated caspase-3 in both cell lines. However, cells transfected with ABTB2 significantly inhibited caspase-3 activation compared to the control group (FIG. 3E, 3F). Thus, ABTB2 overexpression significantly enhanced the resistance of MCF-7 and T-47D cells to epirubicin.
Furthermore, we observed by analysis of the GOBO gene set that ABTB2 expression correlates with overall survival in 560 ER positive breast cancer patients (fig. 4A) and similar results were found in the Kaplan-Meier Plotter database (fig. 4B), indicating that ABTB2 correlates with progression and poor prognosis of ER + tumors. Thus, our results indicate that ABTB2 negatively affected epirubicin-induced apoptosis as a drug resistant protein and mediated resistance to epirubicin in MCF-7 and T-47D cells.
To summarize: by population-based two-stage association analysis, we found that patients carrying the a allele of rs6484711 had poor therapeutic effect compared to the G allele carriers. rs6484711 is a potential marker to guide individualized treatment of NAC. By bioinformatics analysis, rs6484711 was located in the ChIP-seq peaks of histone markers, such as H3K4me3 and H3K27ac, and active chromatin accessibility (fig. 5), suggesting that rs6484711 may have potential promoter-like effects. This is consistent with a reporter assay, where the rs6484711A allele regulates gene expression by activating the gene promoter, whereas such effects are not observed with the G allele. eQTL analysis is an effective strategy to assess whether expression levels of candidate genes are affected by variants, and thus may account for the biological relevance of non-coding variants. Genotype-dependent analysis of the association analysis in tumor tissues showed that the rs6484711 polymorphism has a regulatory effect on the expression of ABTB 2. Taken together, these results indicate that the functional promoter element of rs6484711 significantly interferes with the response of tumor cells to the epirubicin-containing regimen NAC by modulating ABTB 2.
We detected that ABTB2 expression was significantly negatively correlated with the chemosensitivity of epirubicin (r ═ 0.418). This suggests that ABTB2 may play an important role in tumor response to NAC treatment. The protein product encoded by the ABTB2 gene is an ankyrin repeat and a BTB/POZ domain-containing protein. In this study, we found that overexpression of ABTB2 promotes resistance of cells to epirubicin by reducing apoptosis. In summary, the present study demonstrates that the variant of rs6484711 is involved in epirubicin resistance in MCF7 and T47D cell lines by modulating ABTB2 expression. The research result deepens the understanding of the effect of genetic variation in the chemotherapy resistance of breast cancer cells, and suggests that the rs6484711 has important value in predicting the chemotherapy sensitivity, so that the method is helpful for supplementing the indications of new adjuvant chemotherapy and is expected to be used as the target of developing new therapeutic drugs.
While embodiments of the invention have been disclosed above, it is not intended to be limited to the uses set forth in the specification and examples. It can be applied to all kinds of fields suitable for the present invention. Additional modifications will readily occur to those skilled in the art. It is therefore intended that the invention not be limited to the exact details and illustrations described and illustrated herein, but fall within the scope of the appended claims and equivalents thereof.
Sequence listing
<110> tumor hospital of Chinese medical science institute
<120> marker for predicting neoadjuvant chemotherapy efficacy in breast cancer patients and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgcggcaagaacgccaatg 19
<210> 2
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
acgggagaccaagtcactcagct 23
Claims (5)
1. Use of an agent for detecting genotyping of rs6484711 in a sample for the preparation of a tool for predicting the responsiveness of a breast cancer patient to neoadjuvant chemotherapy, said neoadjuvant chemotherapy being chemotherapy comprising epirubicin, said breast cancer being luminal HER2 negative breast cancer.
2. The use of claim 1, wherein the neoadjuvant chemotherapy further comprises docetaxel.
3. Use according to claim 1 or 2, characterized in that: the curative effect of the patient containing rs6484711 allele A on chemotherapy is obviously reduced.
4. Use according to claim 1 or 2, characterized in that: rs6484711 significantly affects the expression level of ABTB2, patients carrying the GA and AA genotypes of rs6484711, and the expression of ABTB2 is significantly higher than those with the GG genotype.
5. The use of claim 1 or 2, wherein the reagent for detecting the genotyping of rs6484711 in the sample comprises a reagent required for detection by PCR or sequencing by hybridization.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911254411.2A CN110923318B (en) | 2019-12-10 | 2019-12-10 | Marker for predicting neoadjuvant chemotherapy curative effect in breast cancer patient and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201911254411.2A CN110923318B (en) | 2019-12-10 | 2019-12-10 | Marker for predicting neoadjuvant chemotherapy curative effect in breast cancer patient and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110923318A CN110923318A (en) | 2020-03-27 |
| CN110923318B true CN110923318B (en) | 2022-02-11 |
Family
ID=69857867
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201911254411.2A Active CN110923318B (en) | 2019-12-10 | 2019-12-10 | Marker for predicting neoadjuvant chemotherapy curative effect in breast cancer patient and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110923318B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005174A (en) * | 2021-03-01 | 2021-06-22 | 中国医学科学院肿瘤医院 | Marker for predicting cancer patient response to chemotherapy and application |
| CN113061655B (en) * | 2021-03-25 | 2022-04-19 | 中国科学院合肥物质科学研究院 | Gene labels for predicting breast cancer neoadjuvant chemotherapy sensitivity and application thereof |
| CN115762801B (en) * | 2022-05-13 | 2024-01-23 | 中国医学科学院肿瘤医院 | Peripheral blood lipid metabolism biomarker for predicting new adjuvant therapy response of breast cancer and application |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014087294A2 (en) * | 2012-12-03 | 2014-06-12 | Koninklijke Philips N.V. | Predictive outcome assessment for chemotherapy with neoadjuvant bevacizumab |
-
2019
- 2019-12-10 CN CN201911254411.2A patent/CN110923318B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2014087294A2 (en) * | 2012-12-03 | 2014-06-12 | Koninklijke Philips N.V. | Predictive outcome assessment for chemotherapy with neoadjuvant bevacizumab |
Non-Patent Citations (2)
| Title |
|---|
| Submitted SNP(ss) Details_ss1340788947-rs6484711;NCBI;《dbSNP》;20140816;第1-2页 * |
| 乳腺癌分子分型对多西他赛联合表阿霉素新辅助化疗疗效和预后的预测价值;齐创等;《中国肿瘤临床与康复》;20160120;第23卷(第1期);第17-21页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110923318A (en) | 2020-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Lu et al. | Potential clinical application of lncRNAs in non-small cell lung cancer | |
| Zhu et al. | MEG3 activated by vitamin D inhibits colorectal cancer cells proliferation and migration via regulating clusterin | |
| Wu et al. | Genome-wide association study identifies common variants in SLC39A6 associated with length of survival in esophageal squamous-cell carcinoma | |
| Lee et al. | MicroRNA expression in ovarian carcinoma and its correlation with clinicopathological features | |
| Zhu et al. | Overexpression of HE4 (human epididymis protein 4) enhances proliferation, invasion and metastasis of ovarian cancer | |
| Duan et al. | Positive expression of KIF20A indicates poor prognosis of glioma patients | |
| CN110923318B (en) | Marker for predicting neoadjuvant chemotherapy curative effect in breast cancer patient and application thereof | |
| JP2020503850A (en) | Method for distinguishing tumor suppressive FOXO activity from oxidative stress | |
| Yan et al. | Long noncoding RNA NBAT-1 suppresses tumorigenesis and predicts favorable prognosis in ovarian cancer | |
| Li et al. | LncRNA HOTAIRM1/HOXA1 axis promotes cell proliferation, migration and invasion in endometrial cancer | |
| Zhao et al. | Identification of serum miRNA-423-5p expression signature in somatotroph adenomas | |
| Han et al. | Novel lncRNA UPLA1 mediates tumorigenesis and prognosis in lung adenocarcinoma | |
| Li et al. | Upregulation of the long non-coding RNA FOXD2-AS1 is correlated with tumor progression and metastasis in papillary thyroid cancer | |
| Gao et al. | TOP2A promotes tumorigenesis of high-grade serous ovarian cancer by regulating the TGF-β/Smad pathway | |
| Cui et al. | Pan-cancer analysis identifies ESM1 as a novel oncogene for esophageal cancer | |
| Zhu et al. | Evaluation of MiR-1908-3p as a novel serum biomarker for breast cancer and analysis its oncogenic function and target genes | |
| Li et al. | BTG1 inhibits malignancy as a novel prognosis signature in endometrial carcinoma | |
| Yu et al. | A novel LncRNA, AC091729. 7 promotes sinonasal squamous cell carcinomas proliferation and invasion through binding SRSF2 | |
| Omid‐Shafaat et al. | Serum Circ‐FAF1/Circ‐ELP3: a novel potential biomarker for breast cancer diagnosis | |
| Piao et al. | A novel tumor suppressing gene, ARHGAP9, is an independent prognostic biomarker for bladder cancer | |
| Zahra et al. | Determining KLF14 tertiary structure and diagnostic significance in brain cancer progression | |
| Wu et al. | CDH3 is associated with poor prognosis by promoting the malignancy and chemoresistance in oral squamous cell carcinoma | |
| CN116113712A (en) | Prognostic biomarkers for cancer | |
| Soltani et al. | LncRNA DLGAP1-AS2 overexpression associates with gastric tumorigenesis: a promising diagnostic and therapeutic target | |
| Liu et al. | MicroRNA-223-5p targets long non-coding RNA TP73 antisense RNA1 to promote the invasion of gastric cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |